CN107177612B

CN107177612B - Externally tangent type alginate lyase, gene and application thereof

Info

Publication number: CN107177612B
Application number: CN201710367707.XA
Authority: CN
Inventors: 朱艳冰; 郭玉淅; 倪辉; 肖安风; 李利君; 姜泽东; 杜希萍
Original assignee: Jimei University
Current assignee: Jimei University
Priority date: 2017-05-23
Filing date: 2017-05-23
Publication date: 2020-05-22
Anticipated expiration: 2037-05-23
Also published as: CN107177612A

Abstract

The invention discloses an exo-type alginate lyase, a gene and application thereof. The invention clones a new alginate lyase gene algl17 from marine bacterium microvesicle bacteria ALW1, the size is 2220 bp, 739 amino acids are coded, and the protein classification is classified as PL-17 family. Coli to obtain recombinant AlgL17 with molecular weight of about 85 kDa. The enzyme has activity on sodium alginate, D-polymannuronic acid (polyM) and algin oligose, and has lower activity on L-polyguluronic acid (polyG), which indicates that the recombinase is polyM specificity oligoalgin lyase. The recombinant AlgL17 can act on sodium alginate to generate 4-deoxy-L-erythro-5-hexosyluronic acid (DEH), and the enzyme is an exo-type alginate lyase. The recombinant enzyme can directly degrade kelp to produce reducing sugar. The invention successfully constructs the recombinant vector containing the novel alginate lyase gene, realizes heterologous expression and provides a good foundation for industrial production and application of the novel alginate lyase gene.

Description

Externally tangent type alginate lyase, gene and application thereof

Technical Field

The invention relates to the technical field of genetic engineering and enzyme engineering, in particular to an exo-type alginate lyase, a gene and application thereof.

Background

Brown algae is an important economic alga, and representative plants comprise kelp, carrageen, gulfweed and the like, the brown algae contains polysaccharides such as algin, brown alginate starch, fucoidan and the like, and accounts for 40-80% of the dry weight of the defatted brown algae, wherein the algin is the most abundant, the brown alginate is a linear high molecular polymer formed by connecting β -D-mannuronic acid and a C5 epimer α -L-guluronic acid monomer through β -1,4 glycosidic bonds, and is widely applied to the fields of food, medicine, chemical industry and the like.

The algin lyase is used for producing algin oligosaccharide by β -eliminating reaction, the algin lyase can be used as an internal cutting type for cutting polysaccharide and can also be used as an external cutting type for cutting the tail end of algin or algin oligosaccharide, the algin lyase has the advantages of high efficiency, mild degradation condition, difficult damage of hydrolysis products, simple recovery process, no environmental pollution and the like, and provides a new means for the research and application of algin oligosaccharide in the aspects of functional foods, multifunctional cosmetics, new product medicaments and the like.

The alginate lyase is mainly derived from various microorganisms, marine algae, marine mollusks, echinoderms and the like. The inventor researches and designs an exo-type alginate lyase from Microbulbifer ALW1(Microbulbifer sp. ALW1), a gene and application thereof, and the gene is generated.

Disclosure of Invention

The invention aims to provide an exo-type alginate lyase, a gene and application thereof, wherein the exo-type alginate lyase can be used for producing monosaccharide and oligosaccharide and can be applied to the fields of food, medicine, chemical industry, energy and the like.

In order to achieve the purpose, the technical scheme adopted by the invention for solving the technical problem is as follows:

the nucleotide sequence of the gene for coding the circumscribed algin lyase AlgL17 is shown as SEQ ID NO. 1. The gene size was 2220 bp.

An exo-type alginate lyase AlgL17, the amino acid sequence of which is shown in SEQ ID NO. 2. This protein encodes 739 amino acid residues.

An expression vector of alginate lyase, which contains an expression vector pET-28a-AlgL17 of the circumscribed alginate lyase AlgL17 gene.

A process for preparing alginate lyase includes such steps as transforming host cell with said expression carrier containing alginate lyase gene, culturing the transformant, and obtaining recombinant alginate lyase from the culture. Of course, the alginate lyase AlgL17 gene can also be transfected into suitable eukaryotic hosts, including yeast and mammalian cells.

