CN110938684A

CN110938684A - Nucleic acid for encoding LTBP2 gene mutant and application thereof

Info

Publication number: CN110938684A
Application number: CN201911164645.8A
Authority: CN
Inventors: 王开宇
Original assignee: Fuzhou Furui Medical Laboratory Co Ltd
Current assignee: Fuzhou Furui Medical Laboratory Co Ltd
Priority date: 2019-11-25
Filing date: 2019-11-25
Publication date: 2020-03-31

Abstract

The invention relates to a nucleic acid for encoding LTBP2 gene mutant and application thereof, belonging to the technical field of genetic engineering. Compared with the wild type, the mutant has c.4936G > C mutation, and the amino acid sequence of the encoded polypeptide has p.Glu1646Gln mutation. By detecting whether the new mutant exists or not, a biological sample susceptible to primary congenital glaucoma can be effectively screened; the detection method is rapid, accurate and efficient; the invention can be used for molecular diagnosis and differential diagnosis of patients with primary congenital glaucoma, and provides scientific basis for early diagnosis and early treatment of patients with primary congenital glaucoma. The kit can be used for screening primary congenital glaucoma carriers, can provide genetic counseling suggestions and guidance for the carriers, and reduces the probability of offspring suffering from primary congenital glaucoma.

Description

Nucleic acid for encoding LTBP2 gene mutant and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to nucleic acid for encoding an LTBP2 gene mutant and application thereof. In particular, the invention relates to isolated nucleic acids encoding LTBP2 mutants, isolated LTBP2 mutant polypeptides, methods of screening a biological sample susceptible to primary congenital glaucoma.

Background

Primary congenital glaucoma is a serious and rare eye disease causing blindness in infants and children, and is the most common type of glaucoma in children. There are significant ethnic and regional differences in the incidence of primary congenital glaucoma, with a total incidence of 1:10000 in european countries, 1:3300 in indian populations, and about 1:2500 in middle east saudi arabia. The incidence of primary congenital glaucoma in our country has no accurate statistics, and according to the reports, congenital glaucoma accounts for about 40% of hospitalized children glaucoma patients. Primary congenital glaucoma seriously harms the vision and visual development of patients, and if the patients cannot be diagnosed early and treated and intervened early, the blindness rate can reach 100 percent.

Primary congenital glaucoma is usually caused by mutations in CYP1B1, LTBP2, TEK gene, wherein LTBP2 gene is located at 14q24.3, near 1.3Mb of GLC3C locus, encodes LTBP2 protein, contains 36 exons and 35 introns, and encodes matrix protein containing 1821 amino acids. It is one of 4 LTBP family proteins, which contain a multidomain glycoprotein with an epidermal growth factor-like domain and 8 cysteine domains, a major component of the extracellular matrix that interacts with fibrillar protein microfibrils. The LTBP2 protein is abundantly expressed in multiple elastic tissues throughout the body, expressed at relatively high levels in the ocular trabecular meshwork, and most highly expressed in the Descemet membrane and lens epithelial layer. Expression is also observed between the non-pigmented epithelium of the ciliary process, the trabecular meshwork and between the sclera and the corneal stroma. LTBP2 plays an important role in the structural and functional functioning of the eye. Autosomal recessive pathogenic mutations of the LTBP2 gene can lead to primary congenital glaucoma. Individuals carrying a heterozygous pathogenic mutation in the LTBP2 gene, although often without obvious clinical symptoms, can pass on the pathogenic mutation to offspring. Since primary congenital glaucoma is very rare, reports of primary congenital glaucoma in Chinese are very limited, and there are few pathogenic sites with diagnostic value.

Therefore, the determination of the causative gene of primary congenital glaucoma and the detection method of primary congenital glaucoma are still under intensive study.

Disclosure of Invention

The invention aims to provide an LTBP2 gene mutant and provides a method capable of effectively screening a biological sample susceptible to primary congenital glaucoma.

The purpose of the invention is realized by the following technical scheme:

according to the recent progress in the medical research field of primary congenital glaucoma, the analysis of primary congenital glaucoma related genes by using a second generation sequencing method has been primarily applied to molecular diagnosis of primary congenital glaucoma patients, discovery of new pathogenic genes and research of pathogenic variation. Second generation sequencing utilizes designed DNA sequence probes to capture the target gene region, followed by deep sequencing for each exon. The research for searching the pathogenic gene of primary congenital glaucoma by utilizing the technical process becomes a research hotspot. For example, Saeedi et al (Saeedi, Osamah, Yousaf, Sairah, Tsai, Joby, et al. delication of Novel Compound Heterozygous Variants in LTBP2 Associated with Juvenenium Open Angle Glaucoma [ J ] Genes,9.11) performed whole exome testing on 1 juvenile Open-Angle primary congenital Glaucoma family using a second generation sequencing technique, which was found to carry 2 new pathogenic mutations of LTBP2 gene. It can be seen that the second generation sequencing technology is promoting the rapid development of the diagnosis of primary congenital glaucoma and the mechanism research thereof.

Therefore, the inventor finally determines a new pathogenic mutation site of the primary congenital glaucoma, namely the c.4936G > C mutation of LTBP2 gene, by adopting a 26-gene primary congenital glaucoma gene package and a high-throughput second-generation sequencing technology of target region capture aiming at a primary congenital glaucoma patient.

The inventors propose, on the one hand, an isolated nucleic acid encoding a LTBP2 mutant. Compared with the gene sequence of SEQ ID NO. 1, the gene sequence of the nucleic acid has c.4936G > C mutation. The mutant is closely related to the onset of primary congenital glaucoma, so that whether an organism is susceptible to primary congenital glaucoma can be effectively detected by detecting whether the mutant exists in a biological sample.

On the other hand, the kit for detecting the LTBP2 gene mutant and the application thereof in screening biological samples susceptible to primary congenital glaucoma are provided. The detection kit comprises a reagent suitable for detecting the LTBP2 gene mutant with c.4936G > C mutation compared with SEQ ID NO: 1. The reagent comprises a specific primer with nucleotide sequences shown as SEQ ID NO. 3 and SEQ ID NO. 4.

The method utilizes a reagent which is suitable for detecting the LTBP2 gene mutant with c.4936G > C mutation compared with SEQ ID NO:1 to detect whether the LTBP2 gene mutation exists in the biological sample, thereby screening the biological sample susceptible to the primary congenital glaucoma. The method specifically comprises the following steps:

(1) extracting nucleic acid samples from biological samples, wherein the biological samples refer to various samples from human bodies, including but not limited to blood, saliva, tissues, hair or oral mucosa. The biological sample can be used for separating and obtaining the LTBP2 gene mutant nucleic acid, or obtaining a cDNA sample through a reverse transcription reaction to form the nucleic acid sample;

(2) carrying out PCR amplification on a nucleic acid sample by using a specific primer or probe of the LTBP2 gene, and constructing a nucleic acid sequencing library aiming at the obtained amplification product and carrying out sequencing; the specific primer or probe of the LTBP2 gene has nucleotide sequences shown as SEQ ID NO. 3 and SEQ ID NO. 4;

(3) comparing the sequencing nucleotide map with the human reference genome sequence, finding that the 4936 th base of the coding region of the LTBP2 gene is mutated from G to C, and the mutation causes the 1646 th codon of the coding sequence to be changed from glutamic acid to glutamine, namely, the p.Glu1646Gln is changed.

The inventor finds out that 1 new pathogenic mutation site in the sequence shown in SEQ ID NO. 1 of LTBP2 gene, namely, the 4936 th base of the coding sequence is mutated from G to C, so that the 1646 th codon of the coding sequence is changed from glutamic acid to glutamine. Based on the above, the invention provides a method for detecting LTBP2 gene mutation. Biological samples susceptible to primary congenital glaucoma can be screened by this method.

Wherein the nucleic acid comprises DNA, RNA or cDNA.

In a third aspect, an isolated LTBP2 mutant polypeptide encoded by a nucleic acid encoding an LTBP2 mutant having a p.glu1646gln mutation in its amino acid sequence compared to SEQ ID No. 2 is presented.

In a fourth aspect, a method of screening a biological sample susceptible to primary congenital glaucoma using an isolated LTBP2 gene mutant polypeptide is provided. The polypeptide (the amino acid sequence is shown as SEQ ID NO:2) encoded by the wild-type LTBP2 gene in a biological sample can be used as an auxiliary judgment method for judging whether an organism suffers from primary congenital glaucoma.

Compared with the prior art, the invention has the advantages that:

(1) the method is rapid, accurate, efficient, simple and convenient, and can effectively screen out biological samples susceptible to primary congenital glaucoma.

(2) The invention can be used for molecular diagnosis and differential diagnosis of patients with primary congenital glaucoma, and provides scientific basis for early diagnosis and early treatment of patients with primary congenital glaucoma.

