CN105132429A - SiRNA targeted to human KPNB1 genes and application thereof - Google Patents
SiRNA targeted to human KPNB1 genes and application thereof Download PDFInfo
- Publication number
- CN105132429A CN105132429A CN201510651096.2A CN201510651096A CN105132429A CN 105132429 A CN105132429 A CN 105132429A CN 201510651096 A CN201510651096 A CN 201510651096A CN 105132429 A CN105132429 A CN 105132429A
- Authority
- CN
- China
- Prior art keywords
- kpnb1
- shrna
- seqidno
- sirna
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention relates to the field of biological medicine and gene therapy, and provides siRNA or shRNA capable of specifically restraining KPNB1 gene expressions, application of siRNA or shRNA in preparing KPNB1 gene expression inhibitors and application of siRNA or shRNA in preparing glioma prevention and treatment medicine.
Description
Technical field
The present invention relates to biological medicine and field of gene, be specifically related to a kind of siRNA of targeted human KPNB1 gene and preparing the application in antitumor drug.
Background technology
KPNB1 full name is Karyopherin (importin) beta1, namely transports receptor protein β 1 (input albumen β 1).Outside nucleo-cytoplasmic transport receptor protein importin 'beta ' family member plays an important role in the input process of nucleoprotein, also there is the biological function that other is important, as in the effect serving potential motor Function protein in the moving of microtubule, participate in the assembling of spindle body, the kinetics of centrosome, the assembling of nuclear membrane, the assembling of nucleopore and by processes such as the transduction of damage signal from damaged axon to cell paste.(WANGShan etc., IdentificationofInteractionbetweenMARVELD1andlmportin β 1ChineseJournalofBiochemistryandMolecularBiolog, 2009May; 25 (8): 735 ~ 739).
People KPNB1 gene is positioned at No. 17 karyomit(e)s, mRNA (GenebankAccession:NM_002265.5).Current research table KNPB1 can be transported into core multiple proteins, and one is death receptor DR5 (DeathReceptor), thus suppresses the apoptosis that DR5/TRAIL causes.(KojimaY.etc; Importin β 1Proteinmediatednuclearlocalizationofdeathreceptor5 (DR5) limitsDR5tumornecrosisfactor (TNF)-relatedapoptosis-inducingligand (TRAIL)-inducedcelldeathofhumantumorcells; JBiolChem, 2011Dec16; 286 (50): 43383-93.); One is ErbB2 (ReceptortyrosineproteinkinaseerbB-2), and ErbB2 and kinds of tumors comprise relevant (DipakK, the Giri.EndosomalTransportofErbB-2:MechanismforNuclearEntry oftheCellSurfaceReceptor.MOLECULARANDCELLULARBIOLOGY of glioma; Dec.2005, p.11005 – 11018); KNPB1 regulates by E2F, (VanderWattPJetc.OverexpressionofKpn β 1andKpn α 2importinproteinsincancerderivesfromderegulatedE2Factivi ty.PlosOne.2011 relevant to cell cycle regulating; 6 (11) e27723); Also has EzH2-miR-30d-KPNB1 path to effect (PingyuZhang.etc, the EZH2 – miR-30d – KPNB1pathwayregulatesmalignantperipheralnervesheathtumou rcellsurvivalandtumourigenesis.JournalofPathology.2014 of Malignant Peripheral Nerve Sheath Tumors (MPNSTs); 232:308 – 318).
Tumour is one of disease threatening human health, lacks desirable treatment means and medicine so far, develops new medicine extremely urgent.Gene therapy is very promising, perhaps can become an effective means of oncotherapy in the near future.RNA perturbation technique is the technology that a kind of silencer is expressed, and two American scientist AndrewZ.Fire and CraigC.Mello are because of contributing to 2006 and be awarded Nobel's physiology and encourage technique.The principle of RNA perturbation technique is the siRNA be made up of justice and antisense strand being cut into 21-23nt compared with long dsrna by specific nucleic acid enzyme Dicer.SiRNA forms silencing complex (RNA-inducedsilencingcomplex, RISC) subsequently and untwists into strand.Antisense strand guides this silencing complex to be specifically bound on target mRNA by base pairing, and mRNA is decomposed.
Hairpin RNA (shorthairpinRNA, shRNA) is a kind of RNA sequence forming zig zag structure, can make gene silencing via RNA interference.
Glioma is a kind of tumour betiding brain or spinal cord, and the most normal happening part is brain, is called as glioma because of its Derived Nerve spongiocyte.Glioma account for brain and central nerve neuroma 30%, account for 80% of brain malignant brain tumor, be the serious threat of human health.The treatment of cerebral glioma adopts operation usually, and radiation and chemotherapy combines.Glioma often betides brain, and operation needs out cranium, and operating time is long.Glioma and the staggered growth of normal nervous tissue, obscure boundary, tumor tissue is not easily cleaned out, and glioma easily recurs.For chemotherapy, due to the existence of hemato encephalic barrier, make common antitumor drug unsatisfactory curative effect.For radiotherapy, also there is location difficulty and the worry to nerve injury.Current glioma is still a difficult problem of medical circle.
Summary of the invention
The object of the present invention is to provide a kind of siRNA of targeted human KPNB1 gene, another object of the present invention is to provide this siRNA preparing the application in antitumor drug.
The present inventor the experiment proved that the glioma that grade malignancy is higher, and the expression amount of KPNB1 is also higher, regulates the expression of KPNB1 can affect the propagation of glioma cell.
The present invention, in conjunction with the function of KPNB1 molecule in oncocyte, utilizes RNA perturbation technique to develop new medicine.
The present invention designs the siRNA of target KPNB1 gene, and specificity suppresses the expression of KPNB1 gene, thus suppresses the propagation of glioma.The invention provides the shRNA molecule comprising this siRNA further, also there is the effect of the expression suppressing KPNB1, the medicine for the treatment of glioma may be become.
A first aspect of the present invention, is to provide a kind of targeted human KPNB1 gene, and specificity suppresses siRNA or shRNA of KPNB1 genetic expression.