As a preferred mode of embodiment, the host cell is Escherichia coli.

As a preferable mode of the embodiment, the recombinant alginate lyase is obtained by transforming the expression vector containing the alginate lyase gene into a host cell, namely escherichia coli BL21(DE3) and inducing the host cell with IPTG.

As a preferred mode of embodiment, the final concentration of IPTG is 0.1mmol/L and the induction temperature is 18 ℃.

A recombinant alginate lyase comprises transforming a host cell by using the expression vector containing the alginate lyase gene, culturing a transformant, and obtaining a recombinase from a culture.

As a preferable mode of the embodiment, the optimal reaction temperature of the recombinant alginate lyase is 35 ℃ by taking sodium alginate as a substrate, and the optimal reaction pH is 8.0. Recombinant AlgL17 was stable at 25 ℃ and unstable at 30 ℃ and 35 ℃. The enzyme has good stability at pH 5.0-8.0. By investigating different concentrations of Na⁺The effect on the enzyme activity, as a result, Na⁺The inhibitors EDTA, &lTtT transfer = beta "&gTt beta &lTt/T &gTt-ME and DTT can inhibit the activity of the recombinase, the enzyme has good resistance to Triton X-100, Tween20 and Tween 80.

The recombinant AlgL17 has activity on sodium alginate, polyM and alginate oligosaccharides, and has lower activity on polyG, which indicates that the recombinant enzyme is polyM specific oligoalginate lyase. The recombinase can act on sodium alginate to generate DEH, and the enzyme is an externally tangent type alginate lyase. In addition, the recombinant enzyme can directly degrade the kelp to produce reducing sugar.

The novel alginate lyase AlgL17 gene is obtained by cloning from microvesicle bacteria ALW1(Microbulbifer sp. ALW1), and the application potential of the enzyme protein coded by the gene in the fields of food, medicine, chemical industry, energy and the like is discovered. Meanwhile, the invention clones and obtains engineering bacteria capable of expressing a large amount, can realize the large-scale production of the algin lyase and provides a good foundation for the subsequent industrial application.

Drawings

FIG. 1 is a SDS-PAGE graph showing the induced expression and purification detection of alginate lyase AlgL 17; wherein, 1: a molecular weight standard protein; 2: inducing by IPTG with pET-28a (+) negative bacteria; 3: contains pET-28a-algl17 positive bacteria and is not induced; 4: inducing by IPTG with pET-28a-algl17 positive bacteria; 5: purified recombinant protein;

FIG. 2 is a graph showing the effect of temperature on the activity and stability of recombinant alginate lyase AlgL 17; a: the effect of temperature on the activity of the recombinant enzyme; b: the effect of temperature on the stability of the recombinant enzyme;

FIG. 3 is a graph showing the effect of pH on the activity and stability of recombinant alginate lyase AlgL 17;

FIG. 4 is a graph showing the effect of metal ions on the activity of recombinant alginate lyase AlgL 17; a: the effect of different metal ions on the activity of the recombinant enzyme; b: na (Na)⁺The effect on the activity of the recombinant enzyme;

FIG. 5 is a diagram showing the substrate specificity analysis of recombinant alginate lyase AlgL 17;

FIG. 6 is an analysis chart of the enzymatic hydrolysate of sodium alginate by recombinant alginate lyase AlgL 17; a: performing liquid chromatography analysis after the sodium alginate enzymolysis treatment; b: performing liquid chromatographic analysis on sodium alginate without enzymolysis; c: mass spectrometry of the product at the 5.28min main peak; d: mass spectrometry of the product at the main peak at 6.94 min;

FIG. 7 is an analysis chart of the recombinant alginate lyase AlgL17 acting on kelp powder.