(3) The kit can be used for screening primary congenital glaucoma carriers, can provide genetic counseling suggestions and guidance for the carriers, and reduces the probability of offspring suffering from primary congenital glaucoma.

Drawings

Fig. 1 is a family atlas of a patient with primary congenital glaucoma according to an embodiment, in which arrows indicate probands, solid icons indicate the patient, and semi-solid icons indicate the carrier;

FIG. 2 is a forward primer sequencing of a patient containing a mutation site according to an embodiment, wherein an arrow indicates a gene mutation site.

Detailed Description

LTBP2 gene mutant

In a first aspect, the present invention provides an isolated nucleic acid encoding an LTBP2 mutant. According to an embodiment, the nucleic acid has a c.4936G > C mutation compared to SEQ ID NO: 1. The expression "nucleic acid encoding LTBP2 gene mutant" used in the present invention refers to a nucleic acid substance corresponding to a gene encoding LTBP2 gene mutant, i.e., the type of nucleic acid is not particularly limited, and may be any polymer comprising deoxyribonucleotides and/or ribonucleotides corresponding to a gene encoding LTBP2 gene mutant, including but not limited to DNA, RNA, or cDNA. According to an embodiment, the nucleic acid encoding the LTBP2 gene mutant is DNA.

According to the embodiment, the inventor determines a new mutant of LTBP2 gene, which is closely related to the onset of primary congenital glaucoma, so that whether the organism is susceptible to primary congenital glaucoma can be effectively predicted by detecting whether the mutant exists in a biological sample.

As to the nucleic acid referred to in the present invention, practically any one or both of the complementary double strands is included. For convenience, in the present invention, although only one strand is given in most cases, actually, another strand complementary thereto is also disclosed. One skilled in the art will appreciate that one strand may be used to detect the other strand and vice versa.

Nucleic acid encoding LTBP2 gene mutant is a new pathogenic mutation on the primary congenital glaucoma pathogenic gene determined by the method of exome sequencing analysis combined with Sanger sequencing verification. The site of this pathogenic mutation is novel and has not been mentioned in the prior art.

Wherein, the cDNA of the wild-type LTBP2 gene has the nucleotide sequence shown as follows:

ATGAGGCCGCGGACCAAAGCCCGCAGCCCGGGGCGCGCCCTGCGGAACCCCTGGAGAGGCTTCCTGCCGCTCACCCTGGCTCTCTTCGTGGGCGCGGGTCATGCCCAAAGGGACCCCGTAGGGAGATACGAGCCGGCTGGTGGAGACGCGAATCGACTGCGGCGCCCTGGGGGCAGCTACCCGGCAGCGGCTGCAGCCAAGGTGTACAGTCTGTTCCGGGAGCAGGACGCGCCTGTCGCGGGCTTGCAGCCCGTGGAGCGGGCCCAGCCGGGCTGGGGGAGCCCCAGGAGGCCCACCGAGGCGGAGGCCAGGAGGCCGTCCCGCGCGCAGCAGTCGCGGCGTGTCCAGCCACCTGCGCAGACCCGGAGAAGCACTCCCCTGGGCCAGCAGCAACCAGCACCCCGGACCCGGGCCGCGCCGGCTCTCCCACGCCTGGGGACCCCACAGCGGTCTGGGGCTGCGCCCCCAACCCCGCCGCGAGGGCGGCTCACGGGGAGGAACGTCTGCGGGGGACAGTGCTGCCCAGGATGGACAACAGCAAACAGCACCAACCACTGTATCAAACCCGTTTGCGAGCCGCCGTGCCAGAACCGGGGCTCCTGCAGCCGCCCGCAGCTCTGTGTCTGCCGCTCTGGTTTCCGTGGAGCCCGCTGCGAGGAGGTCATTCCCGATGAGGAATTTGACCCCCAGAACTCCAGGCTGGCACCTCGACGCTGGGCCGAGCGTTCACCCAACCTGCGCAGGAGCAGTGCGGCTGGAGAGGGCACCTTGGCCAGAGCACAGCCGCCAGCACCACAGTCGCCGCCCGCACCACAGTCGCCACCAGCTGGGACCCTGAGTGGCCTCAGCCAGACCCACCCTTCCCAGCAGCACGTGGGGTTGTCCCGCACTGTCCGACTTCACCCGACTGCCACGGCCAGTAGCCAGCTCTCTTCCAACGCCCTGCCCCCGGGACCAGGCCTTGAGCAGAGAGATGGCACCCAACAGGCGGTACCTCTGGAGCACCCCTCATCCCCCTGGGGGCTGAACCTCACGGAGAAAATCAAGAAGATCAAGATCGTCTTCACTCCCACCATCTGCAAGCAGACCTGTGCCCGTGGACACTGTGCCAACAGCTGTGAGAGGGGCGACACCACCACCCTGTACAGCCAGGGCGGCCATGGGCACGATCCCAAGTCTGGCTTCCGCATCTATTTCTGCCAGATCCCCTGCCTGAACGGAGGCCGCTGCATCGGCAGGGACGAATGCTGGTGCCCCGCCAACTCCACCGGGAAGTTCTGCCACCTGCCTATCCCGCAGCCGGACAGGGAGCCTCCAGGGAGGGGGTCCCGCCCCAGGGCCTTGCTGGAAGCCCCACTGAAGCAGTCCACTTTCACACTGCCGCTCTCCAACCAGCTGGCCTCCGTGAACCCCTCCCTGGTGAAGGTGCACATTCACCACCCACCCGAGGCCTCAGTGCAGATCCACCAGGTGGCCCAGGTGCGGGGCGGGGTGGAGGAGGCCCTAGTGGAGAACAGCGTGGAGACCAGACCCCCGCCCTGGCTGCCTGCCAGCCCTGGCCACAGCCTCTGGGACAGCAACAACATCCCTGCTCGGTCTGGAGAGCCCCCTCGGCCACTGCCCCCAGCAGCACCCAGGCCTCGAGGACTGCTGGGCCGGTGTTACCTGAACACTGTGAACGGACAGTGTGCCAACCCTCTGCTGGAGCTGACTACCCAGGAGGACTGCTGTGGCAGTGTGGGAGCCTTCTGGGGGGTGACTTTGTGTGCCCCATGCCCACCCAGACCAGCCTCCCCGGTGATTGAGAATGGCCAGCTGGAGTGTCCTCAGGGGTACAAGAGACTGAACCTCACTCACTGCCAAGATATCAACGAGTGCTTGACCCTGGGCCTGTGCAAGGACGCGGAGTGTGTGAATACCAGGGGCAGCTACCTGTGCACATGCAGACCTGGCCTCATGCTGGATCCATCGCGGAGCCGCTGTGTGTCGGACAAGGCAATCTCCATGCTGCAGGGACTGTGCTACCGGTCGCTGGGGCCCGGCACCTGCACCCTGCCTTTGGCCCAGCGGATCACCAAGCAGATATGCTGCTGCAGCCGCGTGGGCAAAGCATGGGGCAGCGAGTGTGAGAAATGCCCTCTGCCTGGCACAGAGGCCTTCAGAGAGATCTGCCCTGCCGGCCACGGCTACACCTACGCGAGCTCCGACATCCGCCTGTCCATGAGGAAAGCCGAGGAGGAGGAACTGGCAAGGCCCCCAAGGGAGCAAGGGCAGAGGAGCAGCGGGGCACTGCCCGGGCCAGCAGAGAGGCAGCCCCTCCGGGTCGTCACGGACACCTGGCTTGAGGCCGGGACCATCCCTGACAAGGGTGACTCTCAGGCTGGCCAGGTCACGACCAGTGTCACTCATGCACCTGCCTGGGTCACAGGGAATGCCACAACCCCACCAATGCCTGAACAGGGGATTGCAGAGATACAGGAAGAACAAGTGACCCCCTCCACTGATGTGCTGGTGACCCTGAGCACCCCAGGCATTGACAGATGCGCTGCTGGAGCCACCAACGTCTGTGGCCCTGGAACCTGCGTGAACCTCCCCGATGGATACAGATGTGTCTGCAGCCCTGGCTACCAGCTGCACCCCAGCCAGGCCTACTGCACAGATGACAACGAGTGTCTGAGGGACCCCTGCAAGGGAAAAGGGCGCTGCATCAACCGCGTGGGGTCCTACTCCTGCTTCTGCTACCCTGGCTACACTCTGGCCACCTCAGGGGCGACACAGGAGTGTCAAGATATCAATGAGTGTGAGCAGCCAGGGGTGTGCAGCGGGGGGCAGTGCACCAACACCGAGGGCTCGTACCACTGCGAGTGTGATCAGGGCTACATCATGGTCAGGAAAGGACACTGCCAAGATATCAACGAATGCCGTCACCCCGGTACCTGCCCTGATGGGAGATGCGTCAATTCCCCTGGCTCCTACACTTGTCTGGCCTGTGAGGAGGGCTACCGGGGCCAGAGTGGGAGCTGTGTAGATGTGAATGAGTGTCTGACTCCCGGGGTCTGTGCCCATGGAAAGTGCACCAACCTAGAAGGCTCCTTCAGATGCTCTTGTGAGCAGGGCTATGAGGTCACCTCAGATGAGAAGGGCTGCCAAGATGTGGATGAGTGTGCCAGCCGGGCCTCATGCCCCACAGGCCTCTGCCTCAACACGGAGGGCTCCTTCGCCTGCTCTGCCTGTGAGAACGGGTACTGGGTGAATGAAGACGGCACTGCCTGTGAAGACCTAGATGAGTGTGCCTTCCCGGGAGTCTGCCCCTCCGGAGTCTGCACCAACACGGCTGGCTCCTTCTCCTGCAAGGACTGCGATGGGGGCTACCGGCCCAGCCCCCTGGGTGACTCCTGTGAAGATGTGGATGAATGTGAAGACCCCCAGAGCAGCTGCCTGGGAGGCGAGTGCAAGAACACTGTGGGCTCCTACCAGTGCCTCTGTCCCCAGGGCTTCCAGCTGGCCAATGGCACCGTGTGTGAGGATGTGAATGAGTGCATGGGGGAGGAGCACTGCGCACCCCACGGCGAGTGCCTCAACAGCCACGGGTCTTTCTTCTGTCTGTGCGCGCCTGGCTTCGTCAGCGCAGAGGGGGGCACCAGCTGCCAGGATGTGGACGAGTGTGCCACCACAGACCCGTGTGTGGGAGGGCACTGTGTCAACACCGAGGGCTCCTTCAACTGTCTATGTGAGACTGGCTTCCAGCCCTCCCCAGAGAGTGGAGAGTGTGTGGATATTGACGAGTGTGAGGACTATGGAGACCCGGTGTGTGGCACCTGGAAGTGTGAAAACAGCCCTGGCTCCTACCGCTGTGTTCTGGGCTGCCAGCCTGGCTTCCACATGGCCCCGAACGGAGACTGCATTGACATAGACGAGTGCGCCAACGACACCATGTGTGGCAGCCACGGCTTCTGTGACAACACTGATGGCTCCTTCCGCTGCCTCTGTGACCAGGGCTTCGAGATCTCTCCCTCAGGCTGGGACTGTGTGGATGTGAACGAGTGTGAGCTTATGCTGGCGGTATGTGGGGCCGCGCTCTGTGAGAACGTGGAGGGCTCCTTCCTGTGCCTCTGTGCCAGTGACCTGGAGGAGTACGATGCCCAGGAGGGGCACTGCCGCCCACGGGGGGCTGGAGGTCAGAGTATGTCTGAGGCCCCAACGGGGGACCATGCCCCGGCCCCCACCCGCATGGACTGCTACTCCGGGCAGAAGGGCCATGCGCCCTGCTCCAGTGTCCTGGGCCGGAACACCACACAGGCTGAATGCTGCTGCACCCAGGGCGCTAGCTGGGGAGATGCCTGTGACCTCTGCCCGTCTGAGGACTCAGCTGAATTCAGCGAGATCTGCCCTAGTGGAAAAGGCTACATTCCTGTGGAAGGAGCCTGGACGTTTGGACAGACCATGTACACAGATGCGGATGAGTGTGTGATATTCGGGCCTGGTCTCTGCCCGAACGGCCGGTGCCTCAACACCGTGCCTGGTTATGTCTGCCTGTGCAATCCCGGCTTCCACTACGATGCTTCCCACAAGAAGTGTGAGGATCACGATGAGTGCCAGGACCTGGCCTGTGAGAATGGCGAGTGCGTCAACACGGAGGGCTCCTTCCACTGCTTCTGCAGCCCCCCGCTCACCCTGGACCTCAGCCAGCAGCGCTGCATGAACAGCACCAGCAGCACGGAGGACCTCCCTGACCACGACATCCACATGGACATCTGCTGGAAAAAAGTCACCAATGATGTGTGCAGCGAACCCCTGCGTGGGCACCGCACCACCTACACGGAATGCTGCTGCCAGGACGGCGAGGCCTGGAGCCAGCAGTGTGCTCTGTGTCCCCCGAGGAGCTCTGAGGTCTATGCTCAGCTGTGCAACGTGGCTCGCATTGAGGCAGAGCGGGAGGCCGGGGTCCACTTCCGGCCAGGCTATGAGTATGGCCCCGGGCCCGATGACCTGCACTACAGCATCTATGGCCCAGATGGGGCCCCCTTCTACAACTACCTGGGCCCCGAGGACACCGTCCCTGAGCCTGCCTTCCCCAACACAGCCGGTCACTCAGCGGACCGCACACCCATCCTTGAGTCTCCTTTGCAGCCCTCAGAACTCCAGCCCCACTACGTGGCCAGCCATCCAGAGCCCCCAGCCGGCTTCGAAGGGCTTCAGGCGGAGGAGTGCGGCATCCTGAACGGCTGTGAGAATGGCCGCTGTGTGCGCGTGCGGGAGGGCTACACCTGTGACTGTTTTGAGGGCTTCCAGCTGGATGCGGCCCACATGGCCTGCGTAGATGTGAATGAGTGTGATGACTTGAACGGGCCTGCTGTGCTCTGTGTCCATGGTTACTGCGAGAACACAGAGGGCTCCTACCGCTGCCACTGCTCCCCGGGATATGTGGCTGAGGCAGGGCCCCCCCACTGCACTGCCAAGGAGTAG(SEQ ID NO:1)。