The invention provides three kinds of targeted human KPNB1 genes and the siRNA of specificity suppression KPNB1 genetic expression, comprise positive-sense strand and antisense strand, the sequence of siRNA is as follows:
siRNA-1：
Positive-sense strand: 5 '-GCUUGCUAUUGAUGCUAAUGC-3 ' (SEQIDNO.1)
Antisense strand: 5 '-CGAACGAUAACUACGAUUACG-3 ' (SEQIDNO.2)
siRNA-2:
Positive-sense strand: 5 '-GGAAGUGUUGGGUGGUGAAUU-3 ' (SEQIDNO.3)
Antisense strand: 5 '-CCUUCACAACCCACCACUUAA-3 ' (SEQIDNO.4)
siRNA-3：
Positive-sense strand: 5 '-GGUGGACAAGUCAGACUAUGA-3 ' (SEQIDNO.5)
Antisense strand: 5 '-CCACCUGUUCAGUCUGAUACU-3 ' (SEQIDNO.6)
The present invention finds through experiment, and the interference effect of siRNA-2, siRNA-3 is best.
The invention provides a kind of shRNA sequence of above-mentioned siRNA sequence, comprise positive-sense strand and antisense strand, shRNA sequence is:
shRNA-1：
Positive-sense strand:
5’-
CCGGGCUUGCUAUUGAUGCUAAUGCCUCGAGGCAUUAGCAUCAAUAGCAAGCUUUUUUG-3’(SEQIDNO.7)
Antisense strand:
5’-
AAUUCAAAAAAGCUUGCUAUUGAUGCUAAUGCCUCGAGGCAUUAGCAUCAAUAGCAAGC-3’(SEQIDNO.8)
shRNA-2：
Positive-sense strand:
5’-
CCGGGGAAGUGUUGGGUGGUGAAUUCUCGAGAAUUCACCACCCAACACUUCCUUUUUUG-3’(SEQIDNO.9)
Antisense strand:
5’-
AAUUCAAAAAAGGAAGUGUUGGGUGGUGAAUUCUCGAGAAUUCACCACCCAACACUUCC-3’(SEQIDNO.10)
ShRNA-3：
Positive-sense strand:
5’-
CCGGGGUGGACAAGUCAGACUAUGACUCGAGUCAUAGUCUGACUUGUCCACCUUUUUUG-3’(SEQIDNO.11)
Antisense strand:
5’-
AAUUCAAAAAAGGUGGACAAGUCAGACUAUGACUCGAGUCAUAGUCUGACUUGUCCACC-3’(SEQIDNO.12)
The present invention finds through experiment, and the interference effect of shRNA-2, shRNA-3 is best.
Further, the invention provides a kind of DNA sequence dna of transcribing above-mentioned shRNA, DNA sequence dna is:
ShRNA-1：
The DNA of transcribed plus chain:
5’-
CCGGGCTTGCTATTGATGCTAATGCCTCGAGGCATTAGCATCAATAGCAAGCTTTTTTG-3’(SEQIDNO.13)
The DNA of transcribes anti-sense chain:
5’-
AATTCAAAAAAGCTTGCTATTGATGCTAATGCCTCGAGGCATTAGCATCAATAGCAAGC-3’(SEQIDNO.14)
ShRNA-2:
The DNA of transcribed plus chain:
5’-
CCGGGGAAGTGTTGGGTGGTGAATTCTCGAGAATTCACCACCCAACACTTCCTTTTTTG-3’(SEQIDNO.15)
The DNA of transcribes anti-sense chain:
5’-
AATTCAAAAAAGGAAGTGTTGGGTGGTGAATTCTCGAGAATTCACCACCCAACACTTCC-3’(SEQIDNO.16)
ShRNA-3:
The DNA of transcribed plus chain:
5’-CCGGGGTGGACAAGTCAGACTATGACTCGAGTCATAGTCTGACTT
GTCCACCTTTTTTG-3’(SEQIDNO.17)
The DNA of transcribes anti-sense chain:
5’-
AATTCAAAAAAGGTGGACAAGTCAGACTATGACTCGAGTCATAGT
CTGACTTGTCCACC-3’(SEQIDNO.18)
The present invention finds through experiment, and the interference effect of ShRNA-2, ShRNA-3 is best.
A second aspect of the present invention, provides a kind of recombinant vectors, the shRNA of the siRNA containing targeted human KPNB1 gene as above or targeted human KPNB1 gene as above.
Described recombinant vectors, carrier can be selected from plasmid, lentiviral vectors, adenovirus carrier etc., is preferably plasmid pLKD-CMV-GFP-U6.
A third aspect of the present invention, is to provide above-mentioned siRNA, shRNA, or the application of DNA sequence dna in preparation KPNB1 gene expression inhibitor.
Further, present invention also offers above-mentioned siRNA, shRNA, or DNA sequence dna is preparing the application in antitumor drug.
Described tumour is glioma.
Main technical schemes of the present invention is:
The design of 1.siRNA and the preparation of interference carrier;
Search for and download the cDNA sequence of KPNB1, using the BLOCK-iTRNADesigner software Photographing On-line of Lifetechnologies company and the siRNA sequence of KNPB1cDNA complementation.Choose the siRNA sequence that score is the highest, with the transcription sequence comparison of people, get rid of inclined targeted effect.By the order engineer shRNA of " AgeI restriction enzyme site sticky end-positive-sense strand-stem ring-antisense strand-code termination sequence-EcoRI restriction enzyme site sticky end ".
2. disturb the packaging of lentiviral particle;
With Lipofectamine2000 the mixture of pLKD-CMV-GFP-U6-shRNA plasmid (or not containing the empty carrier plasmid of shRNA), virus coat plasmid psPAX2, packaging plasmid pMD2.G added in 293T cell culture medium and carry out transfection, after 4-6 hour, be replaced by normal substratum.Collect 24 and 48 hours wild Oryza species, after filtering, ultracentrifugation obtains virus deposition block.Slow virus is obtained with the resuspended collection of substratum.
