CN108553478B - Application of septin gene shRNA in preparation of septin gene activity inhibitor - Google Patents

Abstract

The invention discloses application of a septin gene shRNA in preparation of a septin gene activity inhibitor.

Description

Application of septin gene shRNA in preparation of septin gene activity inhibitor

(I) technical field

The invention relates to two sub-types Septin2(SEPT2) of gene Septin, shRNA of Septin9(SEPT9) and application of shRNA in inhibiting glioma activity.

(II) background of the invention

Glioblastoma (GBM) is the most common primary malignancy of the Central Nervous System (CNS), with a five-year survival rate of less than 10%. Worldwide, about 21 million new cases occur each year, accounting for 81% of brain tumors. There are four types of gliomas, which can be classified according to their origin, including astrocytomas (world health organization classification astrocytomas I, II (astrocytomas), III (anaplastic astrocytomas) and IV (glioblastomas, GBMs)), oligodendrogliomas, ependymomas and mixed gliomas. Since GBM cells can grow and invade into the normal brain, resection surgery and treatment become difficult. GBM was discovered and named by Percival Bailey and Harvey Cushing as early as 90 years ago, but is still difficult to treat because of poor prognosis, with median survival of about 1 year in typical patients. Progress has been made in surgical safe excision, radiation therapy and chemotherapy, but viable GBM cells often continue to grow and develop resistance. Therefore, a more comprehensive understanding of the molecular pathophysiology of GBM is needed in order to develop more effective and targeted therapeutic strategies.

Although the molecular mechanisms of GBM remain elusive, a large amount of GBM genome data has accumulated worldwide over the last 10 years. Due to its complexity, sufficient description of the GBM system requires a combination of various molecular biological data from RNA to protein levels. Because of their diversity and progressive drug resistance, treatment of multifactorial tumors such as GBM with a single target is often impractical and development of multi-targeted therapy for GBM may be an effective approach. In view of these considerations, we have applied an unbiased multiplex combinatorial approach to integrate the results of microarray multiplex analysis and proteome recognition analysis. The combination method finds two novel GBM related molecules, Septin9 and Septin 2.

Septins are a family of highly conserved GTP-binding and membrane-interacting proteins from yeast to humans, which are involved in various cellular processes such as cytoskeletal organization, cytokinesis and membrane dynamics. To date, 13 functional septin genes (SEPT-1 to SEPT-12 and SEPT14) have been identified in humans, based on their sequence homology (SEPT-2, SEPT-3, SEPT-6, SEPT-7 subgroups). The Septin family members are able to form non-polar tri-, hexa-or octamer complexes with each other with strong affinity, which means that they interact functionally. In addition, Septins are also thought to be involved in a variety of cellular functions, such as chromosome segregation, DNA repair, cellular polarization, migration and apoptosis.

Currently, many studies have reported that deregulation of Septin expression or activity is associated with human tumorigenesis, with high levels of Septins (SEPT-2, -7, -8, -9 and-11) being detected in breast cancer. Among them, SEPT-9 was identified as an oncogene in breast cancer, ovarian cancer, head and neck cancer, prostate cancer and colorectal cancer, and downregulation of SEPT-2 could inhibit hepatoma cell growth through PPAR γ activation. In this study, we identified SEPT-9 and SEPT-2 as GBM-associated genes in a multi-component assay, whose inhibition of expression in GMB cells was found to inhibit GBM onset and progression in vitro and in vivo.

Disclosure of the invention

The invention aims to provide the application of the septin gene shRNA in the preparation of the septin gene activity inhibitor, which can inhibit the growth of glioma under the condition of interfering the expression of the gene shRNA, and provides a new solution for clinically treating glioma.

The technical scheme adopted by the invention is as follows:

the invention provides an application of a septin gene shRNA in preparation of a septin gene activity inhibitor, wherein the shRNA nucleotide sequence is shown as one of the following:

SEPT9-shRNA-1 (abbreviation SEPT9-sh 1):

GATCCGAGATCAAGTCCATCACGCACGATATTTCAAGAGAATATCGTGCGTGATGGACTTGATCTCTTTTTGAATTCAAAAAGAGATCAAGTCCATCACGCACGATATTCTCTTGAAATATCGTGCGTGATGGACTTGATCTCG；

SEPT2-shRNA-1 (abbreviation SEPT2-sh 1):

GATCCGCTATGGTGACGCTATCAACTGCAGAGATTCAAGAGATCTCTGCAGTTGATAGCGTCACCATAGCTTTTTGAATTCAAAAAGCTATGGTGACGCTATCAACTGCAGAGATCTCTTGAATCTCTGCAGTTGATAGCGTCACCATAGCG。

the invention also provides application of the shRNA in preparation of the glioblastoma multiforme activity inhibitor.

The glioblastoma is glioma cell U-87MG or glioma cell A172.

Compared with the prior art, the invention has the following beneficial effects: the method can effectively inhibit the growth of the glioma and has no obvious damage to normal cells of a human body such as epidermal fibroblasts (HDF).

(IV) description of the drawings

FIG. 1 is a schematic diagram of comprehensive multi-group study of GBM-related gene discovery and validation.

FIG. 2 shows the expression patterns of SEPT2 and SEPT9 in normal tissues and glioma tissues and GBM cell lines. A is an immunohistochemical assay of SEPT2 and SEPT9 expression in 3 grades of gliomas (Astrocytoms (Grade II), (Astrocytoms (Grade III), (Astrocytoms (Grade IV)) and Normal brain tissue (Normal brain tissue). B is a western blot assay of SEPT2 and SEPT9 expression in A172 and U87-MG cells and immunofluorescence assay of cells co-localized with GFAP. C is a western blot assay of the expression levels of SEPT2 and SEPT9 in different tissues and cells (A172, U87-MG, HDF, brain tissue).