the encoded protein has the following amino acid sequence:

MRPRTKARSPGRALRNPWRGFLPLTLALFVGAGHAQRDPVGRYEPAGGDANRLRRPGGSYPAAAAAKVYSLFREQDAPVAGLQPVERAQPGWGSPRRPTEAEARRPSRAQQSRRVQPPAQTRRSTPLGQQQPAPRTRAAPALPRLGTPQRSGAAPPTPPRGRLTGRNVCGGQCCPGWTTANSTNHCIKPVCEPPCQNRGSCSRPQLCVCRSGFRGARCEEVIPDEEFDPQNSRLAPRRWAERSPNLRRSSAAGEGTLARAQPPAPQSPPAPQSPPAGTLSGLSQTHPSQQHVGLSRTVRLHPTATASSQLSSNALPPGPGLEQRDGTQQAVPLEHPSSPWGLNLTEKIKKIKIVFTPTICKQTCARGHCANSCERGDTTTLYSQGGHGHDPKSGFRIYFCQIPCLNGGRCIGRDECWCPANSTGKFCHLPIPQPDREPPGRGSRPRALLEAPLKQSTFTLPLSNQLASVNPSLVKVHIHHPPEASVQIHQVAQVRGGVEEALVENSVETRPPPWLPASPGHSLWDSNNIPARSGEPPRPLPPAAPRPRGLLGRCYLNTVNGQCANPLLELTTQEDCCGSVGAFWGVTLCAPCPPRPASPVIENGQLECPQGYKRLNLTHCQDINECLTLGLCKDAECVNTRGSYLCTCRPGLMLDPSRSRCVSDKAISMLQGLCYRSLGPGTCTLPLAQRITKQICCCSRVGKAWGSECEKCPLPGTEAFREICPAGHGYTYASSDIRLSMRKAEEEELARPPREQGQRSSGALPGPAERQPLRVVTDTWLEAGTIPDKGDSQAGQVTTSVTHAPAWVTGNATTPPMPEQGIAEIQEEQVTPSTDVLVTLSTPGIDRCAAGATNVCGPGTCVNLPDGYRCVCSPGYQLHPSQAYCTDDNECLRDPCKGKGRCINRVGSYSCFCYPGYTLATSGATQECQDINECEQPGVCSGGQCTNTEGSYHCECDQGYIMVRKGHCQDINECRHPGTCPDGRCVNSPGSYTCLACEEGYRGQSGSCVDVNECLTPGVCAHGKCTNLEGSFRCSCEQGYEVTSDEKGCQDVDECASRASCPTGLCLNTEGSFACSACENGYWVNEDGTACEDLDECAFPGVCPSGVCTNTAGSFSCKDCDGGYRPSPLGDSCEDVDECEDPQSSCLGGECKNTVGSYQCLCPQGFQLANGTVCEDVNECMGEEHCAPHGECLNSHGSFFCLCAPGFVSAEGGTSCQDVDECATTDPCVGGHCVNTEGSFNCLCETGFQPSPESGECVDIDECEDYGDPVCGTWKCENSPGSYRCVLGCQPGFHMAPNGDCIDIDECANDTMCGSHGFCDNTDGSFRCLCDQGFEISPSGWDCVDVNECELMLAVCGAALCENVEGSFLCLCASDLEEYDAQEGHCRPRGAGGQSMSEAPTGDHAPAPTRMDCYSGQKGHAPCSSVLGRNTTQAECCCTQGASWGDACDLCPSEDSAEFSEICPSGKGYIPVEGAWTFGQTMYTDADECVIFGPGLCPNGRCLNTVPGYVCLCNPGFHYDASHKKCEDHDECQDLACENGECVNTEGSFHCFCSPPLTLDLSQQRCMNSTSSTEDLPDHDIHMDICWKKVTNDVCSEPLRGHRTTYTECCCQDGEAWSQQCALCPPRSSEVYAQLCNVARIEAEREAGVHFRPGYEYGPGPDDLHYSIYGPDGAPFYNYLGPEDTVPEPAFPNTAGHSADRTPILESPLQPSELQPHYVASHPEPPAGFEGLQAEECGILNGCENGRCVRVREGYTCDCFEGFQLDAAHMACVDVNECDDLNGPAVLCVHGYCENTEGSYRCHCSPGYVAEAGPPHCTAKE(SEQ ID NO:2)。