Detailed Description

Example 1: construction of recombinant expression plasmid and recombinant strain of alginate lyase AlgL17 gene

Extracting the genome of microvesicle bacteria ALW1(Microbulbifer sp. ALW1) by using a bacterial genome extraction kit (TaKaRa), and amplifying an alginate lyase AlgL17 gene by using a gene-specific primer of the enzyme:

upstream primer (SEQ ID NO. 3): 5'-CGCGGATCCGTTGAACATCCCAACCTGGTGATCG-3', respectively;

downstream primer (SEQ ID NO. 4): 5'-CCGCTCGAGGTTAGTAATTTGGAAGAGTTTTGCG-3', respectively;

the PCR reaction conditions are as follows: 5min at 95 ℃; 94 ℃ for 45sec, 50 ℃ for 45sec, 72 ℃ for 2min, 30 cycles; 10min at 72 ℃. After the PCR product was detected by agarose gel electrophoresis, the target gene was recovered by tapping, the product was ligated with pET-28a (+) vector after digestion with BamHI and XhoI, the target gene was inserted into pET-28a (+) vector, and the resulting construct was named pET-28a-algl 17. Once the gene sequence was confirmed by sequencing, the recombinant plasmid was introduced into E.coli BL21(DE 3).

Example 2: recombinant alginate lyase expressed and purified by recombinant expression strain

After overnight culture of the recombinant expression strain, the volume ratio of the recombinant expression strain to the culture medium is 1: 100 was transferred to 250mL of LB liquid medium (containing 50. mu.g/mL kanamycin), cultured at 37 ℃ at 180r/min until the OD600 reached 0.8, added with IPTG at a final concentration of 0.1mmol/L, and cultured at 18 ℃ at 180r/min for 20 hours. The cells were collected by centrifugation at 6,000 Xg for 10 min. Cells were resuspended in binding buffer (50mmol/L NaH)₂PO₄300mmol/L sodium chloride, 15mmol/L imidazole, pH 8.0) on ice. Centrifuging at 4 deg.C at 18,000 Xg for 20min, collecting supernatant, performing Ni-NTA affinity chromatography, and washing with washing buffer (50mmol/L NaH)₂PO₄300mmol/L NaCl, 30mmol/L imidazole, pH 8.0) and then eluted with elution buffer (50mmol/L NaH)₂PO₄300mmol/L sodium chloride, 250mmol/L imidazole, pH 8.0) and collecting the eluate. The molecular weight of the recombinant protein was 85kDa by SDS-PAGE after dialyzing the obtained recombinant alginate lyase AlgL17 against 50mmol/L sodium phosphate buffer (pH 8.0), as shown in FIG. 1. The protein concentration was determined using the BCA protein assay kit (Pierce, USA) and the concentration of the recombinase was about 0.6 mg/mL.

Example 3: activity detection of alginate lyase

The activity of alginate lyase was detected by measuring the amount of released reducing sugar using 3, 5-dinitrosalicylic acid (DNS) method. The method comprises the following specific operations: mu.L of the enzyme solution (0.6mg/mL) was added to 390. mu.L of 50mmol/L sodium phosphate buffer solution (pH 8.0) containing 2.5mg/mL sodium alginate, incubated at 35 ℃ for 10min, added 400. mu.L of DNS reagent, and heated in a boiling water bath at 100 ℃ for 10min to terminate the reaction. After cooling to room temperature, the amount of reducing sugars released was monitored at 540nm using an Epoch2T spectrophotometer (BioTeK, USA). One unit of alginate lyase activity is defined as the amount of enzyme required to release 1. mu. moL of reducing sugar per minute under the assay conditions.

Example 4: effect of temperature and pH on recombinant alginate lyase AlgL17

The optimum reaction temperature of the alginate lyase is determined within the range of 25-60 ℃, and the specific operation is as follows: the system used above was used, and the reaction was carried out at 25, 30, 35, 40, 45, 50, 55 and 60 ℃ for 10min, and the absorbance at 540nm was measured. The results of the assay (FIG. 2A) show that the optimum reaction temperature of alginate lyase AlgL17 is 35 deg.C, and exhibits more than 60% of the maximum activity in the temperature range of 25-45 deg.C, and almost no activity at 60 deg.C. The enzyme thermostability assay was performed at 25, 30 and 35 ℃. The specific operation is as follows: treating the purified enzyme solution at different temperatures for 10-60 min. After heat treatment the samples were cooled immediately on ice. The residual activity of the enzyme was measured by the standard method described, and defined as the untreated enzyme activity as 100%. The assay results (FIG. 2B) show that the enzyme is relatively stable at 25 ℃. Treatment at 30 ℃ for 30min resulted in a loss of 84% of its relative enzyme activity. The enzyme had little activity after heat treatment at 35 ℃. These results indicate that the recombinant enzyme is heat-labile.