FIG. 3 shows the effect of SEPT2 and SEPT9 on the expression level of mRNA and protein after SEPT2-sh1 and SEPT9-sh1 interference plasmids interfere with SEPT2 and SEPT 9. After SEPT2-sh1 and SEPT9-sh1 interference plasmids respectively interfere with SEPT2 and SEPT9 or simultaneously interfere with SEPT2 and SEPT9, the change of the mRNA expression quantity of SEPT2 and SEPT9 is realized. B and C are SEPT2-sh1, the protein level expression quantity of SEPT2 and SEPT9 changes after the interference plasmids of SEPT 3978-sh 1 and SEPT9-sh1 respectively interfere with SEPT2 and SEPT9 or simultaneously interfere with SEPT2 and SEPT9, and D is the expression of SEPT9 and SEPT2 after the interference of SEPT9(sh1, sh2) and SEPT2(sh1, sh 2).

FIG. 4 shows the effect of SEPT2 and SEPT9mRNA interference on A172 cell growth inhibition. (A) A172 cell fluorescence map of shRNAs (SEPT2-sh1 and SEPT9-sh1) co-transfected with SEPT2, SEPT9 and SEPT2,9 for co-expression of GFP. (B) SEPT2-sh1 and SEPT9-sh1 interfering plasmids respectively interfere with SEPT2 and SEPT9 or simultaneously interfere with SEPT2 and SEPT9 and A172 cell growth curves. (C) Fa-CI plot of synergy between SEPT2-sh1 and SEPT9-sh 1.

FIG. 5 shows the effect of SEPT2-sh1 and SEPT9-sh1 interfering plasmids on A172 cell cycle progression and apoptosis, respectively, or simultaneously with SEPT2, SEPT9 or SEPT2 and SEPT 9. A cell cycle progression was detected by FACS analysis. B cell apoptosis was assessed by annexin V-7-AAD staining. C cell cycle distribution was calculated using ModFit LT software. D ratio of apoptotic cells in a172 cells treated with single and double shRNA.

FIG. 6 shows the effect of SEPT2-sh1 and SEPT9-sh1 interfering plasmids on the migration and invasion capacity of A172 cells by SEPT2 and SEPT 9. Interference of A with SEPT2 and SEPT9 or interference of both SEPT2 and SEPT9 on the effect of A172 cell migration ability. B interferes with the effects of SEPT2 and SEPT9 or both SEPT2 and SEPT9 on a172 cell invasion. C quantitates the migration distance of a172 cells. D mean cell count of invading cells.

FIG. 7 is a cell growth experiment in which SEPT2-sh1 and SEPT9-sh1 interfere with GBM cells involved in MEK-ERK and p53-p21 pathways. A interferes with the detection of pMEK1/2, Erk1/2 and pErk1/2western blot in A172 cells of SEPT2 and SEPT9 or SEPT2 and SEPT9 simultaneously. B interferes with SEPT2 and SEPT9 or both SEPT2 and SEPT9 in a172 cells for p53 and p21western blot detection. C RNAi growth overexpressing SEPT2 or SEPT9 inhibits cellular immunofluorescence. D RNAi growth-suppressing cell growth curve overexpressing SEPT2 or SEPT 9.

Figure 8 is a graph of the effect of SEPT2 and SEPT9 knockdown on GBM cell-derived subcutaneous xenograft tumors in nude mice. A in vivo bioluminescence imaging data was analyzed in different groups by IVIS system. B tumor volume change growth curve; tumor weight significance analysis 20 days after injection of C single shRNA and double shRNA treatment groups.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

example 1: finding and identifying GBM-associated genes by multigroup chemical analysis

(1) The experimental method comprises the following steps: comprehensive multi-component chemical analysis

GBM transcriptomics studies were selected based on the following four criteria: 1) samples were from primary tissues with normal controls; 2) more than three cases and controls were used; 3) the experiment is operated on the same platform; 4) the study was performed by an independent group (see table 1). Proteomic analysis of three different GBM cell lines was performed simultaneously to represent gene expression at the protein level. As shown in the multi-group chemical analysis workflow chart (figure 1), the data generated by proteomics and transcriptomics are input, and high-quality candidate functional genes are output and are arranged according to different statistical standards. GBM expression data studies from gene expression integration (GEO) repositories were integrated for multiplex analysis. For each of the 47,000 transcripts tested, meta fold-change and meta p-value were calculated in all studies using Fisher's method. If meta fold-change is greater than 1.5 and meta effect p-value is less than 4.5X 10^-5Then, the gene is considered to be a GBM-associated gene. Notch1, SEPT-9, SEPT-2, NES, WEE1, RPN2, PDGFRB, SOX4 were identified as GBM-related genes. Candidate proteins were then screened by proteomic analysis of three different GBM cell lines and SEPT9, SEPT2 were further narrowed down as final candidate genes (fig. 1).

(2) The experimental results are as follows: since the Septin gene has been found to be involved in cell proliferation, migration and tumorigenesis, but its role in GBM has not yet been established, SEPT9 and SEPT2 were finally selected for further validation.

TABLE 1

Example 2: expression of SEPT9 and SEPT2 in GBM tissues and cell lines

The first experiment method comprises the following steps:

1. immunohistochemistry

(1) Sections of normal brain tissue (grade I normal human brain tissue, purchased from Rockville, MD, USA), 3 grade glioma sections (grade II (astrocytoma), grade III (anaplastic astrocytoma) and grade IV (glioblastoma, GBM, purchased from Rockville, MD, USA) were washed in xylene to remove paraffin and rehydrated by serial dilutions of alcohol.

(2) The tissue sections were washed twice with PBS for 5 minutes each.

(3) Endogenous peroxidase activity was blocked by incubation in 3% hydrogen peroxide for 10min at room temperature.

(4) The tissue sections were rinsed with PBS for 5 minutes.

(5) And (5) antigen retrieval. The antigen retrieval buffer (purchased from biologies) was heated to boiling in a microwave oven, the tissue sections were placed in buffer at 95-100 ℃ for 10min, 2 times, cooled and washed 2 times with 1 × PBS (3-5 min each).

