CN110927389B

CN110927389B - Cancer biomarker and application

Info

Publication number: CN110927389B
Application number: CN201911246997.8A
Authority: CN
Inventors: 高山; 王晓冬
Original assignee: Suzhou Institute of Biomedical Engineering and Technology of CAS
Current assignee: Suzhou Institute of Biomedical Engineering and Technology of CAS
Priority date: 2019-11-29
Filing date: 2019-12-09
Publication date: 2021-07-16
Anticipated expiration: 2039-12-09
Also published as: WO2021114201A1; CN110927389A

Abstract

The invention relates to the field of tumor molecular biology, in particular to a cancer biomarker and application, wherein the cancer biomarker comprises programmed death molecules PD-1, genes PDCD1 and/or PD-1mRNA in tumor cells; PD-1 is expressed in tumor cells in a broad spectrum and plays a role in inhibiting the growth of the tumor cells. The cancer biomarker is used for predicting, evaluating or identifying the treatment effectiveness of the PD-1 antibody on tumor patients with immunodeficiency or low immunity, predicting the tumor patients who are not suitable for the treatment of the PD-1 antibody, providing more effective medication and treatment selection suggestions for the tumor patients, giving important warnings for the clinical application of immunotherapy in the future, reducing the treatment risk of the tumor patients, reducing the pain of the patients and prolonging the life of the patients, and solving the problem that the tumor patients which are possibly not suitable for the treatment of the PD-1 antibody cannot be evaluated because no predictive biomarker for treating the tumor by the PD-1 antibody exists in the prior art.

Description

Cancer biomarker and application

Technical Field

The invention relates to the field of tumor molecular biology, in particular to a cancer biomarker and application.

Background

Programmed cell death protein 1(PD-1) is a type I transmembrane glycoprotein and is an important negative regulator in immune response. Under normal conditions, PD-1 inhibits the function of T lymphocytes by binding to its ligand PD-L1, PD-L2, thereby suppressing the autoimmune response. The therapeutic mechanism of the PD-1 antibody and the PD-L1 antibody is that the PD-L1 on the surface of the tumor cell can not be combined with the PD-1 on the surface of the T cell and the PD-L1 on the surface of the tumor cell respectively, then the T cell is activated, and finally the killed tumor cell is identified. Currently, therapeutic antibodies against PD-1, anti-PD-L1, which are immune checkpoint blockers, have been used to treat a variety of human tumors, such as melanoma, renal cell carcinoma, NSCLC, and hodgkin's lymphoma. However, the therapeutic response to these antibodies is only effective in a small fraction of patients, and some patients are not treated, but instead show a pseudo-progressive and hyper-progressive pattern. A pseudoprogression is a phenomenon in which a patient, after being treated with an antibody, develops an enlarged tumor in a short time and then becomes smaller. The hyper-progressive mode means that after a patient receives antibody treatment, the tumor is enlarged and the disease condition is aggravated. For these two post-treatment aberrant responses, no clear mechanism of occurrence has been found so far. Thus, despite significant advances in the use of antibody therapy, there remains a need to find improved therapies. The most suitable antibody treatment method for tumor patients is identified in advance, so that the treatment risk of the patients is reduced, the pain of the patients is reduced, the early recovery of the patients is promoted, and the life of the patients is prolonged.

Recent review articles indicate that there is a great need to accelerate the development of biomarkers and their use for improving the diagnosis and treatment of cancer. As can be seen from the above, cancer biomarkers are also gaining increasing attention in order to improve the diagnosis and treatment of cancer. Currently, three different types of cancer biomarkers are known: (1) a prognostic biomarker; (2) a predictive biomarker; and (3) a Pharmacodynamic (PD) biomarker. Predictive biomarkers are used to assess the likelihood that a particular patient will benefit from treatment with a particular drug. For example, patients with breast cancer, whose ERBB2(HER2) gene was amplified, may benefit from treatment with trastuzumab, whereas patients without ERBB2 gene amplification may not benefit from treatment with trastuzumab. The predictive biomarkers described above will aid in the screening identification of the most likely appropriate drugs and therapies for tumor patients.

However, no predictive biomarker for tumor treatment with PD-1 antibody has been proposed, and only some tumor patients were found to be unresponsive, poorly responsive or over-advanced to PD-1 antibody treatment, and it is not clear that tumor patients for which PD-1 antibody treatment is appropriate, increased the risk of treatment of tumor patients for which PD-1 antibody treatment is appropriate, and failed to effectively treat tumor patients for which PD-1 antibody treatment is appropriate, and at the same time failed to propose more optimal drug selection and therapy for tumor patients for which PD-1 antibody treatment is inappropriate.

Disclosure of Invention

Therefore, the technical problem to be solved by the present invention is to overcome the problem that in the prior art, there is no predictive biomarker for treating tumor with PD-1 antibody, which cannot evaluate tumor patients who may not be suitable for treatment with PD-1 antibody, resulting in increased risk of tumor patients being treated with PD-1 antibody, increased patient pain, and easily delaying the optimal treatment time of patients, and further provide a cancer biomarker, which can be used for predicting, evaluating or identifying the effectiveness of PD-1 antibody for treatment of tumor patients, predicting tumor patients who are not suitable for treatment with PD-1 antibody, providing more effective medication and treatment selection suggestions for tumor patients, reducing treatment risk of tumor patients, reducing patient pain, and prolonging patient life.

Therefore, the invention provides the following technical scheme:

the invention provides a cancer biomarker, which comprises programmed death molecules in tumor cells, gene PDCD1 and/or PD-1 mRNA; the cancer biomarker has tumor inhibiting effect.

Preferably, the cancer includes any one of blood cancer, breast cancer, colon cancer, pancreatic cancer, prostate cancer, bone cancer, kidney cancer, skin cancer, cervical cancer, brain cancer, liver cancer, stomach cancer or lung cancer.

Preferably, the cells of the blood cancer include Raji, K-562, Jeko-1, U-937 or Jurkat; cells of breast cancer include MCF-7, SK-BR-3 or T47D; cells of intestinal cancer include HT-29, RKO, SW480 or HCT 116; cells of pancreatic cancer include HPDE6C, BxpC-3 or AspC-1; cells of prostate cancer include PC-3, 22Rv1, DU145 or LNCaP; cells of bone cancer include CRL8303 or U-2 OS; the cell of renal cancer comprises ACHN, 769-P, 786-O or Caki-1; cells of skin cancer include B16F10 or A-375; cells of cervical cancer include Ca Ski or Hela; cells of brain cancer include M059J, SKNSH, M059K or SK-N-BE (2); liver cancer cells include Huh-7 or HepG 2; cells from gastric cancer include HGC-27; cells of lung cancer include A549, HCC827, Calu-1, or NCI-H1299.

The present invention provides the use of cancer biomarkers for inhibiting the above-mentioned tumors.

Further, the use comprises the use of the cancer biomarker for inhibiting the growth of a tumor as described above in vitro.