compared with the sequence shown in SEQ ID NO. 1 of the wild-type LTBP2 gene, the inventor finds that the novel LTBP2 gene mutant has c.4936G > C mutation, namely, the 4936 th base in cDNA of the LTBP2 gene mutant is mutated from G to C, so that the encoded product has p.Glu1646Gln mutation, namely, the 1646 th codon of the encoding sequence is changed from glutamic acid to glutamine, compared with the wild-type LTBP2(SEQ ID NO: 2).

The inventor firstly proposes that the c.4936G > C heterozygous mutation of the LTBP2 gene causes the patient to have symptoms of primary congenital glaucoma, so that the aim of effectively predicting whether an organism is susceptible to the primary congenital glaucoma can be achieved by detecting whether the new mutant exists in a biological sample.

In a second aspect, the inventors propose an isolated polypeptide based on the obtained mutant gene. According to embodiments, the isolated polypeptide has a p.glu1646gln mutation compared to wild-type LTBP 2. The polypeptide is encoded by the isolated nucleic acid encoding the LTBP2 gene mutant.

Method for screening biological samples susceptible to primary congenital glaucoma

In a third aspect, the invention provides a kit for detecting a nucleic acid encoding a mutant LTBP2 gene, and a method of screening a biological sample susceptible to primary congenital glaucoma. The kit comprises a reagent suitable for detecting the LTBP2 gene mutant, wherein the LTBP2 gene mutant has c.4936G > C mutation compared with a sequence shown as SEQ ID NO. 1. The reagent comprises a specific primer, and the primer has nucleotide sequences shown as SEQ ID NO. 3 and SEQ ID NO. 4. By screening a biological sample with the LTBP2 mutant, a biological sample susceptible to primary congenital glaucoma can be effectively screened.

According to an embodiment, the method of screening a biological sample susceptible to primary congenital glaucoma comprises the following implementation steps:

first, a nucleic acid sample is extracted from the biological sample. The type of the biological sample is not particularly limited as long as a nucleic acid sample reflecting the presence or absence of a mutation in the LTBP2 gene of the biological sample can be extracted from the biological sample. The biological sample includes but is not limited to blood, saliva, tissue, hair or oral mucosa. The term "nucleic acid sample" is used in a broad sense and can be any sample that reflects the presence or absence of a mutation in the LTBP2 gene in a biological sample, including but not limited to genomic DNA, total RNA, and mRNA extracted from a biological sample. According to an embodiment, the nucleic acid sample is whole genomic DNA. Thus, the source range of the biological sample can be expanded, and various information of the biological sample can be determined at the same time, so that the efficiency of screening the biological sample susceptible to primary congenital glaucoma can be improved.

Second, the nucleic acid sequence of the nucleic acid sample is determined. The method and apparatus for determining the nucleic acid sequence of the nucleic acid sample are not particularly limited. The nucleic acid sequence of the nucleic acid sample can be determined using, but is not limited to, a nucleic acid sequencing method, and the nucleic acid sequencing method and apparatus are not particularly limited. The second generation sequencing technology can be adopted, and the sequencing technology of various performances such as the first generation, the third generation and the like can also be adopted. According to an embodiment, the step of determining the nucleic acid sequence of the nucleic acid sample using a second generation sequencing technique further comprises: and (3) constructing a sequencing library aiming at the nucleic acid sample, and sequencing the sequencing library by using sequencing equipment to obtain a sequencing result containing LTBP2 gene information. The sequencing equipment comprises but is not limited to Novaseq series, Hiseq series, Nexeseq series and BGIseq series second generation nucleic acid sequencers. The reagents and methods for constructing sequencing libraries include but are not limited to Nextera, TruSeq and Yeasen, the specific procedures can be referred to the manufacturer's instructions, and those skilled in the art can make appropriate selections according to different sequencing platforms. According to embodiments, a nucleic acid sample may be screened to enrich for an exon of LTBP2 gene, and the screening enrichment may be performed before, during, or after the construction of a sequencing library. According to the examples, primers for specifically amplifying an exon region of LTBP2 gene were designed and synthesized, genomic DNA samples were amplified using the primers, and nucleic acid sequencing libraries were constructed using the amplification products. The method for carrying out PCR amplification by using the LTBP2 gene exon specific primer can effectively improve the efficiency of screening biological samples susceptible to primary congenital glaucoma.

According to the examples, LTBP2 gene exon-specific primers are not particularly limited, and the inventors have preferably designed for the c.4936G > C mutation, and the LTBP2 gene-specific primer has the nucleotide sequences shown as SEQ ID NO:3 and SEQ ID NO: 4:

LTBP2_E34F：GTTGCCAGGATCTCCCAGAG(SEQ ID NO:3)

LTBP2_E34R：GACCTCTGGCTTGGTGTGTCT(SEQ ID NO:4)

it should be noted that the term "nucleic acid sequence" as used herein refers broadly to all nucleic acid sequences and information data containing information encoded by the LTBP2 gene, including but not limited to nucleic acid sequence information obtained directly by sequencing, complete nucleic acid sequence information obtained by assembling sequencing data, raw sequencing data (reads) generated by sequencing equipment, and data information obtained by computer processing sequencing data (Bam files, etc.).

Third, alignment of the nucleic acid sequence to a genomic reference sequence. Specifically, the nucleic acid sequence based on the nucleic acid sample or the complementary sequence thereof, if having the c.4936G > C mutation, compared to SEQ ID NO:1, indicates that the organism is predisposed to primary congenital glaucoma. The method of aligning the nucleic acid sequence with SEQ ID NO. 1 is not particularly limited, and the alignment may be performed manually or by using any computer software, and according to the examples, the alignment may be performed by using Novoalign software from Novocraft.

The invention adopts a second-generation sequencing technology, carries out exon sequencing analysis of 26 genes related to primary congenital glaucoma on a patient with primary congenital glaucoma, verifies the patient himself and parents of the patient by combining Sanger sequencing, and finally discovers a new mutation site of the primary congenital glaucoma, namely the c.4936G > C mutation of the LTBP2 gene. Compared with the first generation sequencing technology and the classical linkage analysis strategy, the high-flux second generation sequencing technology has the advantages of high flux, high speed, low detection cost and the like, can quickly and accurately locate the pathogenic mutation sites of the primary congenital glaucoma, further provides scientific basis for clarifying the molecular pathogenesis of the primary congenital glaucoma and providing disease screening, early diagnosis, treatment, prognosis judgment and genetic counseling.

In a fourth aspect, as a derivative application of the present invention, a method for screening a biological sample susceptible to primary congenital glaucoma can be established, that is, a method for determining whether an organism suffers from primary congenital glaucoma by detecting a polypeptide (amino acid sequence is shown in SEQ ID NO:2) encoded by the wild-type LTBP2 gene in the biological sample can be used as an auxiliary determination method.

The technical solutions of the present invention are described in detail below with reference to specific examples, which are only illustrative and should not be construed as limiting the present invention.

Unless otherwise indicated, the techniques used in the examples are conventional and well known to those skilled in the art, and may be performed according to the third edition of the molecular cloning, laboratory Manual, or related products, and the reagents and products used are also commercially available. Various procedures and methods not described in detail are conventional methods well known in the art, and the sources, trade names, and components of the reagents used are indicated at the time of first appearance, and the same reagents used thereafter are the same as those indicated at the first appearance, unless otherwise specified.

EXAMPLE 1 determination of Primary congenital glaucoma causing mutations

1. Sample source

One 8-year-old primary congenital glaucoma female patient (proboscis) from the Chinese Fujian province, only one proboscis in the three generations of the family, and the inventor selects patients and parents thereof to carry out glaucoma gene package detection. The first two eyes were found to have abnormal development at 5 months of age. At present, the infant patients have the clinical manifestations of lacrimation, photophobia and the like, the intraocular pressure examination (IOP) is 5.01kpa, the diameter of a left corneal cornea is 13mm, the diameter of a right corneal cornea is 14mm, and the opacity of the cornea is accompanied. The clinical intended diagnosis is primary congenital glaucoma. The pedigree of the primary congenital glaucoma patient is shown in fig. 1, with the arrows pointing to the proband, the solid icon representing the patient, and the semi-solid icon representing the carrier. Informed consent was obtained from all participants and venous blood collection was performed.