3. jamming effectiveness is in the checking of protein level;
The impact of cell line proliferation after 4.MTT method detection interference KPNB1;
5. the impact on cell line proliferation after Clone formation detection interference KPNB1.
The RNA interfering that the present invention relates to effectively can suppress the expression of people KPNB1 gene at messenger rna level and protein level, thus suppresses the propagation of glioma cell line U87 and U251, and the treatment for glioma provides new approach.
Accompanying drawing explanation
Fig. 1 is that WesternBlot method detects the film scanning figure disturbing KPNB1 to cause the KPNB1 protein level of U87 and U251 clone to decline;
Fig. 2 is the broken line graph that mtt assay detects interference KPNB1 suppression U87 and U251 cell line growth; Ordinate zou is the light absorption value at 490nm place;
Fig. 3 is the photo figure that clone forming method detects that interference KPNB1 suppression U87 and U251 forms clone;
The virus (shKPNB1) of the virus (control) containing empty carrier in Fig. 1 ~ Fig. 3 and interference KPNB1.
Embodiment
Below in conjunction with accompanying drawing, the present invention is further described.The one of following embodiment just preferably in embodiment, not limitation of the present invention.Change, the modification done under other any does not deviate from spirit of the present invention and principle, substitute, combine, simplify, all should be the substitute mode of equivalence, be included within protection scope of the present invention.Do not make experiment reagent and the method for specified otherwise, all refer to conventional reagent and method.
Agents useful for same of the present invention and raw material all commercially maybe can be prepared by literature method.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as the people such as Sambrook " molecular cloning: lab guide " (NewYork:ColdSpringHarborLaboratoryPress, 1989) condition described in, or conveniently condition, or according to the condition that manufacturer advises.
Embodiment 1: build KNPB1 interference plasmid
Search at Ensemble website (http://www.ensembl.org/index.html) and download the cDNA sequence of KPNB1, using BLOCK-iTRNADesigner software (http://rnaidesigner.lifetechnologies.com/rnaexpress/) Photographing On-line of Lifetechnologies company and the siRNA sequence of KNPB1cDNA complementation.Choose the siRNA sequence that score is the highest, as follows:
siRNA-1：
Positive-sense strand: 5 '-GCUUGCUAUUGAUGCUAAUGC-3 ' (SEQIDNO.1)
Antisense strand: 5 '-CGAACGAUAACUACGAUUACG-3 ' (SEQIDNO.2)
siRNA-2:
Positive-sense strand: 5 '-GGAAGUGUUGGGUGGUGAAUU-3 ' (SEQIDNO.3)
Antisense strand: 5 '-CCUUCACAACCCACCACUUAA-3 ' (SEQIDNO.4)
siRNA-3：
Positive-sense strand: 5 '-GGUGGACAAGUCAGACUAUGA-3 ' (SEQIDNO.5)
Antisense strand: 5 '-CCACCUGUUCAGUCUGAUACU-3 ' (SEQIDNO.6)
Be input to the StandardNuceotideBLAST interface of NCBI website, with the transcription sequence comparison of people, confirm that goal gene and the transcript except KPNB1 are without high homology (more than 16 bases), get rid of inclined targeted effect.Then according to the order of " AgeI restriction enzyme site sticky end-positive-sense strand-stem ring-antisense strand-code termination sequence-EcoRI restriction enzyme site sticky end ", siRNA is assembled into shRNAd positive-sense strand and antisense strand.
ShRNA-1：
The DNA of transcribed plus chain:
5’-
CCGGGCTTGCTATTGATGCTAATGCCTCGAGGCATTAGCATCAATAGCAAGCTTTTTTG-3’(SEQIDNO.13)
The DNA of transcribes anti-sense chain:
5’-
AATTCAAAAAAGCTTGCTATTGATGCTAATGCCTCGAGGCATTAGCATCAATAGCAAGC-3’(SEQIDNO.14)
ShRNA-2:
The DNA of transcribed plus chain:
5’-
CCGGGGAAGTGTTGGGTGGTGAATTCTCGAGAATTCACCACCCAACACTTCCTTTTTTG-3’(SEQIDNO.15)
The DNA of transcribes anti-sense chain:
5’-
AATTCAAAAAAGGAAGTGTTGGGTGGTGAATTCTCGAGAATTCACCACCCAACACTTCC-3’(SEQIDNO.16)
ShRNA-3:
The DNA of transcribed plus chain:
5’-CCGGGGTGGACAAGTCAGACTATGACTCGAGTCATAGTCTGACTT
GTCCACCTTTTTTG-3’(SEQIDNO.17)
The DNA of transcribes anti-sense chain:
5’-
AATTCAAAAAAGGTGGACAAGTCAGACTATGACTCGAGTCATAGT
CTGACTTGTCCACC-3’(SEQIDNO.18)
The synthesis of invitrogen company is handed over to obtain DNAOligo above information.
DNAOligo adds ddH
2o dissolves, concentration 10mM.Distinctly get
dNAOligo with
10 × annealing buffer (composition is 100mMTris-HCl (pH7.5), 10mMEDTA, 1mMNaCl) mixing, take out after 95 DEG C of water-bath 12min, be at room temperature cooled to room temperature.
At 25 DEG C, with T4 ligase enzyme (Japanese TAKARA company produces), the carrier that complementary double-strand and AgeI, EcoRI enzyme are cut is connected 30min, system by specification preparation (DNA4 μ l, carrier 2 μ l, PEG40002 μ l, 10 × T4buffer2 μ l, T4 ligase enzyme 1 μ l, ddH2O9 μ l).Get and connect product and add the 1.5ml specification centrifuge tube that bacillus coli DH 5 alpha competent cell is housed and make it mix, be placed in 30 minutes on ice, then put into 42 DEG C of water-baths 90 seconds, then put back to and add 800 μ l on ice after 2 minutes not containing antibiotic substratum, put in 37 DEG C of bacteriological incubators and shake 1 hour.Be coated with solid LB media flat board after the bacterium that 4500 revs/min of collected by centrifugation obtain, 37 DEG C of bacteriological incubator incubated overnight are to growing bacterium colony.