Further, the application comprises the application in the preparation of tumor inhibition products.

The invention provides the use of cancer biomarkers to reduce the level of p-ERK and p-AKT expression in tumors.

Further, the use comprises the use of the cancer biomarker in reducing the expression level of p-ERK and p-AKT in a tumor in vitro.

Further, the application comprises the preparation of products for reducing the expression level of p-ERK and/or p-AKT in tumors.

The invention provides the use of cancer biomarkers or agents that detect the presence or level thereof to predict, assess or identify the effectiveness of PD-1 antibodies in cancer inhibition, guide drug selection or therapy selection.

Further, the use includes the use of the product for predicting, assessing or identifying the effectiveness of a PD-1 antibody for cancer inhibition, guiding medication or therapy selection; preferably, the cancer is in an immunodeficiency or immunocompromised environment.

Further, the PD-1 antibody includes Nivolumab or Pembrolizumab.

Further, the reagents include reagents for detecting the presence or level of the cancer biomarker using RT-PCR, fluorescent real-time quantitative PCR, ImmunoBlot, or FACS.

The present invention provides a method of predicting, assessing or identifying a PD-1 antibody as therapeutically effective for inhibiting, selecting for administration or selecting for therapy in a cancer patient, comprising:

determining whether said cancer biomarker is present in a tumor sample from an immunodeficient or immunocompromised cancer patient and if the determination indicates presence, indicating that PD-1 antibody is ineffective to treat said cancer patient or that hyper-progression is likely to occur; or

Determining whether the cancer biomarker is present in a tumor sample of a cancer patient having an immunodeficiency or low immune function, and if the determination indicates that the biomarker is present, indicating that the cancer patient is not eligible for treatment with a PD-1 antibody drug; or

Determining the presence or absence of said cancer biomarker in a tumor sample from an immunodeficient or immunocompromised cancer patient, and if the determination indicates the presence, indicating that said cancer patient is not amenable to treatment with a treatment comprising a PD-1 antibody drug.

Further, in the method, the cancer includes any one of the above-mentioned blood cancer, breast cancer, colon cancer, pancreatic cancer, prostate cancer, bone cancer, kidney cancer, skin cancer, cervical cancer, brain cancer, liver cancer, stomach cancer or lung cancer.

Further, in the method, the cells of the blood cancer include Raji, K-562, Jeko-1, U-937 or Jurkat; cells of breast cancer include MCF-7, SK-BR-3 or T47D; cells of intestinal cancer include HT-29, RKO, SW480 or HCT 116; cells of pancreatic cancer include HPDE6C, BxpC-3 or AspC-1; cells of prostate cancer include PC-3, 22Rv1, DU145 or LNCaP; cells of bone cancer include CRL8303 or U-2 OS; the cell of renal cancer comprises ACHN, 769-P, 786-O or Caki-1; cells of skin cancer include B16F10 or A-375; cells of cervical cancer include Ca Ski or Hela; cells of brain cancer include M059J, SKNSH, M059K or SK-N-BE (2); liver cancer cells include Huh-7 or HepG 2; cells from gastric cancer include HGC-27; cells of lung cancer include A549, HCC827, Calu-1, or NCI-H1299.

The technical scheme of the invention has the following advantages:

1. the invention provides a cancer biomarker, which comprises programmed death molecule 1(PD-1), gene PDCD1 and/or PD-1mRNA in tumor cells; as the inventor further researches on PD-1 molecules, the PD-1 is expressed in tumor cells in a broad spectrum and plays a role in inhibiting the growth of the tumor cells. In addition, the invention utilizes commercial PD-1 antibodies Nivolumab, Pembrolizumab and the like to carry out antibody blocking experiments, finds that the antibodies have certain promotion effect on the growth of tumor cells (in vivo and in vitro experiments), and also finds that PD-1 influences the proliferation of the cells in the tumor cells through two major signal paths of AKT and ERK, so on the basis, the invention provides a novel cancer biomarker applied by the immune-related therapeutic PD-1 antibody, is used for predicting, evaluating or identifying the effectiveness of the PD-1 antibody in treating tumor patients with immunodeficiency or low immune function, predicting the tumor patients unsuitable for treating the PD-1 antibody, providing more effective medication and treatment selection suggestions for the tumor patients, providing important warnings for the clinical application of immunotherapy in the future, and reducing the treatment risk of the tumor patients, the pain of a patient is reduced, the life of the patient is prolonged, and the problems that the risk of treating the tumor patient by adopting the PD-1 antibody is increased, the pain of the patient is increased, and the optimal treatment time of the patient is easily delayed due to the fact that the tumor patient which is possibly not suitable for treating by adopting the PD-1 antibody cannot be evaluated because a predictive biomarker for treating the tumor by adopting the PD-1 antibody is not available in the prior art are solved.

2. The broad-spectrum expression of the cancer biomarker provided by the invention includes, but is not limited to, expression in the cancer, wherein the cancer is any one or more of blood cancer, breast cancer, colon cancer, pancreatic cancer, prostate cancer, bone cancer, kidney cancer, skin cancer, cervical cancer, esophageal cancer, brain cancer, liver cancer, stomach cancer or lung cancer, and the cancer cell line selected is a cell of blood cancer including Raji, K-562, Jeko-1, U-937 or Jurkat; cells of breast cancer include MCF-7, SK-BR-3 or T47D; cells of intestinal cancer include HT-29, RKO, SW480 or HCT 116; cells of pancreatic cancer include HPDE6C, BxpC-3 or AspC-1; cells of prostate cancer include PC-3, 22Rv1, DU145 or LNCaP; cells of bone cancer include CRL8303 or U-2 OS; the cell of renal cancer comprises ACHN, 769-P, 786-O or Caki-1; cells of skin cancer include B16F10 or A-375; cells of cervical cancer include Ca Ski or Hela; cells of brain cancer include M059J, SKNSH, M059K or SK-N-BE (2); liver cancer cells include Huh-7 or HepG 2; cells from gastric cancer include HGC-27; cells of lung cancer include one or more of A549, HCC827, Calu-1, or NCI-H1299; the cancer cells include 40 different cell lines under 12 kinds of cancers, 4 kinds of lung cancer cell lines, and the universal expression of tumor cells in 7 clinical lung cancer patient samples. The prevalence of expression of the PD-1 molecule in different types of tumor cells can be seen.

Furthermore, in the experiments (in vivo and in vitro experiments) of knocking down and over-expressing PD-1 molecules on the tumor cells, after the results are compared, the PD-1 molecules are found to have certain inhibition effect on the growth of the tumor cells.

Furthermore, it is also found by comparative experiments that PD-1 affects the proliferation of tumor cells in tumor cells through two major signaling pathways of AKT and ERK.