The optimum reaction pH of the alginate lyase is determined within the range of 4.0-11.0. The buffers used for the assay were: 50mmol/L citric acid buffer (pH 4.0-6.0), 50mmol/L sodium phosphate buffer (pH 7.0-8.0), 50mmol/L barbiturate sodium-HCl (pH 8.5-9.0), and 50mmol/L glycine-NaOH (pH 9.5-11.0). The results of the assay (FIG. 3) show that the optimum reaction pH of alginate lyase AlgL17 is 8.0, and the enzyme shows more than 30% of the maximum activity in the pH range of 7.5-9.0. The pH stability of the alginate lyase was determined in the range of 4.0-11.0. The specific operation is as follows: after incubation of the enzyme in buffers at different pH values for 1h at 25 ℃ the residual activity of the enzyme was determined and defined as 100% of the untreated enzyme activity. The assay results (FIG. 3) show that the recombinant enzyme maintains stability at a pH range of 5.0-8.0 of more than 50% of the initial activity and retains 18% of residual activity at pH 9.5.

Example 5: effect of additives on the Activity of recombinant alginate lyase AlgL17

Adding different metal salt ions with final concentration of 1mmol/L or 10mmol/L into alginate lyase respectively, includingNaCl、KCl、 CaCl₂、MgCl₂、FeCl₂、CuCl₂、CoCl₂、MnCl₂、BaCl₂、CdCl₂And ZnCl₂. After being placed at 25 ℃ for 1h, the residual activity of the enzyme is determined, and the enzyme activity without adding metal ions is 100 percent. The results of the measurement (FIG. 4A) show that Fe²⁺、Cu²⁺、 Co²⁺、Mn²⁺、Ba²⁺、Cd²⁺And Zn²⁺Will inhibit the activity of enzyme, Cd²⁺And Zn²⁺The effect of (a) is significant. 1mmol/L of K⁺、Ca²⁺And Mg²⁺Has no influence on the activity of the enzyme, and has an inhibiting effect under the condition of 10 mmol/L. 1mmol/L and 10mmol/L Na⁺Can promote enzyme activity. Further investigation of different concentrations of Na⁺Effect on enzyme Activity, the results (FIG. 4B) show that 0.7mol/L NaCl was the most active with 170% relative activity, but the enzyme activity was inhibited at 1.0mol/L NaCl. These results indicate that the recombinant alginate lyase is Na⁺An activated enzyme.

The enzyme activity was determined to be residual activity after standing at 25 ℃ for 1h by adding an inhibitor (including EDTA, β -ME and DTT) and a detergent (including SDS, Triton X-100, Tween20, Tween 80 and CTAB) at a final concentration of 1mmol/L or 10mmol/L and 0.1% (w/v or v/v) or 1% (w/v or v/v), respectively, to the alginate lyase, with the enzyme activity being 100% without the addition of the inhibitor or detergent, as shown in Table 1, EDTA, β -ME and DTT all showed inhibitory effects on the enzyme activity at both concentrations tested.

TABLE 1 Effect of inhibitors and detergents on recombinant alginate lyase Activity

Example 6: substrate specificity of recombinant alginate lyase AlgL17

The substrate specificity of the enzyme was studied by measuring the activity of alginate lyase by analyzing the absorbance at 235nm using 2mg/mL sodium alginate, polyM, polyG and alginate-derived oligosaccharides (3.3kDa) as substrates, respectively. The specific operation is as follows: to 8mL of each substrate solution, 100. mu.L of an enzyme solution (0.6mg/mL) was added and reacted at 35 ℃ for 90 min. The amount of unsaturated uronic acid produced was reflected by measuring the absorbance of the reaction mixture at 235nm using a UV-5200 spectrophotometer (Shanghai Meta analysis instruments, Ltd.). The results (FIG. 5) show that the recombinant alginate lyase has activity on polyM, sodium alginate and alginate oligosaccharides, but shows very low activity on polyG. These results indicate that the recombinase is a polyM-specific oligoalginate lyase.