Picking colony is dissolved in the centrifuge tube containing 20 μ l resistance culture bases, carries out bacterium colony PCR qualification, identifies that primer used is:
PLKD-F：CCTATTTCCCATGATTCCTTCATA(SEQIDNO.19)
PLKD-R：GAAATACGGTTATCCACGCG(SEQIDNO.20)
Transform successfully sampling and send order-checking (Hua Da gene company limited provides order-checking service), the primer that order-checking uses is: PLKD-F:CCTATTTCCCATGATTCCTTCATA (SEQIDNO.19).
After sequencing result comparison is correct, bacterium liquid should be added in the 50ml centrifuge tube containing 15ml penbritin LB substratum.Centrifuge tube is put into 37 DEG C of shaking tables and cultivate 20 hours.Plasmid is extracted with the little middle amount test kit (Tian Gen company) of carrying of plasmid, for subsequent use after measuring DNA concentration.Obtain pLKD-CMV-GFP-U6-shRNA1,2,3 plasmids.
By 293T cell kind in 6 well culture plates, when degree of converging reaches 40% with lipofection by shRNA plasmid transfered cell.Step is: transfection changes fresh culture in first 0.5 hour.In 2 centrifuge tubes, respectively add the Opti-MEM substratum (Gibco company) of 125 μ l, add 9 μ lLipofectamine2000 (Invitrogen company) in one of them pipe, another pipe adds 6 μ gshRNA plasmids.5 minutes are placed after each mixing.Again by the liquid blending in two pipes, place 20 minutes.Finally liquid is added cultivation orifice plate.Cultivate after 6 hours for 37 DEG C and suck transfection liquid, change fresh culture.Transfection is lysing cell after 72 hours, extracts albumen, and detected by Western blot detects the expression of people KPNB1.
Find through experiment: the interference effect of siRNA-2, siRNA-3 is best.The interference effect of shRNA-2, shRNA-3 is best.
The shRNA sequence of above-mentioned siRNA sequence, comprises positive-sense strand and antisense strand, and shRNA sequence is:
shRNA-1：
Positive-sense strand:
5’-
CCGGGCUUGCUAUUGAUGCUAAUGCCUCGAGGCAUUAGCAUCAAUAGCAAGCUUUUUUG-3’(SEQIDNO.7)
Antisense strand:
5’-
AAUUCAAAAAAGCUUGCUAUUGAUGCUAAUGCCUCGAGGCAUUAGCAUCAAUAGCAAGC-3’(SEQIDNO.8)
shRNA-2：
Positive-sense strand:
5’-
CCGGGGAAGUGUUGGGUGGUGAAUUCUCGAGAAUUCACCACCCAACACUUCCUUUUUUG-3’(SEQIDNO.9)
Antisense strand:
5’-
AAUUCAAAAAAGGAAGUGUUGGGUGGUGAAUUCUCGAGAAUUCACCACCCAACACUUCC-3’(SEQIDNO.10)
ShRNA-3：
Positive-sense strand:
5’-
CCGGGGUGGACAAGUCAGACUAUGACUCGAGUCAUAGUCUGACUUGUCCACCUUUUUUG-3’(SEQIDNO.11)
Antisense strand:
5’-
AAUUCAAAAAAGGUGGACAAGUCAGACUAUGACUCGAGUCAUAGUCUGACUUGUCCACC-3’(SEQIDNO.12)
The present invention finds through experiment, and the interference effect of shRNA-2, shRNA-3 is best.
Embodiment 2: the packaging of interference lentiviral particle
At 37 DEG C of 5%CO
2cell culture incubator in cultivate HEK293T cell (under be called for short 293T, purchased from the American Type Culture Collection council of Chinese Academy of Sciences cell bank), substratum uses DMEM (production of the USA New York Gibco company) substratum that with the addition of 10% foetal calf serum (production of USA New York Gibco company). and Secondary Culture 293T cell is in the culture dish of 10cm in diameter, be about 50% when cell grows to degree of converging, by the culture medium culturing 4 hours of serum-free.
By the operation of Lipofectamine2000 (production of American I nvitrogen company) specification sheets, get out the transfection mixture of 22.5g pLKD-CMV-GFP-U6-shRNA plasmid obtained above (or not containing the empty carrier plasmid of shRNA), 7.9g virus coat plasmid psPAX2 (Chinese Shanghai Niu En bio tech ltd provides), 14.6g packaging plasmid pMD2.G (Chinese Shanghai Niu En bio tech ltd provides).
Mixture is added in the cell that hunger had been cultivated and carries out transfection, after 4-6 hour, be replaced by normal substratum.Cultivate 24 and 48 h before harvest substratum changing liquid respectively, after the membrane filtration in 0.22 μm of aperture, then use CP80MX whizzer (HIT's production) through 4 DEG C, 100000g ultracentrifugation 2 hours, obtain virus deposition block.Slow virus is obtained with OPTI-MEM (production of USA New York Gibco company) the resuspended collection of substratum.
Be packaged to be the virus (control) containing empty carrier by above method and disturb the virus (shKPNB1-1, shKPNB1-2, shKPNB1-3) of KPNB1.The titer determination of slow virus adopts the dilution method of counting, 293T cell is spread 96 orifice plates, about 5000, every hole cell, incubated overnight.Get out totally 10 parts, the virus with substratum 10 times of gradient dilutions, namely minimum, maximum concentration is respectively 1/10 of stoste
- 10, 1/10
-1, the culture medium culturing that every part of 100 μ l change corresponding aperture changes normal incubation medium after spending the night.Change fresh culture to cultivate again two days later, latter two has clone's number of the fluorocyte in the hole of fluorescence to put fluorescence microscopy Microscopic observation, with following formulae discovery virus titer: titre (TU/ml)=(X+Y*10) * 10/ (2*Z) wherein X refer to penultimate have the hole of fluorescence fluorocyte clone number, Y refers to last the fluorocyte clone number having the hole of fluorescence, and Z refers to the thinning ratio of the added virus of X corresponding aperture.
Embodiment 3: jamming effectiveness is in the checking of protein level
The preparation of protein sample:
In diameter 6cm culture dish, culturing cell is to about 30% degree of converging, and adds the virus infection particle (infection multiplicity is 10) of contrast slow virus infection particle and interference KPNB1 respectively, continues culturing cell 4 days.When receiving cell, first transport medium is to empty 15ml specification centrifuge tube, with PBS rinsing twice cell, uses PBS3ml at every turn, then uses 2ml0.25% trypsin digestion and cell, until cell all become circle floating after the substratum siphoned away before is refunded culture dish.The cell digested with media transfer in 15ml specification centrifuge tube, 1200 revs/min of centrifugal 5 minutes collecting cells.Discard supernatant, add the RIPA cell pyrolysis liquid (the green skies company of China Nantong produces) containing 1 × PMSF (production of China Nantong green skies company) and 1 × proteinase inhibitor cocktail (production of ThermoScientific company of the U.S.).Piping and druming mixing cell and lysate, be put in cracking on ice 1 hour, within every 20 minutes, mixes with eddy mixer vibration.Finally centrifugal, whizzer is set to: 4 DEG C, 13000 revs/min, 15 minutes.Draw centrifugal after supernatant liquor to clean centrifuge tube, be the protein sample raised.Protein sample and isopyknic 2 × albumen sample-loading buffer (dithiothreitol (DTT) (DTT): 0.1572g, tetrabromophenol sulfonphthalein; 0.01g, Tris-HCl (1MpH6.8): 0.5ml, 10%SDS:2ml, glycerine: 1ml, H
2o: be settled to 10ml) mix and boil 5 minutes, complete sample preparation.
The compound method of Tris (1MpH6.8) damping fluid: take TrisBase24.228g and be dissolved in about 160ml ultrapure water, abundant stirring and dissolving, with salt acid for adjusting pH to 6.8, is settled to 200ml with ultrapure water simultaneously.
WesternBlot method detects protein expression:
Get out the reagent preparing gel needs:
The compound method of 30%acrylamidemix: take acrylamide 29.2g, methylene diacrylamide 0.8g, dissolves with ultrapure water and is settled to 100ml.
Tris (1.5MpH8.8) compound method: take TrisBase36.342g and be dissolved in about 160ml ultrapure water, abundant stirring and dissolving, with salt acid for adjusting pH to 8.8, is settled to 200ml with ultrapure water simultaneously.
The compound method of Tris (0.5MpH6.8) damping fluid: take TrisBase12.114g and be dissolved in about 160ml ultrapure water, abundant stirring and dissolving, with salt acid for adjusting pH to 6.8, is settled to 200ml with ultrapure water simultaneously.
The compound method of 10%SDS: take 5g sodium lauryl sulphate (sodiumdodecylsulfate, SDS), is dissolved in ultrapure water to 50ml.
The compound method of 10%APS: take 5g ammonium persulphate (Ammoniumpersulfate, APS), is dissolved in ultrapure water to 50ml.
TEMED refers to N, N, N', N'-Tetramethylethylenediamine, Chinese name N, N, N', N'-tetramethyl-diethylamine.
Get out the sheet glass (production of Chinese Shanghai Tian Neng Science and Technology Ltd.) of electrophoresis apparatus (the VE-180 type Vertial electrophorestic tank that Chinese Shanghai Tian Neng Science and Technology Ltd. produces) and preparation 1.5mm thick gel.Sheet glass liquid detergent, clear water washes clean, then use deionized water rinsing one time, put into electric drying oven with forced convection and dry.Assemble after sheet glass is absolutely dry and join adhesive dispenser, prepare 10% separation gel (ddH
2o:4.0ml, 30%acrylamidemix:3.3ml, Tris (PH8.81.5M): 2.5ml, 10%SDS:100 μ l, 10%APS:100 μ l, TEMED:4 μ l), be injected into sheet glass, add rear use 300 μ l ultrapure water and seal upper surface.
Room temperature places more than 30 minutes, treats that water and the separation gel two-phase interface solidified become clear, gets out 5% concentrated glue (ddH
2o:2.7ml, 30%acrylamidemix:0.67ml, Tris (PH6.80.5M): 0.5ml, 10%SDS:40 μ l, 10%APS:40 μ l, TEMED:4 μ l), outwell the water in sheet glass, inject concentrated glue, plug comb, room temperature is placed and can be used after it solidifies for 20 minutes.
Electrophoresis:
Preparation 10 × electrophoresis liquid (Tris:30.3g, glycine: 144.0g, SDS:10.0g, deionized water: be settled to 1000ml), by 50ml10 × electrophoresis liquid and 450mlH
2o
2namely mixing obtains 500ml1 × electrophoresis liquid.
Install electrophoresis apparatus and rinse well with clear water, pulling out comb.Go up 500ml electrophoresis liquid, electrophoresis chamber inside groove is kept to be full of electrophoresis liquid, sample centrifugal 1s under 6000 revs/min of conditions adds swimming lane after collecting, and one of them blank well that contiguous sample is put adds pre-dyed marker (Canadian Fermentas company produces, article No. SM0671).Limit power condition during electrophoresis: constant current 15-20mA.To be instructed dose of show sample stops electrophoresis close to during gel lower boundary.
Transferring film:
Preparation 10 × transferring film liquid (Tris:30.3g, glycine: 144.0g, H
2o: be settled to: 1000ml).
Next 1 × transferring film liquid (10 × transferring film liquid: 80ml, methyl alcohol: 160ml, H is prepared
2o: be settled to 800ml).Get out membrane-transferring device, two groups of 9 × 8cm specification filter paper, often organize three.Pvdf membrane is first immersed in methyl alcohol about 20 seconds and treats that it soaks into without white point, then after putting into transferring film liquid balance, be transferred in the capsule that transferring film liquid is housed for subsequent use.Then concentrated glue is cut gently with plastic sheet, then cutting and separating glue two ends and the face with glass contact.Dip in a little transferring film liquid with plastic sheet, make it loosen under filling in separation gel, then jiggled to the plastic tub that transferring film liquid is housed by its back-off, namely separation gel departs from transferring film liquid from glass.