(6) The tissue sections were rinsed with PBS for 5 minutes.

(7) Blocking antibodies (3% normal goat serum in 1 × PBS) were used, incubated at room temperature for 20 minutes, and the remaining liquid was discarded.

(8) Primary antibody was added overnight at 4 deg.C (antibody diluted with 3% goat serum in 1 XPBS).

(9) The tissue sections were rinsed with PBS for 5 minutes each.

(10) The biotin-conjugated secondary antibody was incubated for 30 minutes at room temperature.

(11) The tissue sections were washed twice with PBS for 5 minutes each.

(12) Tissue sections were incubated with SABC reagent (purchased from Abcam) for 30min at room temperature.

(ABC reagent preparation: 2 drops (100ul) of reagent A solution was added to 5ml of PBS mixture, 2 drops of reagent B mixture was immediately added, and after leaving for 30 minutes in the dark) (Vector ABC kit, Cat. NO PK-6100 series)

(13) The tissue sections were rinsed 4 times for 5 minutes each with PBS.

(14) Staining with DAB (the extent of staining was controlled with a conventional microscope).

(15) The tissue sections were washed in distilled water.

(16) Staining was done in hematoxylin (vector hematoxylin catalog number H-3401). (hematoxylin counterstain 7-8min, rinse with tap water).

(17) Dehydration of the array slide.

2. Cellular immunofluorescence staining

(1) Healthy A172 cells (purchased from American Type Culture Collection (ATCC), HDF cells (purchased from American Type Culture Collection (ATCC)), U87-MG cells (purchased from American Type Culture Collection (ATCC)) cultured in 6-well plates, respectively, were cultured in a normal medium (10% FBS, 90% DMEM, purchased from gibico), the pipette was carefully aspirated off the Culture medium against the well edge of the plate, and PBS was washed 2-3 times (light action, PBS was added along the wall).

(2) After the PBS was aspirated, 4% paraformaldehyde was added and fixed at 37 ℃ for 30 min.

(3) PBS was rinsed 3 times.

(4) Adding distilled water containing 1% Triton-100, and treating at 37 deg.C for 30 min.

(5) PBS was rinsed 2 times, added with blocking solution (1ml sheep serum, 6ml of 1% Triton, 13ml PBS) and blocked at 37 ℃ for 30 min.

(6) After removal of the blocking solution, wash several more times with PBS, add 1: 1000 dilutions of SEPT2 primary antibody, SEPT9 primary antibody, at 4 ℃ overnight.

(7) PBS was washed three times and dilution 2 antibody was added.

(8) Remove 2 antibody and then rinse with deionized water.

(9) The cells were observed under a fluorescence microscope, set according to the respective excitation wavelengths.

3、Western blot

(1) Healthy a172 cells, HDF cells, U87-MG cells cultured in 6-well plates were washed with pre-cooled PBS, and then the wash solution was discarded. The above operation was repeated twice, and the cells were co-washed three times to wash out the culture solution. After discarding the PBS, the flasks were placed on ice.

(2) Lysis mixtures were prepared from 1ml of RIPA lysate plus 10. mu.l of protease inhibitor and 10. mu.l of phosphatase inhibitor, shaken well and placed on ice.

(3) Mu.l of the lysis mixture prepared in step (2) was added to each well of cells, lysed on ice for 30 minutes, and the flask was shaken back and forth often to fill and divide the cells.

(4) After lysis, the cells were scraped to one side of the flask using a clean scraper, and the cell debris and lysate were then transferred to a 1.5ml centrifuge tube using a gun. (the entire operation was carried out on ice as much as possible.)

(5) Centrifuge at 12000rpm for 5 minutes at-4 ℃.

(6) And subpackaging and transferring the centrifuged supernatant (namely the protein sample) into a 1.5ml centrifuge tube. Protein concentration was measured using the BCA kit (purchased from Abcam).

(7) 5 XSDS-PAGE protein loading buffer was added to the collected protein samples. Heating at 100 deg.C or boiling water bath for 3-5 min.

(8) After cooling to room temperature, 20ul of the protein sample from step (6) and Human Brain (purchased from Abcam) were loaded into SDS-PAGE gel loading wells, and an equal volume of 1 × loading buffer was added to the lanes on either side of the sample, and the Marker was also adjusted to 20ul (equal volume to the sample) with 1 × loading buffer. And (3) setting an electrophoresis device, using 100V for 15 minutes, then using 200V for 30 minutes, and stopping electrophoresis when bromophenol blue reaches the position close to the bottom end of the gel.

(9) Assembling a film transferring clamp: the transfer membrane clip (black on one side), gasket, sheared PVDF membrane (pre-soaked with methanol) and double-sided filter paper were soaked in transfer buffer for 15 minutes. Then opening a film transferring clamp in the transferring liquid, sequentially placing a liner, double-side filter paper, the electrophoresed gel, a PVDF film, double-side filter paper and a liner on the black surface of the clamp, and closing the clamp.

(10) Film transfer: and (4) loading the assembled film transferring clamp into a transferring groove, wherein the black surface of the clamp corresponds to the black side of the transferring groove. The transfer tank is filled with transfer liquid, placed into an ice bag twice, and placed into a foam box filled with ice. The power was turned on and 300 milliamps were transferred for 2 hours.

(11) After the membrane is completely transferred, the PVDF membrane is placed in a prepared TBST solution, rinsed for 10 minutes on a shaking table, and continuously washed for 10 minutes after the TBST solution is replaced, and 3 times of washing are carried out.

(12) The wash was aspirated, and Western blocking medium (5% TBST solution of skimmed milk powder) was added, gently shaken on a shaker, and blocked at room temperature for 60 minutes.