2. Genomic DNA extraction

Collecting peripheral Blood of all members of the family, and respectively adopting HiPure Blood&Tissue DNA Kit (magenta) Whole blood DNA extraction method genomic DNA was extracted from peripheral blood samples, DNA purity was measured by Nanodrop one, and OD of each genomic DNA obtained_260nm/OD_280nmAll are located between 1.7 and 2.0, and the concentration of DNA is measured by Nanodrop one, and the concentration of each genomic DNA obtained is 50 to 100 ng/. mu.L, and the total amount is 5 to 10. mu.g.

3. Target exon capture sequencing

The inventor utilizes Nextera DNA Exome kit of Illumina company and Illumina second generation sequencing technology to sequence the clinical Exome sequence of the primary congenital glaucoma patient.

The method comprises the following specific steps:

1) genomic DNA samples were randomly fragmented into fragments of about 200-1000bp using the Nextera DNA Exome kit from Illumina, and then prepared by ligating adaptors at each end of the fragments according to the manufacturer's instructions.

2) After the library is purified, the Nanodrop one is used for detecting the library, the same amount of the Nanodrop one and the Nanodrop one are mixed, the concentration of the mixture is more than 100 ng/mu L, Nextera Rapid Capture reagent is used for hybridization and Enrichment by combining with a Nextera DNAexome kit of Illumina company, and the original sequencing data can be obtained by using a computer for sequencing after the library is detected to be qualified through amplification. Wherein the sequencing platform is Illumina Hiseq X Ten, PE150, and the 20X average sequencing coverage of each sample is not less than 96%.

3) Mutation detection, annotation, and database comparison

NGS sequencing results were aligned to the human reference genome UCSC NCBI37/hg19 using Novocraft Novoalign to obtain a unique aligned sequence aligned to the genome. The variation of the target region was determined using VarScan mpileup2snp and VarScan mpileup2indel detection. Remov Run Common Variants and Remov Global Common Variants software were used to Remove Common variations in dbSNP and ExAC databases. The variants were then annotated using Interactive Biosoftware Alamut Batch. The database used for annotation includes: dbSNP, ExAC, 1000g, ClinVar, OMIM, etc. Py was used to rank the annotated variants by High, Medium, Low. In High and Medium packets, a precedence value and a classification reason are given to the variation. All mutations are initially in the Low group and when a mutation meets certain criteria, it can be classified as a higher level mutation. And performing SNP function prediction by using FATHMM, FATHMMMKL, METALR, METASVM, MUTATIONASSESSOR, MUTATIONTASTERAGGGD, AGVGD, LRT, PROVEAN and SIFT software.

The total number of target genes analyzed in the above process is 26, and the target genes are mainly primary glaucoma related genes, and include:

ACVR1,BEST1,CA4,CANT1,COL18A1,COL4A1,CYP1B1,FOXC1,ISPD,LMX1B,LOXL1,LTBP2,MFRP,MYOC,NTF4,OPA1,OPTN,PAX6,PITX2,PITX3,SBF2,SH3PXD2B,SLC4A4,TBK1,TTR,WDR36。

the inventor finds a LTBP2 gene mutant c.4936G > C (p.Glu1646Gln). The allelic frequency of this variation in the general population is recorded as 0.00000801 in the gonmAD database, and is extremely rare. This variation results in a change from glutamate to glutamine at codon 1646 of the coding sequence of the gene, which may have an effect on gene function. The mutation is homozygous on the predecessor, heterozygous on the predecessor parents, and the LTBP2 gene is a pathogenic gene of primary congenital glaucoma, which is consistent with the disease condition of patients per se. According to the detection result, the diagnosis of the primary congenital glaucoma of the patient is clear due to pathogenic mutation of the LTBP2 gene, regular follow-up is recommended, multiple surgical treatments are possibly required according to the disease condition, intraocular pressure reduction and nutritional nerve treatment are carried out in time, osteoporosis of part of patients is shown once, and regular detection of bone density and calcium supplement are recommended. As for parents and parents of a patient, the parents and the inventor carry out genetic consultation, the recurrence risk of offspring suffering from the primary congenital glaucoma is 1/4, the risk of the offspring becoming a carrier of the disease is 1/2, prenatal diagnosis, PGD, egg donation and semen donation can be carried out according to personal wishes if fertility needs exist, and the risk of offspring suffering from the primary congenital glaucoma is reduced.

Example 2 sequencing by Sanger method

The LTBP2 gene was tested in the primary congenital glaucoma patients described in example 1: designing a primer aiming at the c.4936G > C mutation of the LTBP2 gene, then obtaining a mutation site related sequence by a PCR amplification, product purification and sequencing method, and verifying the correlation between the c.4936G > C mutation of the LTBP2 gene and primary congenital glaucoma according to the fact that whether a sequence determination result belongs to a mutant type or a wild type.

The method comprises the following specific steps:

1. DNA extraction

Reference is made to the procedure for DNA extraction described in example 1.

2. Primer design and PCR reaction

First, with reference to the human genome sequence database hg 19/built 36.3, exon-specific primers for the c.4936G > C mutation of LTBP2 gene were designed, and the specific sequences were as follows:

LTBP2_E34F：GTTGCCAGGATCTCCCAGAG(SEQ ID NO:3)

LTBP2_E34R：GACCTCTGGCTTGGTGTGTCT(SEQ ID NO:4)

then, PCR reaction systems of the genome DNA samples are prepared and PCR reaction is carried out according to the following mixture ratio, wherein the 50-microliter reaction system comprises: 10 XBuffer 5 uL, genomic DNA 1 uL, forward primer F (SEQ ID NO:3)2 uL, reverse primer R (SEQ ID NO:4)2 uL, 10mM dNTP 5 u L, Taq enzyme 1 u L, ddH₂O34. mu.L. And (3) PCR reaction conditions: 95 ℃ for 5min, 30 cycles (95 ℃ for 15s, 62 ℃ for 40s, 72 ℃ for 45s), 72 DEG C5min, and keeping the temperature at 4 ℃. Finally obtaining PCR amplification products of the genome DNA samples of all the subjects.

3. Sequencing

Directly carrying out DNA sequencing on the PCR amplification product of the genome DNA sample of each subject obtained in the step 2. Sequencing was performed in forward and reverse directions using an ABI3730 sequencer. The sequencing result is compared with the nucleic acid sequence of LTBP2 gene shown as SEQ ID NO. 1. Based on the comparison result, the existence of the c.4936G > C mutation site of the LTBP2 gene in the family members of the primary congenital glaucoma can be checked. The patients (probands) in the family carry c.4936G > C homozygous mutation through comparison, and the results are shown in figure 2; the polypeptide coded by the mutant has p.Glu1646Gln variation compared with the amino acid sequence shown in SEQ ID NO. 2. Thus, it was further demonstrated that c.4936G > C (p.Glu1646Gln) of the LTBP2 gene is a novel pathogenic site for primary congenital glaucoma, and that heterozygous mutations in c.4936G > C of the LTBP2 gene can lead to this disease.

Reference throughout this specification to the description of "one embodiment," "some embodiments," "an embodiment," "a specific embodiment," or the like means that a particular feature, structure, material, or characteristic described in connection with the embodiment is included in at least one embodiment of the invention and is not specifically referred to.

It should be noted that, although the above embodiments have been described herein, the invention is not limited thereto. Therefore, based on the innovative concepts of the present invention, the technical solutions of the present invention can be directly or indirectly applied to other related technical fields by making changes and modifications to the embodiments described herein, or by using equivalent structures or equivalent processes performed in the content of the present specification and the attached drawings, which are included in the scope of the present invention.

Sequence listing

<110> Fuzhou Furui medical laboratory Co., Ltd

<120> nucleic acid for encoding LTBP2 gene mutant and application thereof

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>5466

<212>DNA

<213> human (human)

<400>1

atgaggccgc ggaccaaagc ccgcagcccg gggcgcgccc tgcggaaccc ctggagaggc 60

ttcctgccgc tcaccctggc tctcttcgtg ggcgcgggtc atgcccaaag ggaccccgta 120

gggagatacg agccggctgg tggagacgcg aatcgactgc ggcgccctgg gggcagctac 180

ccggcagcgg ctgcagccaa ggtgtacagt ctgttccggg agcaggacgc gcctgtcgcg 240

ggcttgcagc ccgtggagcg ggcccagccg ggctggggga gccccaggag gcccaccgag 300

gcggaggcca ggaggccgtc ccgcgcgcag cagtcgcggc gtgtccagcc acctgcgcag 360

acccggagaa gcactcccct gggccagcag caaccagcac cccggacccg ggccgcgccg 420

gctctcccac gcctggggac cccacagcgg tctggggctg cgcccccaac cccgccgcga 480

gggcggctca cggggaggaa cgtctgcggg ggacagtgct gcccaggatg gacaacagca 540

aacagcacca accactgtat caaacccgtt tgcgagccgc cgtgccagaa ccggggctcc 600

tgcagccgcc cgcagctctg tgtctgccgc tctggtttcc gtggagcccg ctgcgaggag 660

gtcattcccg atgaggaatt tgacccccag aactccaggc tggcacctcg acgctgggcc 720

gagcgttcac ccaacctgcg caggagcagt gcggctggag agggcacctt ggccagagca 780

cagccgccag caccacagtc gccgcccgca ccacagtcgc caccagctgg gaccctgagt 840

ggcctcagcc agacccaccc ttcccagcag cacgtggggt tgtcccgcac tgtccgactt 900

cacccgactg ccacggccag tagccagctc tcttccaacg ccctgccccc gggaccaggc 960

cttgagcaga gagatggcac ccaacaggcg gtacctctgg agcacccctc atccccctgg 1020

gggctgaacc tcacggagaa aatcaagaag atcaagatcg tcttcactcc caccatctgc 1080

aagcagacct gtgcccgtgg acactgtgcc aacagctgtg agaggggcga caccaccacc 1140

ctgtacagcc agggcggcca tgggcacgat cccaagtctg gcttccgcat ctatttctgc 1200

cagatcccct gcctgaacgg aggccgctgc atcggcaggg acgaatgctg gtgccccgcc 1260

aactccaccg ggaagttctg ccacctgcct atcccgcagc cggacaggga gcctccaggg 1320

agggggtccc gccccagggc cttgctggaa gccccactga agcagtccac tttcacactg 1380

ccgctctcca accagctggc ctccgtgaac ccctccctgg tgaaggtgca cattcaccac 1440

ccacccgagg cctcagtgca gatccaccag gtggcccagg tgcggggcgg ggtggaggag 1500

gccctagtgg agaacagcgt ggagaccaga cccccgccct ggctgcctgc cagccctggc 1560

cacagcctct gggacagcaa caacatccct gctcggtctg gagagccccc tcggccactg 1620

cccccagcag cacccaggcc tcgaggactg ctgggccggt gttacctgaa cactgtgaac 1680

ggacagtgtg ccaaccctct gctggagctg actacccagg aggactgctg tggcagtgtg 1740

ggagccttct ggggggtgac tttgtgtgcc ccatgcccac ccagaccagc ctccccggtg 1800

attgagaatg gccagctgga gtgtcctcag gggtacaaga gactgaacct cactcactgc 1860

caagatatca acgagtgctt gaccctgggc ctgtgcaagg acgcggagtg tgtgaatacc 1920

aggggcagct acctgtgcac atgcagacct ggcctcatgc tggatccatc gcggagccgc 1980

tgtgtgtcgg acaaggcaat ctccatgctg cagggactgt gctaccggtc gctggggccc 2040

ggcacctgca ccctgccttt ggcccagcgg atcaccaagc agatatgctg ctgcagccgc 2100

gtgggcaaag catggggcag cgagtgtgag aaatgccctc tgcctggcac agaggccttc 2160

agagagatct gccctgccgg ccacggctac acctacgcga gctccgacat ccgcctgtcc 2220

atgaggaaag ccgaggagga ggaactggca aggcccccaa gggagcaagg gcagaggagc 2280

agcggggcac tgcccgggcc agcagagagg cagcccctcc gggtcgtcac ggacacctgg 2340

cttgaggccg ggaccatccc tgacaagggt gactctcagg ctggccaggt cacgaccagt 2400

gtcactcatg cacctgcctg ggtcacaggg aatgccacaa ccccaccaat gcctgaacag 2460

gggattgcag agatacagga agaacaagtg accccctcca ctgatgtgct ggtgaccctg 2520

agcaccccag gcattgacag atgcgctgct ggagccacca acgtctgtgg ccctggaacc 2580

tgcgtgaacc tccccgatgg atacagatgt gtctgcagcc ctggctacca gctgcacccc 2640

agccaggcct actgcacaga tgacaacgag tgtctgaggg acccctgcaa gggaaaaggg 2700

cgctgcatca accgcgtggg gtcctactcc tgcttctgct accctggcta cactctggcc 2760

acctcagggg cgacacagga gtgtcaagat atcaatgagt gtgagcagcc aggggtgtgc 2820

agcggggggc agtgcaccaa caccgagggc tcgtaccact gcgagtgtga tcagggctac 2880

atcatggtca ggaaaggaca ctgccaagat atcaacgaat gccgtcaccc cggtacctgc 2940

cctgatggga gatgcgtcaa ttcccctggc tcctacactt gtctggcctg tgaggagggc 3000

taccggggcc agagtgggag ctgtgtagat gtgaatgagt gtctgactcc cggggtctgt 3060

gcccatggaa agtgcaccaa cctagaaggc tccttcagat gctcttgtga gcagggctat 3120

gaggtcacct cagatgagaa gggctgccaa gatgtggatg agtgtgccag ccgggcctca 3180

tgccccacag gcctctgcct caacacggag ggctccttcg cctgctctgc ctgtgagaac 3240

gggtactggg tgaatgaaga cggcactgcc tgtgaagacc tagatgagtg tgccttcccg 3300

ggagtctgcc cctccggagt ctgcaccaac acggctggct ccttctcctg caaggactgc 3360

gatgggggct accggcccag ccccctgggt gactcctgtg aagatgtgga tgaatgtgaa 3420

gacccccaga gcagctgcct gggaggcgag tgcaagaaca ctgtgggctc ctaccagtgc 3480

ctctgtcccc agggcttcca gctggccaat ggcaccgtgt gtgaggatgt gaatgagtgc 3540

atgggggagg agcactgcgc accccacggc gagtgcctca acagccacgg gtctttcttc 3600

tgtctgtgcg cgcctggctt cgtcagcgca gaggggggca ccagctgcca ggatgtggac 3660

gagtgtgcca ccacagaccc gtgtgtggga gggcactgtg tcaacaccga gggctccttc 3720

aactgtctat gtgagactgg cttccagccc tccccagaga gtggagagtg tgtggatatt 3780

gacgagtgtg aggactatgg agacccggtg tgtggcacct ggaagtgtga aaacagccct 3840

ggctcctacc gctgtgttct gggctgccag cctggcttcc acatggcccc gaacggagac 3900

tgcattgaca tagacgagtg cgccaacgac accatgtgtg gcagccacgg cttctgtgac 3960

aacactgatg gctccttccg ctgcctctgt gaccagggct tcgagatctc tccctcaggc 4020

tgggactgtg tggatgtgaa cgagtgtgag cttatgctgg cggtatgtgg ggccgcgctc 4080

tgtgagaacg tggagggctc cttcctgtgc ctctgtgcca gtgacctgga ggagtacgat 4140

gcccaggagg ggcactgccg cccacggggg gctggaggtc agagtatgtc tgaggcccca 4200

acgggggacc atgccccggc ccccacccgc atggactgct actccgggca gaagggccat 4260

gcgccctgct ccagtgtcct gggccggaac accacacagg ctgaatgctg ctgcacccag 4320

ggcgctagct ggggagatgc ctgtgacctc tgcccgtctg aggactcagc tgaattcagc 4380

gagatctgcc ctagtggaaa aggctacatt cctgtggaag gagcctggac gtttggacag 4440

accatgtaca cagatgcgga tgagtgtgtg atattcgggc ctggtctctg cccgaacggc 4500

cggtgcctca acaccgtgcc tggttatgtc tgcctgtgca atcccggctt ccactacgat 4560

gcttcccaca agaagtgtga ggatcacgat gagtgccagg acctggcctg tgagaatggc 4620

gagtgcgtca acacggaggg ctccttccac tgcttctgca gccccccgct caccctggac 4680

ctcagccagc agcgctgcat gaacagcacc agcagcacgg aggacctccc tgaccacgac 4740

atccacatgg acatctgctg gaaaaaagtc accaatgatg tgtgcagcga acccctgcgt 4800

gggcaccgca ccacctacac ggaatgctgc tgccaggacg gcgaggcctg gagccagcag 4860

tgtgctctgt gtcccccgag gagctctgag gtctatgctc agctgtgcaa cgtggctcgc 4920

attgaggcag agcgggaggc cggggtccac ttccggccag gctatgagta tggccccggg 4980

cccgatgacc tgcactacag catctatggc ccagatgggg cccccttcta caactacctg 5040

ggccccgagg acaccgtccc tgagcctgcc ttccccaaca cagccggtca ctcagcggac 5100

cgcacaccca tccttgagtc tcctttgcag ccctcagaac tccagcccca ctacgtggcc 5160

agccatccag agcccccagc cggcttcgaa gggcttcagg cggaggagtg cggcatcctg 5220

aacggctgtg agaatggccg ctgtgtgcgc gtgcgggagg gctacacctg tgactgtttt 5280

gagggcttcc agctggatgc ggcccacatg gcctgcgtag atgtgaatga gtgtgatgac 5340

ttgaacgggc ctgctgtgct ctgtgtccat ggttactgcg agaacacaga gggctcctac 5400

cgctgccact gctccccggg atatgtggct gaggcagggc ccccccactg cactgccaag 5460

gagtag 5466

<210>2

<211>1821

<212>PRT

<213> human (human)

<400>2

Met Arg Pro Arg Thr Lys Ala Arg Ser Pro Gly Arg Ala Leu Arg Asn

1 5 10 15

Pro Trp Arg Gly Phe Leu Pro Leu Thr Leu Ala Leu Phe Val Gly Ala

20 25 30

Gly His Ala Gln Arg Asp Pro Val Gly Arg Tyr Glu Pro Ala Gly Gly

35 40 45

Asp Ala Asn Arg Leu Arg Arg Pro Gly Gly Ser Tyr Pro Ala Ala Ala

50 55 60

Ala Ala Lys Val Tyr Ser Leu Phe Arg Glu Gln Asp Ala Pro Val Ala

65 70 75 80

Gly Leu Gln Pro Val Glu Arg Ala Gln Pro Gly Trp Gly Ser Pro Arg

85 90 95

Arg Pro Thr Glu Ala Glu Ala Arg Arg Pro Ser Arg Ala Gln Gln Ser

100 105 110

Arg Arg Val Gln Pro Pro Ala Gln Thr Arg Arg Ser Thr Pro Leu Gly

115 120 125

Gln Gln Gln Pro Ala Pro Arg Thr Arg Ala Ala Pro Ala Leu Pro Arg

130 135 140

Leu Gly Thr Pro Gln Arg Ser Gly Ala Ala Pro Pro Thr Pro Pro Arg

145 150 155 160

Gly Arg Leu Thr Gly Arg Asn Val Cys Gly Gly Gln Cys Cys Pro Gly

165 170 175

Trp Thr Thr Ala Asn Ser Thr Asn His Cys Ile Lys Pro Val Cys Glu

180 185 190

Pro Pro Cys Gln Asn Arg Gly Ser Cys Ser Arg Pro Gln Leu Cys Val

195 200 205

Cys Arg Ser Gly Phe Arg Gly Ala Arg Cys Glu Glu Val Ile Pro Asp

210 215 220

Glu Glu Phe Asp Pro Gln Asn Ser Arg Leu Ala Pro Arg Arg Trp Ala

225 230 235 240

Glu Arg Ser Pro Asn Leu Arg Arg Ser Ser Ala Ala Gly Glu Gly Thr

245 250 255

Leu Ala Arg Ala Gln Pro Pro Ala Pro Gln Ser Pro Pro Ala Pro Gln

260 265 270

Ser Pro Pro Ala Gly Thr Leu Ser Gly Leu Ser Gln Thr His Pro Ser

275 280 285

Gln Gln His Val Gly Leu Ser Arg Thr Val Arg Leu His Pro Thr Ala

290 295 300

Thr Ala Ser Ser Gln Leu Ser Ser Asn Ala Leu Pro Pro Gly Pro Gly

305 310 315 320

Leu Glu Gln Arg Asp Gly Thr Gln Gln Ala Val Pro Leu Glu His Pro

325 330 335

Ser Ser Pro Trp Gly Leu Asn Leu Thr Glu Lys Ile Lys Lys Ile Lys

340 345 350

Ile Val Phe Thr Pro Thr Ile Cys Lys Gln Thr Cys Ala Arg Gly His

355 360 365

Cys Ala Asn Ser Cys Glu Arg Gly Asp Thr Thr Thr Leu Tyr Ser Gln

370 375 380

Gly Gly His Gly His Asp Pro Lys Ser Gly Phe Arg Ile Tyr Phe Cys

385 390 395 400

Gln Ile Pro Cys Leu Asn Gly Gly Arg Cys Ile Gly Arg Asp Glu Cys

405 410 415

Trp Cys Pro Ala Asn Ser Thr Gly Lys Phe Cys His Leu Pro Ile Pro

420 425 430

Gln Pro Asp Arg Glu Pro Pro Gly Arg Gly Ser Arg Pro Arg Ala Leu

435 440 445

Leu Glu Ala Pro Leu Lys Gln Ser Thr Phe Thr Leu Pro Leu Ser Asn

450 455 460

Gln Leu Ala Ser Val Asn Pro Ser Leu Val Lys Val His Ile His His

465 470 475 480

Pro Pro Glu Ala Ser Val Gln Ile His Gln Val Ala Gln Val Arg Gly

485 490 495

Gly Val Glu Glu Ala Leu Val Glu Asn Ser Val Glu Thr Arg Pro Pro

500 505 510

Pro Trp Leu Pro Ala Ser Pro Gly His Ser Leu Trp Asp Ser Asn Asn

515 520 525

Ile Pro Ala Arg Ser Gly Glu Pro Pro Arg Pro Leu Pro Pro Ala Ala

530 535 540

Pro Arg Pro Arg Gly Leu Leu Gly Arg Cys Tyr Leu Asn Thr Val Asn

545 550 555 560

Gly Gln Cys Ala Asn Pro Leu Leu Glu Leu Thr Thr Gln Glu Asp Cys

565 570 575

Cys Gly Ser Val Gly Ala Phe Trp Gly Val Thr Leu Cys Ala Pro Cys

580 585 590

Pro Pro Arg Pro Ala Ser Pro Val Ile Glu Asn Gly Gln Leu Glu Cys

595 600 605

Pro Gln Gly Tyr Lys Arg Leu Asn Leu Thr His Cys Gln Asp Ile Asn

610 615 620

Glu Cys Leu Thr Leu Gly Leu Cys Lys Asp Ala Glu Cys Val Asn Thr

625 630 635 640

Arg Gly Ser Tyr Leu Cys Thr Cys Arg Pro Gly Leu Met Leu Asp Pro

645 650 655

Ser Arg Ser Arg Cys Val Ser Asp Lys Ala Ile Ser Met Leu Gln Gly

660 665 670

Leu Cys Tyr Arg Ser Leu Gly Pro Gly Thr Cys Thr Leu Pro Leu Ala

675680 685

Gln Arg Ile Thr Lys Gln Ile Cys Cys Cys Ser Arg Val Gly Lys Ala

690 695 700

Trp Gly Ser Glu Cys Glu Lys Cys Pro Leu Pro Gly Thr Glu Ala Phe

705 710 715 720

Arg Glu Ile Cys Pro Ala Gly His Gly Tyr Thr Tyr Ala Ser Ser Asp

725 730 735

Ile Arg Leu Ser Met Arg Lys Ala Glu Glu Glu Glu Leu Ala Arg Pro

740 745 750

Pro Arg Glu Gln Gly Gln Arg Ser Ser Gly Ala Leu Pro Gly Pro Ala

755 760 765

Glu Arg Gln Pro Leu Arg Val Val Thr Asp Thr Trp Leu Glu Ala Gly

770 775 780

Thr Ile Pro Asp Lys Gly Asp Ser Gln Ala Gly Gln Val Thr Thr Ser

785 790 795 800

Val Thr His Ala Pro Ala Trp Val Thr Gly Asn Ala Thr Thr Pro Pro

805 810 815

Met Pro Glu Gln Gly Ile Ala Glu Ile Gln Glu Glu Gln Val Thr Pro

820 825 830

Ser Thr Asp Val Leu Val Thr Leu Ser Thr Pro Gly Ile Asp Arg Cys

835840 845

Ala Ala Gly Ala Thr Asn Val Cys Gly Pro Gly Thr Cys Val Asn Leu

850 855 860

Pro Asp Gly Tyr Arg Cys Val Cys Ser Pro Gly Tyr Gln Leu His Pro

865 870 875 880

Ser Gln Ala Tyr Cys Thr Asp Asp Asn Glu Cys Leu Arg Asp Pro Cys

885 890 895

Lys Gly Lys Gly Arg Cys Ile Asn Arg Val Gly Ser Tyr Ser Cys Phe

900 905 910

Cys Tyr Pro Gly Tyr Thr Leu Ala Thr Ser Gly Ala Thr Gln Glu Cys

915 920 925

Gln Asp Ile Asn Glu Cys Glu Gln Pro Gly Val Cys Ser Gly Gly Gln

930 935 940

Cys Thr Asn Thr Glu Gly Ser Tyr His Cys Glu Cys Asp Gln Gly Tyr

945 950 955 960

Ile Met Val Arg Lys Gly His Cys Gln Asp Ile Asn Glu Cys Arg His

965 970 975

Pro Gly Thr Cys Pro Asp Gly Arg Cys Val Asn Ser Pro Gly Ser Tyr

980 985 990

Thr Cys Leu Ala Cys Glu Glu Gly Tyr Arg Gly Gln Ser Gly Ser Cys

995 10001005

Val Asp Val Asn Glu Cys Leu Thr Pro Gly Val Cys Ala His Gly Lys

1010 1015 1020

Cys Thr Asn Leu Glu Gly Ser Phe Arg Cys Ser Cys Glu Gln Gly Tyr

1025 1030 1035 1040

Glu Val Thr Ser Asp Glu Lys Gly Cys Gln Asp Val Asp Glu Cys Ala

1045 1050 1055

Ser Arg Ala Ser Cys Pro Thr Gly Leu Cys Leu Asn Thr Glu Gly Ser

1060 1065 1070