Example 7: analysis of enzymolysis product of recombinant alginate lyase AlgL17 on sodium alginate

Alginate lyase (6U) is added into 30mL of 5.0mg/mL sodium alginate substrate solution, and the reaction is carried out at 35 ℃. Samples were taken every 1h and the amount of reducing sugars released was determined by the DNS method. After 8h of reaction, 3U of alginate lyase was added to the reaction mixture, and the reaction was continued at the same temperature for 9h without change in the amount of reducing sugar released. The reaction was terminated by heating the mixture in boiling water for 10min, followed by cooling on ice for 5 min. After centrifugation at 18,000 Xg for 20min at 4 ℃ the supernatant was collected as a hydrolysate sample. The enzymatic products were identified using an ACQUITY HPLC/MALDI SYNAPT Q-TOF MS (Waters, USA) equipped with an ACQUITY BEH C18 column (2.1X 150mm, 1.7 μm). The two mobile phases are solution a: 0.1% (v/v) aqueous formic acid solution, solution B: acetonitrile, gradient flow rate 0.3 mL/min. Mass spectra were obtained using a SYNAPT Q-TOF mass detector (Waters). The results (fig. 6) show that liquid chromatography of the recombinant AlgL17 degraded sodium alginate product showed two major peaks at retention times of 5.28min and 6.94min (fig. 6A), whereas the undecomposed sodium alginate did not show these peaks (fig. 6B). Measuring the product in the main peak by MS, and measuring the mass-to-charge ratio of the product in a negative ion modeIon Peak [ DPx-H ] appearing in Degree of Polymerization (DPs) (m/z)]^—(x is 1(175m/z), 2(351 m/z), 3(527m/z), 4(703m/z) and 5(879m/z), respectively. The mass spectrometry results (FIGS. 6C-D) show that the recombinant AlgL 17-mediated degradation products of sodium alginate are DEH, disaccharides, trisaccharides, and tetrasaccharides.

Example 8: recombinant alginate lyase AlgL17 acting on kelp powder

After washing the kelp pieces in distilled water, the dried samples were ground into powder. The powder was added to 50mmol/L sodium phosphate buffer (pH 8.0) to prepare 5mg/mL of a kelp powder substrate. 6U alginate lyase was added to 30mL of the substrate, and the enzymatic reaction was carried out at 35 ℃ with sampling every 1 hour. The reaction was terminated by heating the sample in a boiling water bath for 5min and then cooling on ice for 5 min. After centrifugation at 18,000 Xg for 20min at 4 ℃ the amount of reducing sugars released in the supernatant was determined by the DNS method. After 6h of reaction, 3U of alginate lyase is added into the reaction mixture, and the reaction is continued for 14h at the same temperature, wherein the release amount of reducing sugar is not changed. Substrates without recombinase treatment were used as negative controls. The results (fig. 7) show that the concentration of reducing sugars increases with the treatment time. The released reducing sugars stabilized after 20h of treatment of the substrate (150mg) with recombinant AlgL17, and reached an amount of about 16 mg. These results indicate that the recombinant alginate lyase AlgL17 can act on the kelp to produce reducing sugar.

In conclusion, the novel alginate lyase AlgL17 gene is obtained by cloning from Microbulbifer sp. ALW1, and the enzyme protein encoded by the gene is found to degrade sodium alginate to generate monosaccharide and oligosaccharide, degrade kelp powder to generate reducing sugar, and can be applied to the fields of food, medicine, chemical industry, energy and the like. Meanwhile, the invention clones and obtains engineering bacteria capable of expressing a large amount, can realize the large-scale production of the algin lyase and provides a good foundation for the subsequent industrial application.

All modifications which can be derived or suggested by a person skilled in the art from the present disclosure are to be considered within the scope of the invention.

SEQUENCE LISTING

<110> college university

<120> exo-type alginate lyase, gene and application thereof

<160>4

<170>PatentIn version 3.3

<210>1

<211>2220

<212>DNA

<213> Microbulbifer sp.)