In conclusion, the invention proves that the existence of the PD-1 molecule has an inhibiting effect on the growth of tumor cells with immunodeficiency or low immune function, and the deletion of the PD-1 molecule has a promoting effect on the growth of tumor cells with immunodeficiency or low immune function. Therefore, the cancer marker has the effect of inhibiting the growth of tumor cells in immunodeficiency or low immune function, and can make up for the defect of over-treatment in a clinical common treatment mode of inhibiting the growth of the tumor cells by using the PD-1 antibody.

Meanwhile, the influence of the knockdown and over-expression of PD-1 molecules on tumor cells is examined, and the invention proves that the existence of the PD-1 molecules plays an inhibiting role in the phosphorylation levels of proteins ERK and AKT under the condition of immunodeficiency or low immune function, thereby proving the influence of PD-1 on the growth of immune cells on a signal path.

3. On the basis, the invention provides a new immune-related therapeutic application of a cancer biomarker applied by a PD-1 antibody, and the tumor cells suitable for the treatment of the PD-1 antibody are screened by utilizing the application of the PD-1 antibody in effectively inhibiting the growth of the tumor cells so as to provide a new application for tumor patients, the effective medication and the therapy provide important warning for clinical application of immunotherapy in the future, reduce the treatment risk of tumor patients, reduce the pain of the patients, prolong the service life of the patients, and solve the problems that no predictive biomarker for treating tumors by using a PD-1 antibody exists in the prior art, the tumor patients which are most possibly unsuitable to be treated by using the PD-1 antibody cannot be evaluated, the risk of treating the tumor patients by using the PD-1 antibody is increased, the pain of the patients is increased, and the optimal treatment time of the patients is easily delayed.

4. The invention provides a method for predicting, evaluating or identifying the effectiveness of a PD-1 antibody in cancer inhibition, guiding drug selection or therapy selection; the invention discovers that PD-1 is expressed on the surface of the tumor cell, so that patients with the tumor and immunodeficiency or low immune function can be predicted to be not suitable for the treatment of the PD-1 antibody, and after the patients are treated by the PD-1 antibody, the inhibition of the PD-1 molecule on the growth of the tumor cell is ineffective due to the low autoimmune function and the blocking of the PD-1 molecule on the tumor cell by the PD-1 antibody, so that the tumor cell rapidly grows, and finally, the over-progression phenomenon can occur. Therefore, the cancer biomarker of the invention can predict tumor cells which are not suitable for being treated by the PD-1 antibody, provides a suggestion for more effective medication and therapy selection for tumor patients, and provides a new mechanism for the clinical ultra-progression phenomenon.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1A is a diagram showing the results of RT-PCR of PD-1mRNA in 35 tumor cell lines provided in example 1 of the present invention;

FIG. 1B shows the fluorescence real-time quantitative PCR results of PD-1mRNA in 35 tumor cell lines provided in example 2 of the present invention;

FIG. 1C shows ImmunoBlot, RT-PCR and fluorescent real-time quantitative PCR results of PD-1 in 4 lung cancer cell lines as provided in example 3 of the present invention;

FIG. 1D is the FACS detection of PD-1 in 4 lung cancer cell lines as provided in example 4 of the invention;

FIG. 1E shows the results of FACS detection of PD-1 in 7 clinical patient samples as provided in example 5 of the present invention;

FIG. 2A is a QPCR detection result after PD-1 knockdown in two lung cancer cell lines provided in invention example 6;

FIG. 2B is a graph showing the growth curves of the PD-1 knockdown group versus the control group in two lung cancer cell lines provided in example 7 of the present invention;

FIG. 2C is an ImmunoBlot assay of the PD-1 knockdown group and the control group of two lung cancer cell lines provided in example 8 of the present invention;

FIG. 2D is a QPCR detection result after PD-1 overexpression in two lung cancer cell lines provided in example 9 of the present invention

FIG. 2E is a graph showing the growth curves of the PD-1 overexpression group and the control group in two lung cancer cell lines provided in example 10 of the present invention;

FIG. 2F is an ImmunoBlot assay of PD-1 overexpression and control groups in two lung cancer cell lines provided in example 11 of the present invention;

FIG. 3A is the measurement results of the growth curve of the tumor in vivo after the stable cell line PD-1 knockdown group and the control group provided in example 12 of the present invention are injected subcutaneously into mice respectively;

FIG. 3B is a graph showing the measurement of tumor size in PD-1 knockdown and control groups in mice provided in example 12 of the present invention;

FIG. 4 is a representative graph and statistics of immunohistochemical staining of tumors in PD-1 knockdown and control groups in mice as provided in example 13 of the present invention;

FIG. 5A is a graph showing the measurement and statistics of the mean fluorescence intensity in cells stained with CFSE after treating the CFSE-stained cells with PD-1 antibody in example 14 of the present invention;

FIG. 5B is the intracellular levels of phosphorylation of AKT and ERK after treatment of Calu-1 cells with PD-1 antibody in example 15 of the present invention;

FIG. 5C is a measurement result of a growth curve of subcutaneous tumors of mice after injection of PD-1 antibody into the abdominal cavity of the mice in example 16 of the present invention;

FIG. 5D shows the measurement and statistics of the size of subcutaneous tumor of the mouse after the PD-1 antibody is injected into the abdominal cavity of the mouse in example 16 of the present invention;

FIG. 5E is the phosphorylation level of AKT of subcutaneous tumors in mice after injection of PD-1 antibody into the abdominal cavity of mice in example 17 of the present invention;

FIG. 5F is the level of ERK phosphorylation of subcutaneous tumors in mice after injection of PD-1 antibody into the abdominal cavity of mice in example 16 of the present invention.

Detailed Description

The following examples are provided to further understand the present invention, not to limit the scope of the present invention, but to provide the best mode, not to limit the content and the protection scope of the present invention, and any product similar or similar to the present invention, which is obtained by combining the present invention with other prior art features, falls within the protection scope of the present invention.

The examples do not show the specific experimental steps or conditions, and can be performed according to the conventional experimental steps described in the literature in the field. The reagents or instruments used are not indicated by manufacturers, and are all conventional reagent products which can be obtained commercially.

Example 1

This example uses RT-PCR to detect mRNA levels of PD-1 in 12 cancer species, including 35 cell lines.

The cancer cells were: blood cancer cells including Raji, K-562, Jeko-1, U-937 and Jurkat; cells of breast cancer include MCF-7, SK-BR-3 and T47D; cells of intestinal cancer include HT-29, RKO, SW480 and HCT 116; cells of pancreatic cancer include HPDE6C, BxpC-3 and AspC-1; cells of prostate cancer include PC-3, 22Rv1, DU145 and LNCaP; cells of bone cancer include CRL8303 or U-2 OS; cells of kidney cancer include ACHN, 769-P, 786-O and Caki-1; cells of skin cancer include B16F10 and A-375; cells of cervical cancer include Ca Ski and Hela; cells of brain cancer include M059J, SKNSH, M059K and SK-N-BE (2); liver cancer cells include Huh-7 and HepG 2; cells from gastric cancer include HGC-27. The cancer cells are all commercially available products.