(13) Primary anti-SEPT 9, primary anti-SEPT 2 were diluted 1:3000 with BSA solution. The blocking solution on the PVDF membrane is aspirated, the prepared primary antibody buffer solution is added, and the membrane is incubated overnight by slowly shaking at 4 ℃ in a shaking table.

(14) Recovering the primary antibody. TBST solution was added and washed on a shaker for 10 minutes with slow shaking. After the washing liquid is absorbed, the washing liquid is replaced to wash for 10 minutes. The total number of washes was 3.

(15) Horseradish peroxidase (HRP) -labeled rabbit or mouse-derived secondary antibodies were diluted 1:5000 with BSA solution. The washing solution on the PVDF membrane was aspirated, the diluted secondary antibody was immediately added, and incubation was carried out on a shaker at room temperature for 1H with slow shaking.

(16) And (5) recovering the secondary antibody. TBST solution was added and the mixture was washed on a shaker for 10 minutes with slow shaking. After the washing solution was sucked up, the washing solution was added again to wash for 10 minutes. The total number of washes was 3.

(17) And (3) developing and imaging:

putting the PVDF membrane into a box with a proper size, adding ECL luminous liquid, completely covering the PVDF membrane, and fully reacting. The protein band image was preserved by exposure to a gel imager.

Second, experimental results

Analyzing the expression of SEPT9 and SEPT2 in normal brain tissue (n-12); low grade glioma tissue sample, grade 2 astrocytoma (n-8); grade 3 glioma specimens (anaplastic astrocytoma: n-12) and grade 4 GBM (n-12). Immunohistochemical analysis showed a significant increase in expression of SEPT9 and SEPT2 in GBM tissue grade 4 (a in figure 2). Immunocytochemistry and western blot analysis showed a significant increase in the expression levels of SEPT9 and SEPT2 in GBM cell lines (B, C in fig. 2) compared to normal brain and HDF cells (C in fig. 2). It was thus concluded that SEPT9 and SEPT2 expression was upregulated in high-grade GBM tissues as well as in several GBM-derived cell lines such as a172 and U87-MG.

Example 3: inhibition of SEPT9 and SEPT2 expression in A172 cells using shRNA

1. Experimental method (fluorescent quantitative PCR):

total RNA from GBM cells (i.e., a172 cells) was extracted and analyzed by real-time quantitative PCR (qRT-PCR) using Trizol reagent (Thermo Fisher Scientific). The amplification reaction was performed by cfx96 real-time PCR detection system (Bio-Rad, Hercules, CA, usa) using SYBR Green fluorescent quantitative PCR kit according to the protocol. For SEPT9 and SEPT2 primers (table 2), the expression of the relevant genes was calculated using the 2 Δ Δ CT method. All qRT-PCR experiments were repeated three times and all data used GAPDH as a control.

TABLE 2 qPCR primer sequences for SEPT2, SEPT9

2、Western blot

1) Construction of scramblel, SEPT2, SEPT9, SEPT2+ SEPT9 plasmids (GFP co-expression): the most commonly used method for constructing interfering plasmids is to use an endonuclease (Biolabs) to cleave the shRNA sequence and P GreenPuro vector (produced), and to use T4 ligase (Biyunnan) to connect the shRNA sequence and the P GreenPuro vector to form plasmids.

The virus liquid obtaining method comprises the following steps: (1) 4 1.5ml centrifuge tubes were taken and 30ul DMEM, 30ul Fectin (ThermoFisher) was added. (2) And (3) adding 60ul of DMEM, 0.75ug of pspax2 packaging plasmid and 0.25ug of pmd2.G packaging plasmid into 4 other centrifuge tubes of 1.5ml, respectively adding 1ug of scramble, SEPT2, SEPT9SEPT2+ SEPT9 interference plasmid, then mixing with the solution of the centrifuge tube in the step (1), respectively adding into 293T cell fluid cultured in a DMEM medium containing 10% fetal calf serum after 30 minutes, taking a culture warm fluid chamber for centrifugation after 24 hours, and taking supernatant.

2) A172 was infected with the virus fluid with SEPT-sh virus, an empty plasmid virus with Green Fluorescent Protein (GFP) was used as a control, after the cells started to undergo apoptosis, the cells were washed with precooled PBS, and the wash solution was discarded. The above operation was repeated twice, and the cells were co-washed three times to wash out the culture solution. After discarding the PBS, the flasks were placed on ice. The other operations were the same as in example 2.

shRNA sequences of SEPT9 and SEPT 2:

SEPT9-shRNA-1 (abbreviation SEPT9-sh1, SEQ ID NO. 1):

GATCCGAGATCAAGTCCATCACGCACGATATTTCAAGAGAATATCGTGCGTGATGGACTTGATCTCTTTTTGAATTCAAAAAGAGATCAAGTCCATCACGCACGATATTCTCTTGAAATATCGTGCGTGATGGACTTGATCTCG；

SEPT9-shRNA-2 (abbreviation SEPT9-sh2, SEQ ID NO. 2):

GATCCGTGGTCAACATCGTCCCTGTCATTCAAGAGATGACAGGGACGATGTTGACCACTTTTTGAATTCAAAAAGTGGTCAACATCGTCCCTGTCATCTCTTGAATGACAGGGACGATGTTGACCACG

SEPT2-shRNA-1 (abbreviation SEPT2-sh1, SEQ ID NO. 3):

GATCCGCTATGGTGACGCTATCAACTGCAGAGATTCAAGAGATCTCTGCAGTTGATAGCGTCACCATAGCTTTTTGAATTCAAAAAGCTATGGTGACGCTATCAACTGCAGAGATCTCTTGAATCTCTGCAGTTGATAGCGTCACCATAGCG。

SEPT2-shRNA-2 (abbreviation SEPT2-sh2, SEQ ID NO. 4):

GATTCGGCAGGAAAGTGGAGAATGAGGACATGATCAAGAGTCATGTCCTCATTCTCCACTTTCCTGCCTTTTTGAATTCAAAAAGGCAGGAAAGTGGAGAATGAGGACATGACTCTTGATCATGTCCTCATTCTCCACTTTCCTGCCG。

3. the experimental results are as follows: to investigate the role of SEPT9 and SEPT2 in GBM cells, two shRNA sequences were selected for SEPT9(sh1, sh2) and SEPT2(sh1, sh2) interference, respectively. As shown in fig. 3D, SEPT9-sh1 and SEPT2-sh1 specifically down-regulate the expression of SEPT9 and SEPT2 respectively, and the P value is less than 0.05, and the gene interference ratios SEPT9-sh2 and SEPT2-sh2 have significant effects, so that SEPT9-sh1 and SEPT2-sh1 are selected for subsequent experiments. We used lentiviral expression vectors containing SEPT9-sh1, SEPT2-sh1 and scrambles (non-silencing sequences) for gene interference experiments. Inhibition of SEPT9 and SEPT2 was verified by qRT PCR (a in fig. 3) and western blot (B in fig. 3 and C in fig. 3). While SEPT9-sh1 and SEPT2-sh1 individually achieve about 70% inhibition on their respective genes, and the combination of SEPT9-sh1 and SEPT2-sh1 achieves 90% inhibition on SEPT9 and SEPT2, which shows that they have synergistic effect in inhibiting gene expression.

Example 4 inhibition of SEPT9 and SEPT2 synergistically reduces GBM cell viability

The experimental method comprises the following steps: (1) 4 1.5ml centrifuge tubes were taken and 30ul DMEM, 30ul Fectin (ThermoFisher) was added. (2) And (3) adding 60ul of DMEM, 0.75ug of pspax2 packaging plasmid and 0.25ug of pmd2.g packaging plasmid into 4 1.5ml centrifuge tubes, respectively adding 1ug of scramble, SEPT2, SEPT9 and SEPT2+ SEPT9 interference plasmid obtained by the method in example 3, mixing with the solution of the centrifuge tube in the step (1), respectively adding into 293T cells of a DMEM medium containing 10% fetal calf serum after 30 minutes, taking the culture solution for warm centrifugation after 24 hours, and taking the supernatant. (3) Configuring 100 mul of glioma cell A172(5000 cells/well) in a 96-well plate by using a DMEM culture medium containing 10% fetal calf serum, dividing the DMEM culture medium into a scramble group, a SEPT2-sh1 group, a SEPT9-sh1 group and a SEPT2-sh1+ SEPT9-sh1 (namely SEPT2 and 9-sh) group, adding 120 mul of corresponding supernatant obtained in the step (2) into each well, carrying out an experiment after the cells emit green fluorescence under a fluorescence microscope, placing the culture plate in an incubator at 37 ℃, and carrying out an experiment after the cells emit the green fluorescence, wherein the temperature of the culture plate is controlled at 37 ℃, and the temperature of the culture₂Incubate at 5% concentration for a suitable period of time (0-7 days), count cells in scramble, SEPT2-sh, SEPT9-sh, SEPT2,9-sh wells at a fixed time each day and develop a growth curve.

The experimental results are as follows: the effect of SEPT9 and SEPT2 on the viability of GBM cells was examined in GBM cell line A172 by transfecting the cells with Scamble, SEPT2-sh, SEPT9-sh, SEPT2,9-sh expression vectors (A in FIG. 4). Interference with SEPT9 and SEPT2 was found to significantly inhibit a172 cell growth in a time-dependent manner (B in fig. 4). Among the RNAi inhibition groups, the combination of SEPT9-sh1 and SEPT2-sh1 (i.e., SEPT2,9-sh) showed the strongest inhibition of A172 cell growth, revealing its synergistic inhibition (CI is 0.27-0.69, CI <1 indicates synergy), with Fa value of 0.10-0.98 (C in FIG. 4).

Example 5 Effect of SEPT9 and SEPT2 interference on GBM apoptosis and cell cycle

The experimental method comprises the following steps:

1.(1) 4 1.5ml centrifuge tubes were taken and 30ul DMEM, 30ul Fectin (ThermoFisher) was added. (2) And (3) adding 60ul of DMEM, 0.75ug of pspax2 packaging plasmid and 0.25ug of pmd2.g packaging plasmid into 4 1.5ml centrifuge tubes, respectively adding 1ug of scramble, SEPT2, SEPT9 and SEPT2+ SEPT9 interference plasmid obtained by the method in example 3, mixing with the solution of the centrifuge tube in the step (1), respectively adding into 293T cells of a DMEM medium containing 10% fetal calf serum after 30 minutes, taking the culture solution for warm centrifugation after 24 hours, and taking the supernatant. (3) Configuring 100 mu l of glioma cell A172(5000 cells/hole) in a 96-hole plate by using a DMEM culture medium containing 10% fetal calf serum, dividing the DMEM culture medium into a scramble group, a SEPT2-sh1 group, a SEPT9-sh1 group, a SEPT2-sh1 group, a SEPT9-sh1(SEPT2, 9-sh) group, adding 120 mu l of corresponding supernatant obtained in the step (2) into each hole, pouring out the culture medium after the cells begin to undergo apoptosis, washing the cells twice by using PBST, adding pancreatin cell digestive juice, and incubating at room temperature until the adherent cells are blown down by gentle blowing, and sucking the pancreatin cell digestive juice. Excessive digestion of pancreatin is to be avoided. Note that: for adherent cells, the trypsinization step is critical. If the pancreatin digestion time is too short, cells can fall off only by forcefully blowing and beating, so that cell membranes are easily damaged, and false positive of cell necrosis is caused; if the digestion time is too long, the cell membrane is easy to damage, so that false positive of cell necrosis is generated, and even the binding of phosphatidylserine on the cell membrane and Annexin V-FITC is influenced, so that the detection of apoptosis is interfered. Meanwhile, the digestive juice of the pancreatin cells should be free of EDTA as much as possible, because the EDTA may influence the combination of Annexin V and phosphatidylserine.

(4) Adding the cell culture fluid collected in the step 3, gently blowing down the cells, transferring the cells into a centrifugal tube, centrifuging the cells for 5 minutes at 1000g, discarding the supernatant, collecting the cells, gently suspending the cells with PBS and counting the cells. Note that: the addition of the cell culture fluid in step 3 is very important, on the one hand, the cells which are already suspended and are apoptotic or necrotic can be collected, and on the other hand, the serum in the cell culture fluid can effectively inhibit or neutralize the residual pancreatin. Residual pancreatin will digest and degrade the Annexin V-FITC added subsequently, resulting in staining failure.

AnnexinV/PI double staining:

the cells collected in step (4) were resuspended in 100. mu.l binding buffer, 2. mu.l Annexin-V-FITC (20ug/ml) was added, mixed gently, and left on ice for 15 min. Transfer to flow detection tube, add 400. mu.l PBS, add 1. mu.l propidium iodide staining solution (PI, 50. mu.g/ml) just before each sample, complete flow detection after 2 minutes. Meanwhile, a tube without annexin V-FITC and PI is used as a negative control. One tube each singly stained with Annexin V-FITC and PI served as positive controls. And filtering the sample by using a filter screen after dyeing is finished, and finishing flow detection.

The experimental results are as follows: to determine whether the reduced cell number was due to apoptosis induced by SEPT9-sh and SEPT2-sh, we compared cell death in a172 cells treated with various inhibitory RNAs (scrambles, septin2-sh1, septin9-sh1, septin2+9-sh 1). In contrast, the Scramble RNA produced 0.6% + -0.2% apoptotic cells, SEPT9-sh1 induced apoptosis in A172 cells by 58.4% + -3.8%, SEPT2-sh induced by 71.4% + -6.0%, and SEPT9-sh1 combined with SEPT2-sh1 induced apoptosis by 80.7% + -4.0% (point in the lower right corner of B in FIG. 5). Thus, interference with the expression of these two genes showed a synergistic effect on the induction of early apoptosis in a172 cells (D in fig. 5). The anti-proliferation effects of SEPT9-sh1 and SEPT2-sh1 were detected by flow cytometry, and the cell cycle distribution was investigated. As shown in a in fig. 5, a172 cells at stage G0/G1 in SEPT9-sh1 and SEPT2-sh1 groups were significantly reduced, with no significant difference between the two groups, although the effect of the combined group was most significant (C in fig. 5). The results showed that S phase cells were increased and G2/M phase cells were eliminated.

Example 6 Effect of SEPT9 and SEPT2 interference on the ability of GBM cells to migrate and invade in culture.

The experimental method comprises the following steps:

cell migration assay

1. Preparation of cell samples

(1) 4 1.5ml centrifuge tubes were taken and 30ul DMEM, 30ul Fectin (ThermoFisher) was added. (2) And (3) adding 60ul of DMEM, 0.75ug of pspax2 packaging plasmid and 0.25ug of pmd2.g packaging plasmid into 4 1.5ml centrifuge tubes, respectively adding 1ug of scramble, SEPT2, SEPT9 and SEPT2+ SEPT9 interference plasmid obtained by the method in example 3, mixing with the solution of the centrifuge tube in the step (1), respectively adding into 293T cells of a DMEM medium containing 10% fetal calf serum after 30 minutes, taking the culture solution for warm centrifugation after 24 hours, and taking the supernatant. (3) And (3) configuring 100 mu l of glioma cell A172(5000 cells/well) in a 96-well plate by using a DMEM culture medium containing 10% fetal calf serum, dividing the DMEM culture medium into a scramble group, a SEPT2-sh1 group, a SEPT9-sh1 group and a SEPT2 and 9-sh1 group, adding 120 mu l of corresponding supernatant obtained in the step (2) into each well, performing a scratching experiment by using a medium-sized gun head when the confluence degree of the cells reaches about 80%, and washing the cells which float for 2 times by using PBS.

2. Photographing observation

The scratch part was photographed every 24 hours under a microscope, and the scratch width was statistically analyzed.

Second, cell invasion ability experiment

1. Preparation of cell samples

(1) 4 1.5ml centrifuge tubes were taken and 30ul DMEM, 30ul Fectin (ThermoFisher) was added. (2) And (3) adding 60ul of DMEM, 0.75ug of pspax2 packaging plasmid and 0.25ug of pmd2.g packaging plasmid into 4 1.5ml centrifuge tubes, respectively adding 1ug of scramble, SEPT2, SEPT9 and SEPT2+ SEPT9 interference plasmid obtained by the method in example 3, mixing with the solution of the centrifuge tube in the step (1), respectively adding into 293T cells of a DMEM medium containing 10% fetal calf serum after 30 minutes, taking the culture solution for warm centrifugation after 24 hours, and taking the supernatant. (3) The method comprises the steps of configuring 100 mu l of glioma cell A172(5000 cells/well) in a 96-well plate by using a DMEM medium containing 10% fetal bovine serum, dividing the DMEM medium into a scramble group, a SEPT2-sh1 group, a SEPT9-sh1 group and a SEPT2 and 9-sh1 group, adding 120 mu l of corresponding supernatant obtained in the step (2) into each well, and after the cells begin to undergo apoptosis, starving the healthily grown A172 cells for 24 hours by replacing the DMEM medium containing 10% FBS with serum-free DMEM medium. The starved cells were digested to resuspend the cell suspension at a density of 25 cells/. mu.l and 200. mu.l of the cell suspension was added to the transwell upper chamber (a type of permeable cup-shaped device, which can be considered as a Membrane filter or a permeable scaffold). The lower chamber of the 24-well plate is typically filled with 500. mu.l of DMEM medium containing 20% FBS. It is to be noted here that air bubbles are often generated between the lower layer culture medium and the chamber, and once they are generated, the chemotactic effect of the lower layer culture medium is weakened or even eliminated, and special care is taken when plating the plate, and once they are generated, the chamber is lifted, the air bubbles are removed, and the chamber is placed in the plate. And culturing for 24h conventionally.

Adherent cells were cultured on Lab-Tek slide chambers (Chamber Slides). After apoptosis induction treatment, the slides were washed 2 times with PBS.

2. Observation by microscope

The experimental results are as follows: the effect of SEPT9 and SEPT2 inhibition on the migration and invasion of GBM cells was investigated by wound healing assays and transwell assays. Wound healing involves many processes, including cell migration and establishment of cell polarity. As shown in fig. 6 a, migration distance was significantly reduced after 10h shRNA treatment. The migration distance of the SEPT2,9-sh group is shortest, and the migration between the SEPT9-sh1 and the SEPT2-sh1 groups is not obviously different (A, C in FIG. 6). However, the combination group exhibited the lowest invasive capacity, as cell invasion is an important feature of GBM cells, and the decreased number of invasive cells through the Transwell cell membrane indicates that shRNA treatment not only decreased the viability of GBM cells, but also decreased their motility (B in fig. 6 and D in fig. 6).

Example 7 interference with SEPT9 and SEPT2 expression inhibits MEK-ERK activation and increases expression of p53-p 21.

The experimental method comprises the following steps: 1.(1) 4 1.5ml centrifuge tubes were taken and 30ul DMEM, 30ul Fectin (ThermoFisher) was added. (2) And (3) adding 60ul of DMEM, 0.75ug of pspax2 packaging plasmid and 0.25ug of pmd2.g packaging plasmid into 4 1.5ml centrifuge tubes, respectively adding 1ug of scramble, SEPT2, SEPT9 and SEPT2+ SEPT9 interference plasmid obtained by the method in example 3, mixing with the solution of the centrifuge tube in the step (1), respectively adding into 293T cells of a DMEM medium containing 10% fetal calf serum after 30 minutes, taking the culture solution for warm centrifugation after 24 hours, and taking the supernatant. (3) And (3) configuring 100 mu l of glioma cell A172(5000 cells/well) in a 96-well plate by using a DMEM medium containing 10% fetal bovine serum, dividing the DMEM medium into a scramble group, a SEPT2-sh1 group, a SEPT9-sh1 group and a SEPT2 and 9-sh1 group, adding 120 mu l of corresponding supernatant obtained in the step (2) into each well, washing the cells by using precooled PBS after the cells begin to undergo apoptosis, and then discarding the washing liquid. The above operation was repeated twice, and the cells were co-washed three times to wash out the culture solution. After discarding the PBS, the flasks were placed on ice. Western blot was performed in the same manner as in example 2.

And (4) experimental conclusion: a recent study reported that activation of the MEK-ERK signaling pathway, but not the PI3K/AKT signaling pathway, was associated with increased protein levels of SEPT2 and SEPT7 in breast cancer. Therefore, we began to study the anti-GBM effect induced by the molecular mechanism of SEPT9/2 RNAi. We observed that inhibition of SEPT9 and SEPT2 specifically attenuated MEK1/2 phosphorylation and phosphorylation of the downstream gene Erk1/2 (A in FIG. 7). There was no significant increase in Akt activation, similar to the observation of SEPT2 and SEPT7 depletion in breast cancer cells. This result suggests that the MEK-ERK signaling pathway may be critical for the function of the Septin family in different cancer cell types.

As previously described, SEPT9 and SEPT2 interference caused GBM cell cycle arrest in S phase (C in a and 5 in fig. 5) and massive apoptosis in cells (D in B and 5 in fig. 5). Therefore, we next examined the expression of P53 and P21 in cell cycle and apoptosis-regulating proteins. p53 protects mammals from tumor formation by inducing apoptosis, DNA repair and cell cycle arrest, as shown in B in FIG. 7. p53 accumulated in a single Septin interference group, and was more evident in the dual Septin knockout group. Protein levels of p21 were also up-regulated following accumulation of p53, consistent with the previous observation that p53 can mediate transcription of p21, and subsequently bind to and inactivate the Cdc2-Cyclin B1 complex, leading to S-phase cell cycle arrest.

Example 8 overexpression of SEPT9 or SEPT2 rescues RNAi-induced cell growth inhibition

The experimental method comprises the following steps:

1.(1) 4 1.5ml centrifuge tubes were taken and 30ul DMEM, 30ul Fectin (ThermoFisher) was added. (2) And (2) adding 60ul of DMEM, 0.75ug of pspax2 packaging plasmid and 0.25ug of pmd2.g packaging plasmid into 4 1.5ml centrifuge tubes, respectively adding scrambles, SEPT2-sh1, SEPT2-sh1+ SEPT9-OE, SEPT9-sh1 and SEPT2-OE + SEPT9-sh1 interference plasmid, mixing with the solution of the centrifuge tube in the step (1), respectively adding the mixture into 293T cells of a DMEM culture medium containing 10% fetal calf serum after 30 minutes, taking the culture solution for warm centrifugation, and taking the supernatant after 24 hours. (3) DMEM medium containing 10% fetal bovine serum was prepared in 96-well plates with 100. mu.l of glioma cell A172(5000 per well), and 120. mu.l of the corresponding supernatant of step (2) was added to each well, and the state of the cells was observed in a fluorescence microscope after the onset of apoptosis. pMEK1/2 and pErk1/2, Erk, p53 and p21 were detected in A172 cells using western blot as described in example 2.

2. Under the same conditions, grouping step 1 was changed to scrambles, SEPT2 group (SEPT2-sh1), SEPT2+ SEPT9 overexpression group (SEPT2-sh1+ SEPT9-OE), SEPT9 group (SEPT9-sh1) and SEPT2 overexpression + SEPT9 group (SEPT2-OE + SEPT9-sh 1). Cell immunofluorescence was performed using the method of example 2 and cell growth curve detection was performed using the method of example 4.

The experimental results are as follows: since SEPT9 and SEPT2 knockouts inhibit the growth of GBM cells in a synergistic manner, we speculate that over-expression of one Septin gene could compensate for the loss of the other in GBM cells. Therefore, we performed a rescue experiment in a 172. As expected, overexpression of SEPT9 in SEPT2 knockdown cells rescued cell growth inhibition by RNAi, and overexpression of SEPT2 in SEPT9 depleted cells had a similar effect (C in fig. 7 and D in 7).

Example 9: SEPT9 and SEPT2 inhibit GBM growth in vivo

The experimental method comprises the following steps: 30 female immunodeficient nude mice (BALB/c-nu) of 5 weeks of age were purchased from Shanghai SLAC laboratory animals.

(1) 4 1.5ml centrifuge tubes were taken and 30ul DMEM, 30ul Fectin (ThermoFisher) was added. (2) And (2) adding 60ul of DMEM, 0.75ug of pspax2 packaging plasmid and 0.25ug of pmd2.g packaging plasmid into 4 1.5ml centrifuge tubes, respectively adding scramble, SEPT2-sh1, SEPT9-sh1, SEPT2-sh1+ SEPT9-sh1 interference plasmid, mixing with the solution of the centrifuge tube in the step (1), adding into 293T cells of a DMEM medium containing 10% fetal calf serum after 30 minutes, taking the culture solution for warm centrifugation after 24 hours, and taking the supernatant. (3) And (3) configuring 100 mu l of glioma cells U87-MG (5000 cells/well) in a 96-well plate by using a DMEM medium containing 10% fetal calf serum, adding 120 mu l of corresponding supernatant obtained in the step (2) into each well, and culturing until the cells begin to undergo apoptosis to obtain U87-Scramble cells, U87-SEPT2-sh1 cells, U87-SEPT9-sh1 cells, U87-SEPT2 cells and U9-sh 1 cells respectively, wherein the U87 cells are used as a control.

(4) The cells of each group of step (3) were injected subcutaneously at 2X 10^6 into the right hind limb of nude mice, and obvious nodules were observed on day 5. GFP-labeled GBM cells were followed with an in vivo imaging system (PerkinElmer, San Jose, CA, USA), and tumor volumes were measured with calipers every 4 days for an observation period of 3 weeks using the formula: length x width²×0.5⁴⁴All mice were sacrificed after day and tumor weight was measured.

The experimental results are as follows: to investigate the anti-GBM effect of SEPT9-sh1 and SEPT2-sh1 interfering plasmids in vivo, we established a subcutaneous xenograft tumor model of GBM cells. Photographs of each group of cells after 5 days of injection into nude mice are shown in fig. 8 a, and tumor volumes are measured at different time points of tumor growth in different groups (fig. 8B). After 8 days, the average tumor size of the mice with the addition of U87-SEPT2-sh1, U87-SEPT9-sh1, U87-SEPT2 and U1-SEPT 1 cells was not increased compared with the groups U87 and U87-Scramble. After 20 days, the tumor of each mouse was removed and weighed. Single and dual Septin RNAi treatments significantly reduced solid tumor mass compared to the U87 and U87-scarmble groups (C in fig. 8), indicating that downregulation of SEPT9 and SEPT2 expression in GBM cells inhibits their tumor formation in vivo.

Sequence listing

<110> university of teachers in Hangzhou

<120> application of septin gene shRNA in preparation of septin gene activity inhibitor

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>144

<212>DNA

<213> Unknown (Unknown)

<400>1

gatccgagat caagtccatc acgcacgata tttcaagaga atatcgtgcg tgatggactt 60

gatctctttt tgaattcaaa aagagatcaa gtccatcacg cacgatattc tcttgaaata 120

tcgtgcgtga tggacttgat ctcg 144

<210>2

<211>128

<212>DNA

<213> Unknown (Unknown)

<400>2

gatccgtggt caacatcgtc cctgtcattc aagagatgac agggacgatg ttgaccactt 60

tttgaattca aaaagtggtc aacatcgtcc ctgtcatctc ttgaatgaca gggacgatgt 120

tgaccacg 128

<210>3

<211>152

<212>DNA

<213> Unknown (Unknown)

<400>3

gatccgctat ggtgacgcta tcaactgcag agattcaaga gatctctgca gttgatagcg 60

tcaccatagc tttttgaatt caaaaagcta tggtgacgct atcaactgca gagatctctt 120

gaatctctgc agttgatagc gtcaccatag cg 152

<210>4

<211>148

<212>DNA

<213> Unknown (Unknown)

<400>4

gattcggcag gaaagtggag aatgaggaca tgatcaagag tcatgtcctc attctccact 60

ttcctgcctt tttgaattca aaaaggcagg aaagtggaga atgaggacat gactcttgat 120

catgtcctca ttctccactt tcctgccg 148

Claims (2)

1. An application of a septin gene shRNA in preparing a glioblastoma active inhibitor is characterized in that the nucleotide sequence of the septin gene shRNA is shown as one of the following:

SEPT9-shRNA-1：

GATCCGAGATCAAGTCCATCACGCACGATATTTCAAGAGAATATCGTGCGTGATGGACTTGATCTCTTTTTGAATTCAAAAAGAGATCAAGTCCATCACGCACGATATTCTCTTGAAATATCGTGCGTGATGGACTTGATCTCG；

SEPT2-shRNA-1：

GATCCGCTATGGTGACGCTATCAACTGCAGAGATTCAAGAGATCTCTGCAGTTGATAGCGTCACCATAGCTTTTTGAATTCAAAAAGCTATGGTGACGCTATCAACTGCAGAGATCTCTTGAATCTCTGCAGTTGATAGCGTCACCATAGCG。

2. the use of claim 1, wherein said glioblastoma is glioma cell U-87MG or glioma cell a 172.

Images