Open the plastic plate of transferring film, be immersed in transferring film liquid, assemble in the following order in transferring film liquid: sponge → mono-group filter paper (three) → separation gel → pvdf membrane → mono-group filter paper (three) → sponge → positive plate put by negative plate (black).Then clamped device, gone up transferring film liquid, guarantee that the sandwich spline structure of transferring film is immersed in transferring film liquid completely, cover the lid with supply lead, whole electrophoresis apparatus is placed in plastic tub, and electrophoresis cartridge periphery adds that mixture of ice and water can start transferring film.Limit power condition: U=100V during transferring film; I=350mA; T=75min.
Close:
Prepare 10 × TBS damping fluid (containing Tris24.23g, NaCl80.06g, HCl adjusts pH to 7.6 to 1L), then dilute 10 times with deionized water and obtain 1 × TBS, then the tween 20 adding 0.5% (v/v) is mixed with TBST.Get out 5% skimmed milk, 5g skimmed milk (industry Group Plc of inner mongolia Erie) is dissolved in 100mlTBST solution.After transferring film, take out pvdf membrane and load valve bag, pour 5% skimmed milk of 20ml into, secure with sealing machine, be placed on decolorization swinging table and shake 20 minutes, then go to 4 DEG C of refrigerator overnight and deposit.
Primary antibodie is hatched:
After taking out pvdf membrane from refrigerator, 1 × TBST is first used to wash 3 times, each 5 minutes.(Abcam company of Britain produces to take antibody KPNB1 by 1:1000 thinning ratio, ab22453) and 1:8000 thinning ratio take the GAPDH of antibody HRP conjugate (upper Haikang become company to produce, KC-5G5), join in 5mlTBST, shake up and namely obtain antibody working fluid.Film after washing is loaded valve bag, pours the antibody working fluid prepared into, the decolorization swinging table of middling speed running hatches 120 minutes.After primary antibodie has been hatched, if primary antibodie there has been horseradish peroxidase-labeled (antibody as internal reference Protein G APDH), then jump directly to development step, if do not have, then needed two to resist and hatch.
Two anti-hatch:
1 × TBST is first used to wash 3 times, each 5 minutes.Draw the rabbit immunoglobulin antibody (namely two resist, and CellSignalingTechnology company of the U.S. produces, and thinning ratio is 1:2000) of horseradish peroxidase-labeled, join in 5ml1 × TBST and shake up.Film after washing is loaded valve bag, and pour the two anti-working fluids prepared into, sealing machine seals, and shaking table shakes 120 minutes.
Development:
Two anti-hatch end after, wash 6 times with 1 × TBST, 3 times each 10 minutes, latter 3 times each 5 minutes.Get out developing solution, stop bath, tap water, film, development camera obscura during this period, scissors, toilet paper.Below operate in red globe lamp in development darkroom to complete under assisting.Draw 400 μ l development substrate A and B (Chinese Tian Gen biochemical technology company limited produces) mixing respectively, balance to room temperature.Pvdf membrane is placed on the clean valve bag internal surface cut off.Add rapidly development substrate, hatch 1-5 minute, if the visible obviously band of naked eyes, then stop hatching.Discard development substrate liquid, film is transferred in the valve bag cut off in three faces, close valve bag, carefully sops up unnecessary liquid with toilet paper, puts into development camera obscura, fix with insulation tape.Put film, after exposure certain hour (5 ~ 30 seconds), put into developing solution, stop bath successively each 20 seconds, then film is placed in clear water.Finally under tap water, clean film, dry, be scanned up to computer, obtain detected result.
After film after development washes 10 minutes with 1 × TBST, can be placed with in the valve bag of antibody elution damping fluid, the water-bath putting into 50 ~ 60 DEG C after sealing hatches 30 minutes.1 × TBST is used to wash 2 times again, each 10 minutes.Wash rear skimmed milk to close the step that can repeat above and detect other albumen as internal reference Protein G APDH.
The result of WesternBlot as shown in Figure 1, shows that RNA interfering that the present invention uses significantly can reduce the protein level of KPNB1.
Impact on U87 and U251 cell line proliferation after embodiment 4:MTT method detection interference KPNB1
Glioma U87 clone, purchased from cell institute of the Chinese Academy of Sciences.
In diameter 6cm culture dish, culturing cell is to about 30% degree of converging, and adds the virus infection particle (infection multiplicity is 10) of contrast slow virus infection particle and interference KPNB1 respectively, continues culturing cell 4 days.After use 96 orifice plates (production of Corning company of the U.S.) to cultivate, about 1500, every hole cell, every hole substratum 150 μ l.Respectively at time point as shown in Figure 3, every hole adds the MTT (production of Shanghai Sheng Gong bio-engineering corporation) that 15 μ l concentration are 5mg/ml and continues to hatch 4 hours.Then sop up culture, every hole adds 150 μ lDMSO, under the 490nm wavelength of microplate reader (Bio-Rad company of the U.S. produces, iMark168-1130 type), measure absorbancy.
Result as shown in Figure 2, shows to disturb KPNB1 obviously can suppress the growth of U87 and U251.
Embodiment 5: the impact on U87 and U251 cell line proliferation after clone forming method detection interference KPNB1
In diameter 6cm culture dish, culturing cell is to about 30% degree of converging, and adds the virus infection particle (infection multiplicity is 10) of contrast slow virus infection particle and interference KPNB1 respectively, continues culturing cell 4 days.After dispel as individual cells, with 6 orifice plates cultivate (production of Corning company of the U.S.), about 500, every hole cell.Cultivate 14 days, substratum is changed on demand in midway.Discard substratum afterwards, fix 30 minutes with ethanol, the violet staining of rear use 0.5%.
Colony formation result as shown in Figure 3, shows to disturb KPNB1 obviously can suppress the formation of U87 and U251 cell clone.Strike and subtract effect it is preferred that shKPNB1-2, shKPNB1-3.