The RT-PCR method comprises the following steps:

1. total RNA extraction from cells

1) Washing cancer cells twice with PBS, adding appropriate amount of RNAioso Plus Reagent to lyse cells (generally 1ml in a 10cm dish), repeatedly blowing with a pipette until the cells are all lysed, transferring to a new RNase Free EP tube, and standing at room temperature for 5 min;

2) centrifuging at 4 deg.C for 10min at 12,000rpm in a microfuge centrifuge;

3) the centrifuged supernatant was transferred to a new RNase Free EP tube (care was taken to avoid aspiration of the pellet), chloroform (supernatant volume: chloroform with the volume of 5:1), quickly turning upside down, mixing, and standing at room temperature for 5 min;

4) centrifuging at 4 deg.C for 15min at 12,000rpm in a refrigerated centrifuge;

5) transferring the transparent liquid at the uppermost layer into a new RNase Free EP tube, adding isopropanol (special for RNA extraction) with the same volume, fully and uniformly mixing, and standing at room temperature for 10min or-20 ℃ for 1 h;

6) centrifuging at 4 deg.C for 10min at 12,000rpm in a refrigerated centrifuge;

7) discarding the supernatant, suspending the bottom precipitate with 75% ethanol solution (DEPC treated water and formulated), and centrifuging at 12,000rpm for 10min at 4 ℃;

8) washing the precipitate with 75% ethanol solution at 12,000rpm at 4 deg.C for 10 min;

9) removing the ethanol solution with the volume concentration of 75%, and placing the EP pipe with the precipitate in an ultra-clean workbench for airing until the ethanol is completely volatilized;

10) according to the amount of the precipitate, an appropriate amount of DEPC treated water (preheated in a metal bath at 55 ℃) was added to dissolve the precipitate, and 2ul of the precipitate was taken and subjected to RNA concentration detection by Nanodrop. Generally, OD260/280 is between 1.8 and 2.0, OD260/230 is more than 2.0, and the RNA quality is good.

2. Reactions for removing genomic DNA

Removing genomic DNA from the extracted RNA before reverse transcription, and the reaction system is shown in the following table 1:

TABLE 1 reaction System

Reagent	Dosage of
		5×gDNAEraser Buffer	2.0μl
gDNAEraser	1.0μl
		Total RNA	1.0μg
RNase Free dH2O	up to 10.0μl

Reaction conditions are as follows: incubate at 42 ℃ for 2 min.

3. RT-PCR reaction

After removing genomic DNA, the RNA was subjected to reverse transcription reaction using the RNA reverse transcription kit (Takara Co.) according to the following Table 2:

TABLE 2 reverse transcription System

Reaction conditions are as follows: 15min at 37 ℃; 85 ℃ for 5 s.

The results of the RT-PCR assay are shown in FIG. 1A, and the band results in FIG. 1A show that PD-1mRNA is expressed in 35 cancer cell lines of 12 cancers. The more distinct the band, the higher the content of PD-1 mRNA.

Example 2

This example utilizes fluorescent real-time quantitative PCR (Q-PCR) technology to detect mRNA levels of PD-1 in 12 cancer species, including 35 cell lines.

The cancer cell is as in example 1.

The Q-PCR method comprises the following steps:

1. Q-PCR primers, as shown in Table 3 below:

TABLE 3 primers

2. Q-PCR reaction System: SYBR Green dye (Takara) was used, each cDNA was tested in triplicate wells, each well was prepared as follows in the reaction system of Table 4, and the cDNAs in Table 4 were the reaction solutions containing the cDNAs obtained by RT-PCR in example 1:

TABLE 4 reaction System

3. Q-PCR reaction procedure: at 95 ℃ for 10 min; number of 35 cycles: 95 ℃ for 15 s; 60 ℃ for 1min.

The Q-PCR test results are shown in FIG. 1B, and the ordinate in FIG. 1B indicates the Delta CT value (the CT value of the target gene minus the CT value of the internal reference), and the higher the Delta CT value, the lower the expression level of PD-1. The results show that PD-1 is expressed in 35 tumor cell lines of 12 cancer species.

Example 3

In this example, the expression of PD-1 in four lung cancer cell lines was detected by Immunoblot (Immunoblot) technique, RT-PCR and fluorescent real-time quantitative PCR.

The four lung cancer cell lines are A549, HCC827, Calu-1 and NCI-H1299. The cancer cells are all commercially available products.

First, immunoblotting detection of PD-1 expression of four lung cancer cell lines

The method comprises the following steps:

(1) protein extraction: observing the state and density of cells under a microscope, removing the supernatant after meeting the experimental requirements, washing with PBS once, removing the PBS, sucking to dry as much as possible, adding a proper amount of cell lysate, slightly scraping the cells from the bottom of the dish by using a cell scraper, transferring the scraped cells into an EP tube, cracking on ice for 20min, centrifuging at 12,000rpm for 20min at 4 ℃, and taking the supernatant for later use.

(2) And (3) detecting the protein concentration: detecting the protein concentration by using a BCA kit, preparing a mixed solution, and preparing a solution A: and (3) setting 3 multiple holes for detection on each sample, adding 200ul of mixed solution into each hole, adding 1ul of supernatant obtained in the step (1), placing the ELISA plate in an incubator at 37 ℃ and reacting for 30 min. And measuring a light absorption value by using a microplate reader, and calculating the protein concentration according to the standard curve.

(3) Preparing a sample: finally, adding 5 xSDS Loading Buffer into the protein sample, and boiling the protein sample for 10min by metal bath at 100 ℃;

(4) preparing glue: the lower layer selects separation gel with proper concentration according to the size of protein, and the upper layer is 5% concentrated gel;

(5) SDS-PAGE: the loading amount of protein is generally 30-50 mug, and is properly adjusted according to the abundance of protein, the protein can be run at constant voltage of 90V at the beginning, and when the sample runs through the concentrated gel, the high voltage running can be replaced: running at 120V for 1.5h (Running on ice can be relatively smooth, and 1 Xrunning Buffer can be pre-cooled at 4 ℃), and stopping electrophoresis after bromophenol blue runs to the bottom;

(6) film transfer: after electrophoresis is finished, carefully disassembling a gel plate, transferring the protein gel to the position above an NC membrane or a PVDF membrane (without pre-soaking in absolute methanol), placing the membrane into a membrane transferring clamp, then soaking the membrane into a membrane transferring groove added with 1 × Transfer buffer, generally setting the constant current to be about 200mA for 50min, and properly prolonging the membrane transferring time as the protein is larger (note that the gel cannot be reversely placed when the membrane is transferred, and the membrane needs to be placed in ice water when the membrane is transferred by the constant current to prevent the heat from influencing the membrane transferring result);

(7) and (3) sealing: after the membrane conversion is finished, taking out the NC or PVDF membrane, sealing with 5% skimmed milk powder, and sealing at room temperature for 1 h;