Phe Ala Cys Ser Ala Cys Glu Asn Gly Tyr Trp Val Asn Glu Asp Gly

1075 1080 1085

Thr Ala Cys Glu Asp Leu Asp Glu Cys Ala Phe Pro Gly Val Cys Pro

1090 1095 1100

Ser Gly Val Cys Thr Asn Thr Ala Gly Ser Phe Ser Cys Lys Asp Cys

1105 1110 1115 1120

Asp Gly Gly Tyr Arg Pro Ser Pro Leu Gly Asp Ser Cys Glu Asp Val

1125 1130 1135

Asp Glu Cys Glu Asp Pro Gln Ser Ser Cys Leu Gly Gly Glu Cys Lys

1140 1145 1150

Asn Thr Val Gly Ser Tyr Gln Cys Leu Cys Pro Gln Gly Phe Gln Leu

1155 11601165

Ala Asn Gly Thr Val Cys Glu Asp Val Asn Glu Cys Met Gly Glu Glu

1170 1175 1180

His Cys Ala Pro His Gly Glu Cys Leu Asn Ser His Gly Ser Phe Phe

1185 1190 1195 1200

Cys Leu Cys Ala Pro Gly Phe Val Ser Ala Glu Gly Gly Thr Ser Cys

1205 1210 1215

Gln Asp Val Asp Glu Cys Ala Thr Thr Asp Pro Cys Val Gly Gly His

1220 1225 1230

Cys Val Asn Thr Glu Gly Ser Phe Asn Cys Leu Cys Glu Thr Gly Phe

1235 1240 1245

Gln Pro Ser Pro Glu Ser Gly Glu Cys Val Asp Ile Asp Glu Cys Glu

1250 1255 1260

Asp Tyr Gly Asp Pro Val Cys Gly Thr Trp Lys Cys Glu Asn Ser Pro

1265 1270 1275 1280

Gly Ser Tyr Arg Cys Val Leu Gly Cys Gln Pro Gly Phe His Met Ala

1285 1290 1295

Pro Asn Gly Asp Cys Ile Asp Ile Asp Glu Cys Ala Asn Asp Thr Met

1300 1305 1310

Cys Gly Ser His Gly Phe Cys Asp Asn Thr Asp Gly Ser Phe Arg Cys

1315 1320 1325

Leu Cys Asp Gln Gly Phe Glu Ile Ser Pro Ser Gly Trp Asp Cys Val

1330 1335 1340

Asp Val Asn Glu Cys Glu Leu Met Leu Ala Val Cys Gly Ala Ala Leu

1345 1350 1355 1360

Cys Glu Asn Val Glu Gly Ser Phe Leu Cys Leu Cys Ala Ser Asp Leu

1365 1370 1375

Glu Glu Tyr Asp Ala Gln Glu Gly His Cys Arg Pro Arg Gly Ala Gly

1380 1385 1390

Gly Gln Ser Met Ser Glu Ala Pro Thr Gly Asp His Ala Pro Ala Pro

1395 1400 1405

Thr Arg Met Asp Cys Tyr Ser Gly Gln Lys Gly His Ala Pro Cys Ser

1410 1415 1420

Ser Val Leu Gly Arg Asn Thr Thr Gln Ala Glu Cys Cys Cys Thr Gln

1425 1430 1435 1440

Gly Ala Ser Trp Gly Asp Ala Cys Asp Leu Cys Pro Ser Glu Asp Ser

1445 1450 1455

Ala Glu Phe Ser Glu Ile Cys Pro Ser Gly Lys Gly Tyr Ile Pro Val

1460 1465 1470

Glu Gly Ala Trp Thr Phe Gly Gln Thr Met Tyr Thr Asp Ala Asp Glu

14751480 1485

Cys Val Ile Phe Gly Pro Gly Leu Cys Pro Asn Gly Arg Cys Leu Asn

1490 1495 1500

Thr Val Pro Gly Tyr Val Cys Leu Cys Asn Pro Gly Phe His Tyr Asp

1505 1510 1515 1520

Ala Ser His Lys Lys Cys Glu Asp His Asp Glu Cys Gln Asp Leu Ala

1525 1530 1535

Cys Glu Asn Gly Glu Cys Val Asn Thr Glu Gly Ser Phe His Cys Phe

1540 1545 1550

Cys Ser Pro Pro Leu Thr Leu Asp Leu Ser Gln Gln Arg Cys Met Asn

1555 1560 1565

Ser Thr Ser Ser Thr Glu Asp Leu Pro Asp His Asp Ile His Met Asp

1570 1575 1580

Ile Cys Trp Lys Lys Val Thr Asn Asp Val Cys Ser Glu Pro Leu Arg

1585 1590 1595 1600

Gly His Arg Thr Thr Tyr Thr Glu Cys Cys Cys Gln Asp Gly Glu Ala

1605 1610 1615

Trp Ser Gln Gln Cys Ala Leu Cys Pro Pro Arg Ser Ser Glu Val Tyr

1620 1625 1630

Ala Gln Leu Cys Asn Val Ala Arg Ile Glu Ala Glu Arg Glu Ala Gly

16351640 1645

Val His Phe Arg Pro Gly Tyr Glu Tyr Gly Pro Gly Pro Asp Asp Leu

1650 1655 1660

His Tyr Ser Ile Tyr Gly Pro Asp Gly Ala Pro Phe Tyr Asn Tyr Leu

1665 1670 1675 1680

Gly Pro Glu Asp Thr Val Pro Glu Pro Ala Phe Pro Asn Thr Ala Gly

1685 1690 1695

His Ser Ala Asp Arg Thr Pro Ile Leu Glu Ser Pro Leu Gln Pro Ser

1700 1705 1710

Glu Leu Gln Pro His Tyr Val Ala Ser His Pro Glu Pro Pro Ala Gly

1715 1720 1725

Phe Glu Gly Leu Gln Ala Glu Glu Cys Gly Ile Leu Asn Gly Cys Glu

1730 1735 1740

Asn Gly Arg Cys Val Arg Val Arg Glu Gly Tyr Thr Cys Asp Cys Phe

1745 1750 1755 1760

Glu Gly Phe Gln Leu Asp Ala Ala His Met Ala Cys Val Asp Val Asn

1765 1770 1775

Glu Cys Asp Asp Leu Asn Gly Pro Ala Val Leu Cys Val His Gly Tyr

1780 1785 1790

Cys Glu Asn Thr Glu Gly Ser Tyr Arg Cys His Cys Ser Pro Gly Tyr

17951800 1805

Val Ala Glu Ala Gly Pro Pro His Cys Thr Ala Lys Glu

1810 1815 1820

<210>3

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>3

gttgccagga tctcccagag 20

<210>4

<211>21

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>4

gacctctggc ttggtgtgtc t 21

Claims

1. A nucleic acid encoding a mutant LTBP2 gene, wherein: compared with SEQ ID NO:1, the gene sequence of the nucleic acid has c.4936G > C mutation.

2. A primer for detecting a nucleic acid encoding an LTBP2 gene mutant, wherein: the primer sequences are as follows:

LTBP2_E34F：GTTGCCAGGATCTCCCAGAG(SEQ ID NO:3)；

LTBP2_E34R：GACCTCTGGCTTGGTGTGTCT(SEQ ID NO:4)。

3. a detection kit for nucleic acid encoding LTBP2 gene mutant, which is characterized in that: the kit comprises the primer of claim 2.

4. Use of a nucleic acid encoding a LTBP2 gene mutant according to claim 1 in the preparation of a reagent for screening a biological sample susceptible to primary congenital glaucoma.

5. Use of a primer for detecting a nucleic acid encoding a LTBP2 gene mutant according to claim 2in the preparation of a reagent for detecting a biological sample predisposed to primary congenital glaucoma.

6. An isolated polypeptide, characterized in that: the polypeptide is encoded by the nucleic acid which encodes the LTBP2 gene mutant and has the amino acid sequence with p.Glu1646Gln mutation compared with SEQ ID NO. 2, of claim 1.

7. Use of the isolated polypeptide of claim 6 in the preparation of a test agent for screening a biological sample susceptible to primary congenital glaucoma.