Above-described embodiment is the present invention's preferably embodiment, but embodiments of the present invention are not restricted to the described embodiments.Other are any do not depart from the spirit of the present invention and principle under the distortion done, all should protection scope of the present invention be thought.
Claims (12)
1. targeted human KPNB1 gene specificity suppress a siRNA for KPNB1 genetic expression, and described siRNA is selected from siRNA-2 or siRNA-3, and the sequence of siRNA is as follows:
siRNA-2:
Positive-sense strand: 5 '-GGAAGUGUUGGGUGGUGAAUU-3 ' (SEQIDNO.3)
Antisense strand: 5 '-CCUUCACAACCCACCACUUAA-3 ' (SEQIDNO.4);
siRNA-3：
Positive-sense strand: 5 '-GGUGGACAAGUCAGACUAUGA-3 ' (SEQIDNO.5)
Antisense strand: 5 '-CCACCUGUUCAGUCUGAUACU-3 ' (SEQIDNO.6).
2. targeted human KPNB1 gene specificity suppress a shRNA sequence for KPNB1 genetic expression, and described shRNA sequence is selected from shRNA-2 or ShRNA-3, and shRNA sequence is as follows:
shRNA-2：
Positive-sense strand:
5’-
CCGGGGAAGUGUUGGGUGGUGAAUUCUCGAGAAUUCACCACCCAACACUUCCUUUUUUG-3’(SEQIDNO.9)
Antisense strand:
5’-
AAUUCAAAAAAGGAAGUGUUGGGUGGUGAAUUCUCGAGAAUUCACCACCCAACACUUCC-3’(SEQIDNO.10)；
ShRNA-3：
Positive-sense strand:
5’-
CCGGGGUGGACAAGUCAGACUAUGACUCGAGUCAUAGUCUGACUUGUCCACCUUUUUUG-3’(SEQIDNO.11)
Antisense strand:
5’-
AAUUCAAAAAAGGUGGACAAGUCAGACUAUGACUCGAGUCAUAGUCUGACUUGUCCACC-3’(SEQIDNO.12)。
3. transcribe a DNA sequence dna of shRNA described in claim 2, described DNA sequence dna is selected from the DNA of DNA or ShRNA-3 of shRNA-2:
The DNA of shRNA-2 transcribed plus chain:
5’-
CCGGGGAAGTGTTGGGTGGTGAATTCTCGAGAATTCACCACCCAACACTTCCTTTTTTG-3’(SEQIDNO.15)
The DNA of shRNA-2 transcribes anti-sense chain:
5’-
AATTCAAAAAAGGAAGTGTTGGGTGGTGAATTCTCGAGAATTCACCACCCAACACTTCC-3’(SEQIDNO.16)；
The DNA of ShRNA-3 transcribed plus chain:
5’-CCGGGGTGGACAAGTCAGACTATGACTCGAGTCATAGTCTGACTT
GTCCACCTTTTTTG-3’(SEQIDNO.17)
The DNA of ShRNA-3 transcribes anti-sense chain:
5’-
AATTCAAAAAAGGTGGACAAGTCAGACTATGACTCGAGTCATAGT
CTGACTTGTCCACC-3’(SEQIDNO.18)。
4. targeted human KPNB1 gene specificity suppress a recombinant vectors for KPNB1 genetic expression, containing, for example the siRNA of targeted human KPNB1 gene according to claim 1, or the shRNA of targeted human KPNB1 gene as claimed in claim 2.
5. as claimed in claim 4 targeted human KPNB1 gene specificity suppress KPNB1 genetic expression recombinant vectors, carrier is selected from plasmid, lentiviral vectors or adenovirus carrier.
6. as claimed in claim 5 targeted human KPNB1 gene specificity suppress KPNB1 genetic expression recombinant vectors, carrier is plasmid pLKD-CMV-GFP-U6.
7. the application of siRNA as claimed in claim 1 in preparation KPNB1 gene expression inhibitor.
8. the application of shRNA as claimed in claim 2 in preparation KPNB1 gene expression inhibitor.
9. the application of DNA sequence dna as claimed in claim 3 in preparation KPNB1 gene expression inhibitor.
10. a siRNA as claimed in claim 1 is preparing the application in antitumor drug.
11. 1 kinds of shRNA as claimed in claim 2 are preparing the application in antitumor drug.
12. 1 kinds of DNA sequence dnas as claimed in claim 3 are preparing the application in antitumor drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510651096.2A CN105132429A (en) | 2015-10-10 | 2015-10-10 | SiRNA targeted to human KPNB1 genes and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510651096.2A CN105132429A (en) | 2015-10-10 | 2015-10-10 | SiRNA targeted to human KPNB1 genes and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105132429A true CN105132429A (en) | 2015-12-09 |
Family
ID=54717998
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510651096.2A Pending CN105132429A (en) | 2015-10-10 | 2015-10-10 | SiRNA targeted to human KPNB1 genes and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105132429A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108096579A (en) * | 2017-12-18 | 2018-06-01 | 深圳先进技术研究院 | Using application of the c-Rel genes as target spot in the drug for preparing treatment rheumatoid arthritis |
| CN109718378A (en) * | 2017-10-31 | 2019-05-07 | 中国科学院上海生命科学研究院 | KPNB1 inhibitor and protein degradation approach restrainer application in preparation of anti-tumor drugs |
| CN109718377A (en) * | 2017-10-31 | 2019-05-07 | 中国科学院上海生命科学研究院 | KPNB1 inhibitor and Bcl-xL inhibitor application in preparation of anti-tumor drugs |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007072225A2 (en) * | 2005-12-01 | 2007-06-28 | Medical Prognosis Institute | Methods and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy |
| WO2010145796A2 (en) * | 2009-06-19 | 2010-12-23 | Merck Patent Gmbh | Biomarkers and methods for determining efficacy of anti-egfr antibodies in cancer therapy |
| CN103124795A (en) * | 2010-07-23 | 2013-05-29 | 哈佛大学校长及研究员协会 | Methods of detecting diseases or conditions using phagocytic cells |
| CN104603289A (en) * | 2012-06-15 | 2015-05-06 | 哈里·斯泰利 | Methods of detecting diseases or conditions |
-
2015
- 2015-10-10 CN CN201510651096.2A patent/CN105132429A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007072225A2 (en) * | 2005-12-01 | 2007-06-28 | Medical Prognosis Institute | Methods and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy |
| CN101365806A (en) * | 2005-12-01 | 2009-02-11 | 医学预后研究所 | Methods, kits and devices for identifying biomarkers of treatment response and use thereof to predict treatment efficacy |
| WO2010145796A2 (en) * | 2009-06-19 | 2010-12-23 | Merck Patent Gmbh | Biomarkers and methods for determining efficacy of anti-egfr antibodies in cancer therapy |
| CN103124795A (en) * | 2010-07-23 | 2013-05-29 | 哈佛大学校长及研究员协会 | Methods of detecting diseases or conditions using phagocytic cells |
| CN104603289A (en) * | 2012-06-15 | 2015-05-06 | 哈里·斯泰利 | Methods of detecting diseases or conditions |
Non-Patent Citations (5)
| Title |
|---|
| PEIZHOU LIANG ET AL.: "KPNB1, XPO7 and IPO8 Mediate the Translocation of NF-κB/p65 into the Nucleus.", 《TRAFFIC》 * |
| PINGYU ZHANG ET AL.: "EZH2–miR-30d–KPNB1 pathway regulates malignant peripheral nerve sheath tumour cell survival and tumourigenesis.", 《THE JOURNAL OF PATHOLOGY》 * |
| 成捷等: "miＲNA，lncＲNA 与心血管疾病", 《中国生物化学分子生物学报》 * |
| 曹木水等: "基于人类信号转导网络研究卵巢癌病变", 《生物物理学报》 * |
| 王楠等: "长非编码ＲNA(lncＲNA)与心血管疾病", 《生理科学进展》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109718378A (en) * | 2017-10-31 | 2019-05-07 | 中国科学院上海生命科学研究院 | KPNB1 inhibitor and protein degradation approach restrainer application in preparation of anti-tumor drugs |
| CN109718377A (en) * | 2017-10-31 | 2019-05-07 | 中国科学院上海生命科学研究院 | KPNB1 inhibitor and Bcl-xL inhibitor application in preparation of anti-tumor drugs |
| CN109718377B (en) * | 2017-10-31 | 2021-03-26 | 中国科学院脑科学与智能技术卓越创新中心 | Application of KPNB1 inhibitor and Bcl-xL inhibitor in preparation of antitumor drugs |
| CN108096579A (en) * | 2017-12-18 | 2018-06-01 | 深圳先进技术研究院 | Using application of the c-Rel genes as target spot in the drug for preparing treatment rheumatoid arthritis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ma et al. | MiR-23a promotes TGF-β1-induced EMT and tumor metastasis in breast cancer cells by directly targeting CDH1 and activating Wnt/β-catenin signaling | |
| Han et al. | MiR-101 inhibits the proliferation and metastasis of lung cancer by targeting zinc finger E-box binding homeobox 1 | |
| Wang et al. | Gankyrin promotes epithelial-mesenchymal transition and metastasis in NSCLC through forming a closed circle with IL-6/STAT3 and TGF-β/SMAD3 signaling pathway | |
| Yu et al. | ERBB2 gene expression silencing involved in ovarian cancer cell migration and invasion through mediating MAPK1/MAPK3 signaling pathway. | |
| CN105132429A (en) | SiRNA targeted to human KPNB1 genes and application thereof | |
| CN108553478B (en) | Application of septin gene shRNA in preparation of septin gene activity inhibitor | |
| CN110172462B (en) | Gene with promotion effect on generation and development of tumor, expression product and application thereof | |
| Ren et al. | Tumor protein D52 promotes breast cancer proliferation and migration via the long non-coding RNA NEAT1/microRNA-218-5p axis | |
| CN113908283A (en) | PRMT5 inhibitor and application thereof in combination with PD-L1 antibody blocking agent in treatment of lung cancer | |
| CN112359039A (en) | shRNA sequence expressed by targeted silencing BRD4 gene and application thereof | |
| CN103740726B (en) | The siRNA of targeted human CDKL5 gene and application thereof | |
| Wang et al. | Interaction of microRNA-21/145 and Smad3 domain-specific phosphorylation in hepatocellular carcinoma | |
| CN114672460B (en) | Preparation method and application of CD 44-targeted heterogeneous CIC cell model | |
| CN111575384B (en) | Application of human GLT8D1 gene in clinical diagnosis and treatment of tumor | |
| CN114703190A (en) | Application of ShRNA for targeted inhibition of KIAA1429 gene expression in chronic myelocytic leukemia | |
| CN117517657B (en) | Application of LNX1 gene or protein in regulation of avian innate immune response | |
| CN114075562A (en) | MAGE-C3 inhibitor and application thereof in preparation of drugs for treating and/or preventing esophageal squamous cell carcinoma | |
| CN110951880A (en) | Application of reagent for detecting lncRNA marker of hypopharynx cancer in preparation of product for diagnosing hypopharynx cancer | |
| CN106467914A (en) | The siRNA of targeting people's TSPAN8 gene and its application | |
| CN114561466B (en) | Application of FTO in diagnosis and treatment of osteosarcoma | |
| Liu et al. | Inhibition of X-linked inhibitor of apoptosis protein suppresses tumorigenesis and enhances chemosensitivity in anaplastic thyroid carcinoma | |
| Ruan et al. | Long noncoding RNA linc00665 stabilized by TAF15 impeded the malignant biological behaviors of glioma cells via STAU1 mediated mRNA degradation | |
| CN115287359B (en) | Application of MCOLN2 in colorectal cancer | |
| CN110241085A (en) | A kind of human bladder cancer's T24/DDP cell strain that NPM1 is knocked out | |
| CN107753956A (en) | A kind of targeted inhibition agent of RAX2 genes and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20151209 |