(8) incubating the primary antibody: after blocking was completed, the membrane was washed 3 times with 1 XTSST for 10min each, and then primary antibody (PDCD1 antibody, Inc.: ORIGEN) was incubated. Primary antibody concentration was typically 1: 1,000, prepared by adding 5% BSA, an antibody stock solution and five thousandths of bacteriostatic agent, and adjusted according to instructions and experimental results;

(9) washing the membrane: recovering primary antibody, washing membrane with 1 × TBST for 3 times, each time for 10 min; secondary antibody incubated (HRP-labeled goat anti-mouse/rabbit): incubation for 1.5h at room temperature, secondary antibody formulated with 5% skim milk powder, typically 1: 2,000-1: 5,000, the secondary antibody can be stored at 4 ℃ and repeatedly used for 2-3 times. Washing the membrane: washing the membrane with 1 × TBST for 3 times, 10min each time;

(10) exposure: and (3) after the TBST on the surface of the membrane is sucked to be dry as much as possible, placing the membrane in a chemiluminescence imaging system instrument, dripping prepared luminescent liquid on the surface of the membrane, automatically exposing, manually adjusting exposure time according to the result, and then storing the original format and the TIFF format of the picture.

The immunoblot results are shown in FIG. 1C, where the more distinct the color of the PD-1 band, indicating higher PD-1 content, indicate that PD-1 is expressed in all four lung cancer cell lines tested.

Secondly, the expression level of PD-1mRMA in four lung cancer cell lines was detected by using RT-PCR technique which was performed according to the RT-PCR method of example 1.

The RT-PCR test result is shown as PDCD1 strip in figure 1C, the more obvious the strip color is, the higher the PD-1 content is, and the result shows that PD-1mRNA is expressed in four lung cancer cell lines which are detected.

Thirdly, detecting mRNA levels of four lung cancer cell lines by using Q-PCR technology

The Q-PCR technique was performed according to the Q-PCR method in example 2.

The Q-PCR assay results are shown in the column in FIG. 1C. The ordinate in the histogram of FIG. 1C represents the Delta CT value (CT value of the gene of interest minus the internal reference CT value), with higher Delta CT values indicating lower PD-1 expression levels. The results show that PD-1 is expressed in four lung cancer cells.

Example 4

In this example, the number of PD-1 expression populations of four lung cancer cell lines was determined by flow cytometry, which was the expression of PD-1 on the cell surface, and represented the proportion of PD-1 expressing cells in one population.

The four lung cancer cell lines were the same as in example 3.

Four lung cancer cell lines were tested according to the following flow cytometry:

1) when the cells grew to about 90%, the supernatant was discarded, washed with PBS, and 2ml of 0.25% EDTA-2Na was added, and the mixture was digested at 37 ℃ for 10 min. After the cells are digested, the cells are blown down and transferred into an ep tube, the rpm is 2000, and the centrifugation is carried out for 6 min;

2) discarding the supernatant, washing with 0.5% BSA, 2000rpm, and centrifuging for 6 min;

3) discarding the supernatant, adding 95ul 0.5% BSA per tube, adding 5ul blocking solution, and mixing;

sealing at room temperature for 10min (after sealing, dividing the sample into several tubes according to experiment requirement, dividing one sample into at least one tube experiment group and one tube isotype control group)

4) 100ul of 0.5% BSA was added to each tube, and the corresponding antibody was added (experimental group: PDCD1 antibody, available from ORIGEN; control group: purified Mouse IgG2a, κ Isotype Ctrl Antibody, inc: biolegend) (general 1: 100 dilutions, with specific use concentrations adjusted according to the instructions);

5) shaking at 4 deg.C for one hour (the sample can be flicked up every half hour to allow sufficient antibody binding);

6) after the primary antibody (PDCD1 antibody) is coated, 1ml of 0.5% BSA is directly added into the sample, evenly blown, 2000rpm and centrifuged for 6 min;

7) the supernatant was discarded, 100ul of 0.5% BSA was added per tube, and the corresponding secondary antibody (PD-1-labeled secondary antibody: APC Goat anti-mouse IgG (minor x-reactivity) Antibody);

8) protected from light and left at room temperature for one hour (samples can be flicked up gently every half hour for adequate antibody binding).

9) After the secondary antibody was applied, 1ml of 0.5% BSA was added, blown uniformly, at 2000rpm, and centrifuged for 6min.

10) The supernatant was discarded (aspirated) and 300ul PBS was added to each tube and filtered through a nylon mesh membrane into the flow tube (to prevent clogging of the flow cytometer).

11) On machine (flow cytometer model: BD facscelesta tm), detection.

The results are shown in FIG. 1D, which is a scatter plot, wherein higher positions of the plot indicate a higher proportion of cancer cells with the expression of PD-1 molecules in the total cancer cells, and the results indicate that the PD-1 molecules are expressed in all four lung cancer cell lines tested.

Example 5

In the embodiment, the expression of PD-1 in tumor masses of seven lung cancer patients (samples of the seven lung cancer patients are from northern tumor hospital) is detected by adopting a flow cytometry technology, the detected samples are tumor masses taken from lesion tissues of 7 lung cancer patients to prepare single cell suspensions, and then the flow cytometry detection is carried out, wherein the flow cytometry detection is carried out according to the implementation in the embodiment 4.

The detection results are shown in a scatter diagram in FIG. 1E, the higher the position of the scatter point is, the higher the proportion of cancer molecules with PD-1 molecule expression in the total detected cancer cells is, and the results show that the PD-1 molecules are all expressed in tumor cells obtained from the pathological tissues of clinical patients.

Example 6 Effect of PD-1 knockdown on cancer cell proliferation assay

In this example, Q-PCR was used to detect the expression levels before and after PD-1 knockdown in two lung cancer cell lines (Calu-1 and NCI-H1299), and the method included the following steps:

first, slow virus packaging experiment

In the experiment, the plasmid with the PDCD1shRNA and the blank plasmid without the PDCD1shRNA are respectively introduced into two cell lines of the lung cancer cells Calu-1 and NCI-H1299 to obtain a PD-1 molecule knockdown cell line experimental group and a blank control group cell line. The PDCD1shRNA plasmid has the function of reducing the expression of PD-1, the sequence of the PDCD1shRNA is GCTTCGTGCTAAACTGGTACC, cells of a recombinant plasmid pSIH-H1-Puro plasmid with PD-1 shRNAPDD 1shRNA are a knock-down group, and cells of a blank plasmid pSIH-H1-Puro without the PDCD1shRNA are a control group. The recombinant plasmid pSIH-H1-Puro with the PDCD1shRNA (shRNA sequence is synthesized by Jinwei Biotechnology Co., Ltd., the recombinant plasmid pSIH-H1-Puro with the PDCD1shRNA is synthesized by the conventional method, or the recombinant plasmid pSIH-H1-Puro is synthesized by the Jinwei Biotechnology Co., Ltd.) is a blank plasmid pSIH-H1-Puro which is a commercial product. The method specifically comprises the following steps:

1) the first day: 293T-Lenti-X cells (commercially available) were plated (typically on 6cm dishes) to ensure that the next day cell densities reached 70% -80%.