<400>1

atgtttggta aatttttctt taaccagcgt aaagctctgt ccgccgccgt cgcggtgctg 60

gcaatggctc cattgtcggg acttgccgtt gaacatccca acctggtgat cgacgccgca 120

gacgtggatg ccatgcaagg cgcggtagca aaacccggtc gctttcgcag cgcatttctc 180

gcgtccaaat cagcggtaga ccatgcgctg caagtgccac tggcggtacc agtgcccacc 240

gacgcgggtg gaggctatac ccacgagcag cacaaaaaga actatcagct gatgtacaac 300

gctggcgtgc tttatcagat taccgaagat cccaaatatg cggaacgcgt gcgggatatg 360

ctgctggctt atgccgatct gtaccctacc ctgccgctcc atcccaagcg tcgcccgggg 420

gcagaaaatc ccggcaagct gttctggcag agcctgaatg aagcggtttg gctggtgtac 480

accatccagg cctacgatct gattcgccct tcattgtcca atgcagaagc agaaaaaatc 540

gaacagggtg cgctgcgccc ggtggctaaa tttctttccg tagaatcccc ggccaccttc 600

aacaaggtgc ataaccacgg cacctggttg accgccggag tgggtatggc gggctatgta 660

ttggacgagc cagagtgggt tgagcaggcg ctcctcgacc tggacaagtc cggcaagggt 720

ggcttccttc gccagctgaa caccctgttc tcaccggatg gctactacaa cgaaggtccc 780

tactaccagc gctacgcgct gatgccattt gtcaccttcg ccaaagcgat cgaaaacaac 840

gagccggaac ggggcatttt caagtaccgc gatggcattg tgatgaaggc catcgatacc 900

accatccagc tcagctacaa caatctgttt ttcccgatca acgatgccat caagagtaaa 960

ggcatcgaca cctcggagct ggtgctgggc gtcaccattg cctatggcga gtccggcaat 1020

ccacaactgc tggatatcgc cgacagacag catcagattc tgttgtccgg tgacggcctc1080

aaggttgcgc agggactcga cgccggcgca ctacagcctt acccgttcaa gtctttcgcc 1140

ttccgcgatg gaaaggacgg cgacgaaggc gcactggttg tgctgcgcca gcaaaccgac 1200

ggcgaccagg cgttagtgtt caagccagcc gctcagggca tgggccacgg tcactttgac 1260

cgcttcctga atgtggaagc caaaaatggc ggccgctatc tgcaagaaaa cgaaacctgg 1380

gccaagcaga ccattgcgca caacacggtg gtggtggacg agacctccca cttcgacaac 1440

aacctgaaaa tcgcaaacag gaaccatcct gagttgctgt tcttccacgc ggatgaccag 1500

gtcaaaatca gtgcggcaga aatcgattcc gcctatcccg gtgtcagctt gaaacgcact 1560

ctggcgctcg ttaacaaccc ggagagcggc aatagcttcg ccatcgatgt gttcggtgtg 1620

gaatccagcc agaaacacca gttggacctt cctttgcact acaacggcca gctggtggat 1680

accaatttca ggttgcaggg ctttaccgac agtctcaagg cactgggtac caacaatggc 1740

taccagcacc tttggctcaa agcccgcggc aaaccggatt ccggactggc acaggtcacc 1800

tggctgaacg acaacggccg tttctatacc caatccagcc tggtagacgg caaaaccgag 1860

ctgttgttca ccgagctggg cgccaacgat cccaacttca acctgcgctc cgaaaaaggc 1920

tttatcgctc gccgcaatgg tgcgcgttca catacctttg taagcgtgtt ggagccccat 1980

ggcgagtaca acccgtccaa ggaatttacc ctggaggcgg aaagccaagt gcaggcgcta 2040

cagcatcggc aggccggtga cctcgaactg atcgccatcg gcatcaagaa cggtgccaca 2100

cagctgcttg cgtacaaccg cagtagcaat gtgccagaag aactcgaaaa catttttgaa 2160

tatgacggcc gtaagtacca gttcactggc cgcgcaaaac tcttccaaat tactaactga 2220

<210>2

<211>739

<212>PRT

<213> Microbulbifer sp.)