The next day: transfection

A plasmid transfection system is prepared as follows (the target plasmid is a recombinant plasmid pSIH-H1-Puro with PDCD1shRNA or a blank plasmid pSIH-H1-Puro without PDCD1 shRNA):

tube A:

reagent	Dosage of
		PSPAX2	3μg
PMD2G	2.5μg
		Plasmid of interest	4μg
Opti-MEM	up to 100μl

And (B) tube:

reagent	Dosage of
		PEI Reagent	25.5μl
Opti-MEM	up to 100μl

2) After the pipe B is prepared, gently swirling for 2-5s, and standing for 5min at room temperature; transferring the mixed solution in the tube B into the tube A, slightly swirling for 2-5s, and standing for 15-20min at room temperature;

3)293T-Lenti-X cells were plated in a bottom layer with 2ml of Opti-MEM or FBS-free DMEM (2 ml of plating was typically added to a 6cm dish), and then the transfection mixture was added. Transfection about 6h the minimal medium containing transfection reagent was replaced by DMEM complete medium containing 10% FBS.

4) Target cell (lung cancer cell): ensuring that the cell density of each dish reaches 30-40% the next day.

And on the third day: the infection is initiated. And respectively collecting the lentiviruses of 24h, 48h and 72h in the step 3) to continuously infect the target cells. After each infection, the fluid is changed after six hours (if the cell state is good, the fluid is not changed)

5) The target cells infected with 72H virus were subjected to antibiotic selection, and cells transformed with the plasmid containing pSIH-H1-Puro vector were selected with puromycin (puromycin), and the selection was completed before the next experiment.

Detection by two, Q-PCR method

And (3) detecting the lung cancer cell lines introduced with the plasmid with the PDCD1shRNA and the blank plasmid without the PDCD1shRNA in the step one by using a Q-PCR method, wherein the Q-PCR method is the same as the Q-PCR method in the embodiment 2.

The Q-PCR technology detects the expression level of PD-1 molecules of the PD-1 knockdown cell line and the control group of two cell strains of the lung cancer cell line. The results are shown in FIG. 2A, wherein the left-hand bar chart shows the expression levels of PD-1 molecules in the knocked-down group of PD-1 knockdown cell line of Calu-1 cell line and the control group, and the right-hand bar chart shows the expression levels of PD-1 molecules in the knocked-down group of PD-1 knockdown cell line of NCI-H1299 cell line and the control group.

Example 7 proliferation assay for two lung cancer cell lines

The influence of PD-1 on the proliferation capacity of tumor cells was examined by a cell proliferation experiment using the PD-1 molecule-knockdown group cell line and the blank control group cell line of the two cell lines of the lung cancer cell lines obtained in example 6.

The cell proliferation assay comprises the following steps:

preparing cells: washing cells once by PBS, digesting for about 2min by pancreatin, adding 10% FBS culture medium with twice amount of pancreatin to stop digestion, blowing the cells down, transferring the cells into a 15ml centrifuge tube, centrifuging for 5min at 1000rpm, removing supernatant, adding 2-3ml of complete culture medium, thoroughly blowing uniformly, and suspending the cells;

cell counting: a clean EP tube was prepared for each cell, and 180. mu.l PBS and 20. mu.l cell suspension were added and mixed (gently flicked to avoid too many air bubbles) corresponding to dilution of the cell concentration to 1/10. Adding 10 μ l of diluted cell suspension into the middle of a cell counting plate and a cover glass, finding out four large 4 × 4 large grid areas under a microscope for counting, repeating for 3-4 times as appropriate to obtain more accurate numbers, and finally calculating the average cell number of each large grid area, wherein the cell number is recorded as a, and the undiluted cell concentration is a × 105 cells/ml;

preparing a 15ml centrifuge tube for each group of cells, adding a corresponding culture medium (determined according to the required amount of a plate, generally 4-5ml) according to the cell counting result, adding a cell suspension (blowing and beating again before adding to ensure that the cells are sufficiently uniform) to ensure that the final concentration of the cells is 5 multiplied by 104cells/ml, slightly inverting the centrifuge tube up and down to ensure that the cells are uniformly mixed under the condition of not having too many bubbles;

after the cells are fully mixed, 100 mul of cell suspension is added into each hole of a 96-hole plate, each cell is in three multiple holes, and then 100 mul of CTG (total concentration of G in each hole) is added

Luminescent Cell viatilityassay chinese:

luminescence method cell activity detection kit), mixing gently, sucking 100 μ l of the mixed solution into a black 96-well microplate, and reading (luminescence) with a multifunctional microplate reader. Adjusting the cell concentration in the 15ml centrifuge tube according to the reading result to ensure that the readings of different groups are similar and are between 100-300 (the number represents that the number of the cells is about 1000);

lay 96 wells plate (using row gun): after adjusting the concentration of each cell to approximately unity, plating was started. Adding 100 mu l of each well, distributing at least three multiple wells for each reading of each group, wherein one circle of the outermost side of the 96-well plate is not used for reading, and adding redundant cell culture solution or PBS (phosphate buffer solution);

day 0 reading: and adding 100 mu l of CTG into three multiple wells of each group of cells, uniformly mixing, transferring 100ul of CTG to a black 96-well plate, and placing the plate into a microplate reader for reading. Then 100. mu.l of clean medium or PBS was added to the used wells of the 96-well plate to ensure that the environment around the other wells was unchanged. Then putting the mixture into an incubator at 37 ℃ for culture; then reading every other day or every two days (according to the growth rate of each cell), recording the replacement fluid after each reading, and then returning the replacement fluid to the incubator for continuous culture.

Note: CTG needs to be used in the dark, and needs to be subpackaged and put into-20 for storage. The readings were performed in 96-well black/clear bottom microplates.

The detection results of the growth curves of the PD-1 knockdown group and the control group in the two lung cancer cell lines are shown in figure 2B, the left side of the figure is the growth curve of the PD-1 knockdown cell line knockdown group and the control group of the Calu-1 cell line, the right side of the figure is the growth curve of the PD-1 knockdown cell line knockdown group and the control group PD-1 of the NCI-H1299 cell line, and the results show that the proliferation speed of cancer cells in the cell lines of the PD-1 knockdown groups of the two cell lines of the lung cancer cell lines is obviously accelerated.

Example 8

The expression of proteins in the signal pathways in the PD-1 knockdown group and the control group of the two cell lines of the lung cancer cell lines obtained in example 6 was examined using the Immunoblot technique.

The Immunoblot technique is the same as the Immunoblot method in example 3.

The results are shown in FIG. 2C, and show that the expression level of two phosphorylated proteins (p-AKT and p-ERK) is increased in the cell strain with reduced PD-1 knockdown.

From the results of example 7 and this example, it is found that the increased growth rate of cancer cells in the knockdown cell lines of PD-1 molecules of two cell lines of the lung cancer cell line and the increased expression levels of two proteins (p-AKT and p-ERK) in the signaling pathway related to cancer cell proliferation indicate that the absence of PD-1 molecules on the surface of cancer cells has the effect of promoting cancer cell proliferation and the effect of two proteins p-AKT and p-ERK in the signaling pathway related to cancer cell proliferation.

Example 9 Effect of PD-1 overexpression on cancer cell proliferation

In this example, the expression level of PD-1 after over-expression in two lung cancer cell lines (Calu-1 and NCI-H1299) was determined by Q-PCR, which comprises the following steps:

first, slow virus packaging experiment

In the experiment, plasmids with PD-1 expression sequences and blank plasmids without PD-1 expression sequences are respectively introduced into two cell lines of lung cancer cells Calu-1 and NCI-H1299 to obtain a PD-1 molecule expression-increased cell line experimental group and a PD-1 molecule non-expression-increased cell line blank control group. The PD-1 expression sequence plasmid is used for increasing the expression of PD-1, cells introduced with the PD-1 expression sequence plasmid PLVX-IRES-Neo (the PD-1 expression sequence is introduced into the PLVX-IRES-Neo by the conventional method, and can also be synthesized by the Kingzhi Biotech Co., Ltd.) are used as an overexpression group, and cells introduced with a blank plasmid PLVX-IRES-Neo (a commercial product) without the PD-1 expression sequence are used as a blank control group.

The specific procedure of the lentivirus packaging experiment was the same as in example 6. Cells transformed with the plasmid carrying the PLVX-IRES-Neo vector were selected with G418.

Detection by two, Q-PCR method

And (3) detecting the lung cancer cell lines introduced into the plasmid with the PD-1 expression sequence and the blank plasmid PLVX-IRES-Neo without the PD-1 expression sequence in the step one by using a Q-PCR method, wherein the Q-PCR method is the same as the Q-PCR method in the example 2.

And detecting the expression levels of PD-1 molecules of two cell strain PD-1 overexpression cell line groups and a PD-1 empty leukocyte line control group of the lung cancer cell lines by using a Q-PCR technology. The results are shown in FIG. 2D, in which the left-hand bar chart is the PD-1 overexpression cell line group and the control group of the Calu-1 cell line, and in which the right-hand bar chart is the PD-1 overexpression cell line group and the control group of the NCI-H1299 cell line.

Example 10 proliferation assay of two Lung cancer cell lines

The effect of PD-1 on the tumor cell proliferation capacity was examined by a cell proliferation experiment using the PD-1 molecule-overexpressing cell line group and the PD-1 empty leukocyte line control group of two cell lines of the lung cancer cell lines obtained in example 9.

The cell proliferation assay was the same as that of example 7.

The results are shown in FIG. 2E, which shows that the proliferation rate of cancer cells in two cell lines of PD-1 overexpression group of the lung cancer cell line is obviously reduced, the left side of the graph is the PD-1 overexpression group and the control group of Calu-1 cell line, and the right side of the graph is the PD-1 overexpression group and the control group of NCI-H1299 cell line.

Example 11

The expression of proteins in the signaling pathways in the PD-1 molecule-overexpressing cell line group and the PD-1 empty leukocyte line control group of the two cell lines of the lung cancer cell lines obtained in example 9 was examined using the Immunoblot technique.

The Immunoblot technique is the same as the Immunoblot method in example 3.

The results are shown in FIG. 2F, and show that the expression levels of both phosphorylated proteins (p-AKT and p-ERK) were found to be reduced in both cell lines of the PD-1-overexpressed lung cancer cell line.

From the results of example 10 and this example, it can be seen that the decrease in the growth rate of cancer cells in the over-expression group of PD-1 molecules of two cell lines of the lung cancer cell line and the decrease in the expression levels of the two proteins (p-AKT and p-ERK) in the signaling pathway associated with cancer cell proliferation indicate that the expression of PD-1 molecules on the surface of cancer cells has the effect of inhibiting cancer cell proliferation and the effect of inhibiting the two proteins p-AKT and p-ERK in the signaling pathway associated with cancer cell proliferation.

Example 12

This example provides the detection of in vivo tumor growth curves in immunodeficient mice injected with the stable cell line PD-1 knockdown group and the control group, comprising the steps of:

1) NSG male mice were purchased from jiangsu jiejiankang biotechnology limited (week old: 4-5 weeks), experiments were performed after the mice were stable in the mouse chamber for one week;

2) preparing cells: the NCI-H1299 cell line PD-1 knockdown group and the control group obtained in example 6;

3) grouping according to the body weight of the mice, injecting the tumor cells into the mice subcutaneously, and classifying the cells prepared in step 2) into 6X 10⁶Each cell/mouse was injected subcutaneously into NSG mice, 5 mice per cell line;

4) when the subcutaneous tumor of the mouse grows to 150mm³-200mm³. Mice were weighed every other day, and the size of the tumors was quantified. Recording the growth curve of the mouse tumor;

5) when the volume of the tumor of the mouse reaches 1500mm³Left and right, mice were euthanized;

6) tumor tissues in the body of the mouse are taken out and fixed in 4% paraformaldehyde for subsequent experiments.

The growth curve of the mouse tumor is shown in FIG. 3A, and it can be seen that the tumor volume of the knockdown group (PDCD1shRNA) is larger than that of the control group (Vector control), and the difference between the two increases with the number of days.

The measurement results of the tumor size of the mice are shown in FIG. 3B (the tumor in the figure is the size of the final tumor, and each group has 5 replicates), and it can be seen that the tumor volume of the knockdown group (PDCD1shRNA) is larger than that of the control group (Vector control).

Example 13

The tumor tissue obtained in example 12 was subjected to immunohistochemistry experiments, comprising the steps of:

1) baking at 60 deg.C for 30min, and conventional dewaxing and hydrating; dewaxing: soaking the tissue chip in xylene for 10 min; replacing dimethylbenzene and soaking for 10min, and replacing 50% dimethylbenzene and soaking for 5 min. Hydration: soaking in anhydrous ethanol for 5min, replacing anhydrous ethanol, soaking for 5min, replacing 95% ethanol, soaking for 5min, replacing 80% ethanol, soaking for 5min, replacing 70% ethanol, soaking for 5min, and washing with tap water for three times: the mixture is soaked in water twice and soaked for 1min for the last time.

Antigen retrieval: placing deparaffinized and hydrated tissue slices on a high-temperature resistant plastic slice, putting the slices into a citric acid buffer solution with the pH value of 8.0, covering a pot cover, and heating for 10min until the slices are boiled. Deflating, closing the valve to the high-pressure cooker for timing, opening the cover after 5 minutes, acceleratedly cooling the repair box under a tap water tap, cooling the slices to room temperature, and washing for 3 times with tap water for 5min each time.