<400>2

Met Phe Gly Lys Phe Phe Phe Asn Gln Arg Lys Ala Leu Ser Ala Ala

1 5 10 15

Val Ala Val Leu Ala Met Ala Pro Leu Ser Gly Leu Ala Val Glu His

20 25 30

Pro Asn Leu Val Ile Asp Ala Ala Asp Val Asp Ala Met Gln Gly Ala

35 40 45

Val Ala Lys Pro Gly Arg Phe Arg Ser Ala Phe Leu Ala Ser Lys Ser

50 55 60

Ala Val Asp His Ala Leu Gln Val Pro Leu Ala Val Pro Val Pro Thr

65 70 75 80

Asp Ala Gly Gly Gly Tyr Thr His Glu Gln His Lys Lys Asn Tyr Gln

85 90 95

Leu Met Tyr Asn Ala Gly Val Leu Tyr Gln Ile Thr Glu Asp Pro Lys

100 105 110

Tyr Ala Glu Arg Val Arg Asp Met Leu Leu Ala Tyr Ala Asp Leu Tyr

115 120 125

Pro Thr Leu Pro Leu His Pro Lys Arg Arg Pro Gly Ala Glu Asn Pro

130 135 140

Gly Lys Leu Phe Trp Gln Ser Leu Asn Glu Ala Val Trp Leu Val Tyr

145 150 155 160

Thr Ile Gln Ala Tyr Asp Leu Ile Arg Pro Ser Leu Ser Asn Ala Glu

165 170 175

Ala Glu Lys Ile Glu Gln Gly Ala Leu Arg Pro Val Ala Lys Phe Leu

180 185 190

Ser Val Glu Ser Pro Ala Thr Phe Asn Lys Val His Asn His Gly Thr

195 200 205

Trp Leu Thr Ala Gly Val Gly Met Ala Gly Tyr Val Leu Asp Glu Pro

210 215 220

Glu Trp Val Glu Gln Ala Leu Leu Asp Leu Asp Lys Ser Gly Lys Gly

225 230 235 240

Gly Phe Leu Arg Gln Leu Asn Thr Leu Phe Ser Pro Asp Gly Tyr Tyr

245 250 255

Asn Glu Gly Pro Tyr Tyr Gln Arg Tyr Ala Leu Met Pro Phe Val Thr

260 265 270

Phe Ala Lys Ala Ile Glu Asn Asn Glu Pro Glu Arg Gly Ile Phe Lys

275 280 285

Tyr Arg Asp Gly Ile Val Met Lys Ala Ile Asp Thr Thr Ile Gln Leu

290 295 300

Ser Tyr Asn Asn Leu Phe Phe Pro Ile Asn Asp Ala Ile Lys Ser Lys

305 310 315 320

Gly Ile Asp Thr Ser Glu Leu Val Leu Gly Val Thr Ile Ala Tyr Gly

325 330 335

Glu Ser Gly Asn Pro Gln Leu Leu Asp Ile Ala Asp Arg Gln His Gln

340 345 350

Ile Leu Leu Ser Gly Asp Gly Leu Lys Val Ala Gln Gly Leu Asp Ala

355 360 365

Gly Ala Leu Gln Pro Tyr Pro Phe Lys Ser Phe Ala Phe Arg Asp Gly

370 375 380

Lys Asp Gly Asp Glu Gly Ala Leu Val Val Leu Arg Gln Gln Thr Asp

385 390 395 400

Gly Asp Gln Ala Leu Val Phe Lys Pro Ala Ala Gln Gly Met Gly His

405 410 415

Gly His Phe Asp Lys Leu Thr Trp Gln Phe Tyr Asp Arg Gly Glu Glu

420 425 430

Ile Val Thr Asp Tyr Gly Ala Ala Arg Phe Leu Asn Val Glu Ala Lys

435 440 445

Asn Gly Gly Arg Tyr Leu Gln Glu Asn Glu Thr Trp Ala Lys Gln Thr

450 455 460

Ile Ala His Asn Thr Val Val Val Asp Glu Thr Ser His Phe Asp Asn

465 470 475 480

Asn Leu Lys Ile Ala Asn Arg Asn His Pro Glu Leu Leu Phe Phe His

485 490 495

Ala Asp Asp Gln Val Lys Ile Ser Ala Ala Glu Ile Asp Ser Ala Tyr

500 505 510

Pro Gly Val Ser Leu Lys Arg Thr Leu Ala Leu Val Asn Asn Pro Glu

515 520 525

Ser Gly Asn Ser Phe Ala Ile Asp Val Phe Gly Val Glu Ser Ser Gln

530 535 540

Lys His Gln Leu Asp Leu Pro Leu His Tyr Asn Gly Gln Leu Val Asp

545 550 555 560

Thr Asn Phe Arg Leu Gln Gly Phe Thr Asp Ser Leu Lys Ala Leu Gly

565 570 575

Thr Asn Asn Gly Tyr Gln His Leu Trp Leu Lys Ala Arg Gly Lys Pro

580 585 590

Asp Ser Gly Leu Ala Gln Val Thr Trp Leu Asn Asp Asn Gly Arg Phe

595 600 605

Tyr Thr Gln Ser Ser Leu Val Asp Gly Lys Thr Glu Leu Leu Phe Thr

610 615 620

Glu Leu Gly Ala Asn Asp Pro Asn Phe Asn Leu Arg Ser Glu Lys Gly

625 630 635 640

Phe Ile Ala Arg Arg Asn Gly Ala Arg Ser His Thr Phe Val Ser Val

645 650 655

Leu Glu Pro His Gly Glu Tyr Asn Pro Ser Lys Glu Phe Thr Leu Glu

660 665 670

Ala Glu Ser Gln Val Gln Ala Leu Gln His Arg Gln Ala Gly Asp Leu

675 680 685

Glu Leu Ile Ala Ile Gly Ile Lys Asn Gly Ala Thr Gln Leu Leu Ala

690 695 700

Tyr Asn Arg Ser Ser Asn Val Pro Glu Glu Leu Glu Asn Ile Phe Glu

705 710 715 720

Tyr Asp Gly Arg Lys Tyr Gln Phe Thr Gly Arg Ala Lys Leu Phe Gln

725 730 735

Ile Thr Asn

<210>3

<211>34

<212>DNA

<213> Artificial sequence

<400>3

cgcggatccgttgaacatcccaacctggtgatcg 34

<210>4

<211>34

<212>DNA

<213> Artificial sequence

<400>4

ccgctcgaggttagtaatttggaagagttttgcg 34

Claims

1. A gene encoding exo-type alginate lyase AlgL17, comprising: the nucleotide sequence is shown in SEQ ID NO. 1.

2. An exo-type alginate lyase AlgL17, characterized in that: the amino acid sequence is shown in SEQ ID NO. 2.

3. An alginate lyase expression vector, which is characterized in that: the expression vector pET-28a-AlgL17 containing the alginate lyase AlgL17 gene of claim 1.

4. A preparation method of alginate lyase is characterized in that: comprises transforming a host cell with the expression vector containing the alginate lyase AlgL17 gene of claim 3, culturing the transformant, and obtaining the recombinant alginate lyase from the culture.

5. The method of claim 4, wherein the alginate lyase comprises the following steps: the host cell is escherichia coli.

6. The method of claim 5, wherein the alginate lyase comprises the following steps: the recombinant alginate lyase with soluble expression is obtained by transforming the expression vector containing the alginate lyase AlgL17 gene into host cell escherichia coli BL21(DE3) and inducing the host cell escherichia coli with IPTG.

7. The method of claim 6, wherein the alginate lyase comprises the following steps: the final concentration of IPTG is 0.1mmol/L, and the induction temperature is 18 ℃.

8. A recombinant alginate lyase, which is characterized in that: comprises transforming a host cell with the expression vector containing the alginate lyase AlgL17 gene of claim 3, culturing the transformant, and obtaining the recombinant alginate lyase from the culture.

9. The recombinant alginate lyase of claim 8, wherein: the optimal reaction temperature and the optimal reaction pH of the recombinant alginate lyase on a sodium alginate substrate are respectively 35 ℃ and 8.0; the recombinase is stable at 25 ℃, is unstable at 30 ℃ and 35 ℃, and has a stable pH range of 5.0-8.0; sodium ions have an activating effect on the activity of the recombinant enzyme.

10. The application of the recombinant alginate lyase is characterized in that: the recombinant algin lyase can act on sodium alginate to generate DEH, or the recombinant algin lyase can directly degrade kelp to generate reducing sugar.