3) Blocking endogenous peroxidase with 3% H2O 2-methanol, washing with PBS for 3 times (5 min each) at room temperature for 10 min;

4) dripping serum of normal non-immune animal at room temperature for 10 min;

5) removing excess serum, adding primary antibody (p-AKT and p-ERK antibody), and refrigerating at 4 deg.C overnight;

6) washed 3 times with 0.1% Tween-20PBS, 5 times each;

7) dripping biotin-labeled secondary antibody HRP-conjugated coat anti-rabbitt, and incubating for 10min at room temperature;

8) washing with 0.1% Tween-20PBS for 5min for 3 times;

9) dripping DAB color developing agent into the slices after preparation, performing microscopic reaction for 5min at room temperature, washing with tap water, and stopping color development with distilled water;

10) counterstaining with hematoxylin for 1min, optionally prolonging to 2min, washing with clear water for 3 times, differentiating with 1, 1% hydrochloric acid alcohol each time, washing with clear water for 3 times, 1min each time, washing with water after differentiation to turn blue for 20min, and air drying;

11) and (5) performing conventional dehydration and transparency, sealing by neutral gum and performing microscopic examination.

Immunohistochemical staining results and statistical results are shown in FIG. 4, from which it can be seen that phosphorylation levels of AKT and ERK were detected and found to be increased in tumors of mice in the PD-1 knockdown group.

Example 14

This example provides for the detection of cell proliferation following treatment of CFSE-stained Calu-1 cells with PD-1 antibody.

The experimental procedure for the CFSE cell proliferation assay is as follows:

1) a ten cm dish of cells was prepared, washed once with PBS, added with 0.2% EDTA, and placed in a 37 ℃ incubator for about 10min of digestion.

2) After the cells were digested, the cells were gently blown with a gun, transferred to a 15ml centrifuge tube, centrifuged at 1000rpm for 5 min. The supernatant was removed and CFSE staining solution (1: 1000 dilution) was added, i.e.1 ml PBS plus 1ul CFSE, pre-warmed at 37 ℃ in PBS.

3) The cells were placed in a 37 ℃ water bath for 30min in the dark (preferably mixed every 5-10 min).

4) Adding complete culture medium, mixing and stopping staining.

5) Incubate at 37 ℃ for 5 min.

6) Centrifuge at 1000rpm for 5min and remove supernatant.

7) Cells were resuspended in fresh pre-warmed medium.

8) And taking a proper amount of cells, and detecting on the machine for the 0 th day to see the dyeing efficiency of the whole cells. The remaining cells were plated on several 6cm dishes as needed, and then the corresponding antibodies were added. Grouping: IgG, Nivo-100ug/ml, Nivo-10ug/ml, Nivo-1ug/ml, Pem-100ug/ml, Pem-10ug/ml, Pem-1 ug/ml.

9) Note that: a small number of unstained cells were taken before staining as negative controls.

10) After 48h, the medium was removed, PBS washed once, EDTA was added, digestion was carried out at 37 ℃ for about 10min, cells were blown up, transferred to ep tubes, centrifuged at 1000rpm for 5min, the supernatant was removed, 300ul PBS was added for resuspension, and after filtration with a filter, an up-flow cytometer (model of flow cytometer: bdfacscelesta tm), note: unstained cells were required as a negative control.

As a result, as shown in FIG. 5A, it was found that the fluorescence intensity of the Calu-1 cells treated with Nivo (PD-1 antibody) and Pem (PD-1 antibody) was lower than that of the cells treated with IgG, indicating that the growth of Calu-1 cells was accelerated after the treatment with Nivo and Pem.

Example 15

The phosphorylation level conditions of AKT and ERK in Calu-1 cells treated by IgG, Nivo and Pem antibodies in example 14 are detected by Immunobot technology

The Immunoblot technique is the same as the Immunoblot method in example 3.

The results are shown in FIG. 5B, which shows that the phosphorylation levels of AKT and ERK in cells are increased after Nivo, Pem treatment.

Example 16

Detecting the subcutaneous tumor growth curve of the immunodeficient mice treated by IgG and Nivo antibodies

Stable NCI-H1299 cancer cell lines were injected into immunodeficient mice by the method described in example 12.

Injection of the NCI-H1299 cancer cell line subcutaneously into immunodeficient mice (10)⁷Individual cell/mouse), and the mouse is allowed to form subcutaneous tumor, and the tumor grows to 200mm³After the left and right, mice were randomly divided into two groups (5 mice per group), and were intraperitoneally injected with IgG and Nivo antibodies (every other day), and the size of tumor was measured to prepare a growth curve. The results are shown in FIG. 5C. When the tumor grows to be nearly 1500mm³Thereafter, the mice were euthanized, and the nodules were removed, sequenced from large to small, and photographed. The results are shown in FIG. 5D.

As shown in FIGS. 5C to 5D, the results showed that the growth rate of tumor was significantly increased in the Nivo antibody-treated group compared to the IgG blank control group.

Example 17

This example provides the phosphorylation levels of AKT and ERK in subcutaneous tumors in mice injected with PD-1 antibody into the abdominal cavity of mice

Nivo antibody treated tumors and IgG blank control tumors as described in example 16 were removed for immunohistochemistry identical to example 13.

The phosphorylation levels of AKT and ERK are shown in FIG. 5E and 5F, respectively, and the results show that the phosphorylation levels of AKT and ERK are increased in mice treated with Nivo antibody.

The increase speed of lung cancer cell strains of immunodeficient mice infected by lung cancer cells after being treated by the PD-1 antibody and the increase of the expression levels of two proteins (p-AKT and p-ERK) on a signal path related to cancer cell proliferation indicate that the PD-1 antibody has the function of promoting the cancer cell proliferation in the environment of cancer cells with immunodeficient functions and has the function of promoting the expression of the two proteins p-AKT and p-ERK on the signal path related to the cancer cell proliferation.

Therefore, PD-1 as a cancer biomarker plays a predictive role in the selection of a cancer treatment method, and test results show that under the condition of low immunity, the use of a PD-1 antibody drug can promote the excessive growth of cancer cells, so that the use of the PD-1 antibody drug is not recommended.

It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications therefrom are within the scope of the invention.

Claims

1. Use of a cancer biomarker for the manufacture of a product for reducing the expression level of p-ERK and/or p-AKT in a tumor, wherein the cancer biomarker is programmed death molecule 1, gene PDCD1 and/or PD-1mRNA in a tumor cell; the tumor is lung cancer; the lung cancer cell is Calu-1 or NCI-H1299.

2. Use of a cancer biomarker, or an agent that detects the presence or level thereof, in the manufacture of a product for predicting, assessing or identifying the effectiveness of a PD-1 antibody for cancer inhibition, guiding drug selection or therapy selection, wherein the cancer biomarker is programmed death molecule 1, gene PDCD1 and/or PD-1mRNA in a tumor cell; the cancer is lung cancer; the cell of the lung cancer is Calu-1 or NCI-H1299;

the cancer is in an immunodeficiency or immunocompromised environment.

3. Use according to claim 2, characterized in that it comprises: