CN111575384B - Application of human GLT8D1 gene in clinical diagnosis and treatment of tumor - Google Patents

Application of human GLT8D1 gene in clinical diagnosis and treatment of tumor Download PDF

Info

Publication number
CN111575384B
CN111575384B CN202010551772.XA CN202010551772A CN111575384B CN 111575384 B CN111575384 B CN 111575384B CN 202010551772 A CN202010551772 A CN 202010551772A CN 111575384 B CN111575384 B CN 111575384B
Authority
CN
China
Prior art keywords
glt8d1
human
glioma
gene
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010551772.XA
Other languages
Chinese (zh)
Other versions
CN111575384A (en
Inventor
杨翠萍
陈勇彬
刘坤
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Kunming Institute of Zoology of CAS
Original Assignee
Kunming Institute of Zoology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Kunming Institute of Zoology of CAS filed Critical Kunming Institute of Zoology of CAS
Priority to CN202010551772.XA priority Critical patent/CN111575384B/en
Publication of CN111575384A publication Critical patent/CN111575384A/en
Application granted granted Critical
Publication of CN111575384B publication Critical patent/CN111575384B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A61K31/4188—1,3-Diazoles condensed with other heterocyclic ring systems, e.g. biotin, sorbinil
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/91—Transferases (2.)
    • G01N2333/91091—Glycosyltransferases (2.4)
    • G01N2333/91097—Hexosyltransferases (general) (2.4.1)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Organic Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Hospice & Palliative Care (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Food Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an application of human GLT8D1 gene in clinical diagnosis and treatment of tumor, namely, an application of human GLT8D1 gene expression quantity detection reagent in preparation of glioma clinical diagnosis reagent; the expression level of the human GLT8D1 gene is in positive correlation with the clinical grading of glioma, namely the human GLT8D1 gene expression profile can guide the clinical grading of glioma; experimental results show that GLT8D1 has higher expression than normal glial cells in a glioma cell line; after the GLT8D1 gene is knocked down, the proliferation of a glioma cell line is obviously inhibited, and the cell cycle is blocked in the G2/M phase; the expression of GLT8D1 is knocked down in a glioma cell line, so that the killing effect of a glioma clinical chemotherapeutic drug Temozolomide (TMZ) on tumor cells can be obviously increased; the invention reveals for the first time that the GLT8D1 gene is a potential risk gene of glioma, and the GLT8D1 gene is combined with a chemotherapeutic drug TMZ to strengthen the clinical chemotherapeutic effect of glioma.

Description

Application of human GLT8D1 gene in clinical diagnosis and treatment of tumor
Technical Field
The invention relates to a new application of a gene, in particular to a new application of a human GLT8D1 gene in clinical diagnosis and treatment of tumors, and in particular relates to an application of the human GLT8D1 gene in clinical diagnosis of glioma.
Background
Gliomas are the most common primary central nervous system tumors, accounting for about half of all intracranial primary tumors. According to the World Health Organization (WHO) 1999 classification scheme, it can be classified into neuroblastoma, astrocytoma, oligodendroglioma, ependymoma, hybrid glioma, and the like. Astrocytomas are the most common type of tumor among gliomas, with glioblastoma being the most malignant. About 5 to 6 out of 100000 people per year are diagnosed with primary malignant brain tumors, of which about 80% are malignant gliomas, of which more than 50% are glioblastomas. Glioblastomas have attracted considerable attention because of their high disability rate and high mortality rate. Although glioblastoma is abundant in treatment means, surgery excision is accompanied by radiotherapy and chemotherapy auxiliary treatment and the like, the life cycle of the glioblastoma is not longer than 12 months, and the prevention of glioblastoma is a century difficult problem expected to be solved by global medical treatment.
Glycosyltransferases catalyze the in vivo attachment of activated saccharides to various acceptor molecules, such as proteins, nucleic acids, oligosaccharides and lipids, and the glycosylated products have a number of biological functions and a high degree of substrate specificity, and are involved in the synthesis of sugar chains in important active substances in the body, such as glycoproteins and glycolipids, which function by transferring the monosaccharide moiety of the corresponding active donor (typically nucleoside diphosphate NDP-sugar) to the sugar, protein, lipid, nucleic acid etc., completing the glycosylation process of the latter and achieving its corresponding biological function. GLT8D1, glycosyltransferase 8 domain 1, is a glycosyltransferase that is more complex than ordinary glycosyltransferases and has an increased C-terminal structure that recognizes the unfolded protein (polypeptide) structure. It is present in most normal tissues of the human body, including brain tissue.
There is no report on the correlation of human GLT8D1 gene with glioma.
Disclosure of Invention
The invention aims to provide a new application of human GLT8D1 gene, namely, application of a human GLT8D1 gene expression level detection reagent in preparation of glioma clinical diagnostic reagents; the human GLT8D1 gene is used as a glioma-associated gene, and is applied to glioma detection, wherein the human GLT8D1 gene expression level detection reagent is a reagent for detecting the high expression level of the human GLT8D1 gene, namely the high expression level of the human GLT8D1 gene is used as a marker for diagnosing glioma.
Detecting the expression level of human GLT8D1 gene can utilize the human GLT8D1 gene sequence to design the primer sequence of human GLT8D1mRNA, and detect the level of human GLT8D1mRNA by a real-time quantitative PCR method; the primer sequences of the mRNA are as follows:
SEQ ID NO:1︰ACTTGCCAATTCTGGTTCCCA；
SEQ ID NO:2︰CGGATGACAACTTTAGTAGAGGC。
the expression level of the human GLT8D1 gene can be detected by a Western blotting method (Western Blot) and/or an immunohistochemical method, and antibodies required by the Western blotting method and/or the immunohistochemical method can be obtained by adopting a conventional technical means.
In view of the high expression of GLT8D1 in gliomas, another object of the present invention is to screen drugs for glioma treatment with the aim of inhibiting the high expression of human GLT8D1 gene.
Aiming at the phenotype of high expression of GLT8D1 in glioma, taking an action target of glioma, namely GLT8D1 gene, as an RNA interference action target, wherein the RNA interference action target is selected from the following nucleotide sequences:
SEQ ID NO:3︰AGCCAGCACTTGCTCATTTAA；
SEQ ID NO:4︰TCTCAGGAAGTCCTGGAAGAT。
cloning shRNA sequences inhibiting GLT8D1 gene expression into a lentiviral vector to obtain RNA interference lentivirus, and using the RNA interference lentivirus to infect glioma cells and then to serve as a cell line for detecting GLT8D1 therapeutic effect; the sequence for expressing shRNA comprises two inverted repeat sequences of the encoding DNA of the target GLT8D1 gene, and the two inverted repeat sequences are separated by a stem-loop sequence; wherein, the two inverted repeated sequences are respectively shRNA target sequences of GLT8D1 genes and complementary sequences thereof.
The sequence of the sense strand of the shRNA expression sequence is shown as SEQ ID NO. 5, and the sequence of the antisense strand is shown as SEQ ID NO. 6; or the sense strand sequence is shown as SEQ ID NO. 7 and the antisense strand sequence is shown as SEQ ID NO. 8.
Forward oligo:GLT8D1FO1(SEQ ID NO:5)
CCGGAGCCAGCACTTGCTCATTTAACTCGAGTTAAATGAGCAAGTGCTGGCTTTTTTG；
Reverse oligo:GLT8D1RO1(SEQ ID NO:6)
AATTCAAAAAAGCCAGCACTTGCTCATTTAACTCGAGTTAAATGAGCAAGTGCTGGCT；
Or alternatively
Forward oligo:GLT8D1FO2(SEQ ID NO:7)
CCGGTCTCAGGAAGTCCTGGAAGATCTCGAGATCTTCCAGGACTTCCTGAGATTTTTG；
Reverse oligo:GLT8D1RO2(SEQ ID NO:8)
AATTCAAAAATCTCAGGAAGTCCTGGAAGATCTCGAGATCTTCCAGGACTTCCTGAGA；
The invention discovers the relativity between GLT8D1 gene and glioma in research, and discovers that GLT8D1 is highly expressed in glioma through tumor chip staining results and network database analysis, and the expression level of GLT8D1 is positively correlated with pathological grading and negatively correlated with prognosis. Therefore, we found the sequence of human GLT8D1 through NCBI database, the nucleotide sequence of human GLT8D1 gene was found in genebank under gene accession number ID 55830, chr3:52694489-52705791 on chromosome 3, the mRNA sequence was found in NM-001010983.2, and CDS region sequence was shown in positions 903-2018.
Based on the sequence of GLT8D1, we found that GLT8D1 was indeed highly expressed in a plurality of glioma cell lines using real-time quantitative PCR and western blotting, so we transfected shRNAs targeting GLT8D1 into glioma cells, constructed stably transfected cell lines, and observed their proliferation capacity. We first assessed the knockdown efficiency of designed shRNA, and real-time quantitative PCR and western blot results showed that shRNAs reduced GLT8D1mRNA expression and protein expression, with significant differences compared to controls (P < 0.001). Interestingly, the number of BrdU positives in glioblastoma cells with knockdown GLT8D1 was significantly lower than in the control group, and the cells grew significantly slower than in the control group, with GLT8D1 overexpression, and vice versa. Further detecting the cell cycle distribution, finding that the expression of knock-down GLT8D1 can block cells in the G2/M phase, promote apoptosis of glioma cells, inhibit the capability of glioma cell nude mice to transplant tumor formation, reduce proliferation of glioma cells in vivo and promote apoptosis of glioma cells in vivo.
Intensive studies have found that cells with knockdown expression of GLT8D1 are more sensitive to temozolomide when treated with temozolomide, and that these glioma cells are more sensitive to temozolomide and more remarkable in apoptosis, and in vivo experiments in nude mice transplanted tumors further prove that the knockdown of GLT8D1 is expressed, and glioma is more sensitive to temozolomide, which indicates that methods or drugs for knockdown or inhibiting GLT8D1 expression can be used in combination with temozolomide in the future for treatment of glioma patients.
In summary, the experimental results showed that: GLT8D1 has regulatory effects on glioma cell proliferation, apoptosis and chemotherapy tolerance in vitro; after GLT8D1 gene knockdown, proliferation of tumor cells is obviously inhibited, apoptosis is obviously increased, and the tumor cells are more sensitive to chemotherapeutic drug temozolomide. The invention reveals that the GLT8D1 gene is a potential risk gene for glioma occurrence and development for the first time, and provides a new biomarker for glioma clinical diagnosis; it is clear that the combination of temozolomide with GLT8D1 expression can be reduced for glioma treatment.
The invention defines the relativity between the expression of GLT8D1 and glioma occurrence and development; and establishes that the combination of GLT8D1 expression and temozolomide is used for treating glioma, thereby having great application value and prospect.
Drawings
FIG. 1 shows the expression of human GLT8D1 in glioma patients; HE is hematoxylin-eosin staining, GLT8D1 is an antibody staining result specific to GLT8D1, and ii, iii, iv are glioma clinical staging conditions, respectively;
FIG. 2 shows the statistics of immunohistochemical detection of GLT8D1 expression in tumor tissue at different stages;
FIG. 3 is an analysis of the correlation between human GLT8D1 expression levels and overall patient survival;
FIG. 4 shows statistics of human GLT8D1 expression in tumor tissues of different stages in TCGA database;
FIG. 5 shows statistics of human GLT8D1 expression in tumor tissues of different stages in CGGA database;
FIG. 6 shows the results of measurement of the expression level of mRNA (upper panel) and protein (lower panel) in human GLT8D1 in normal glial cells (NHA), glioma-associated cell lines (U87 MG, U251, A172, 20180131, GSC11, 20171016B), beta-actin being an internal control of Western immunoblotting;
FIG. 7 shows the results of the detection of knockdown or over-expression of human GLT8D1 gene in glioma cell lines U251 and A172 to construct stably transformed cell lines: the left graph shows the mRNA and protein expression of the stably transformed cell line in U251 cells, and the right graph shows the mRNA and protein expression of the stably transformed cell line in A172 cells; in the figure, ctr shRNA is a scramble shRNA control cell line; g8dsh#1 is a stably transfected cell line knocked down GLT8D1 shrna#1; g8dsh#2 is a stably transfected cell line knocked down GLT8D1 shrna#2; pCDH-Vec is a control cell; G8D ove is a stable cell strain over-expressing GLT8D 1;
FIG. 8 is a statistical plot of cell growth results of stably transformed cell lines knocked down or overexpressed human GLT8D1 gene rescue GLT8D1 knockdown in glioma cell lines U251 and A172: panel A shows U251 cells, and Panel B shows A172 cells;
FIG. 9 is a statistical graph of the results of cell growth over-expressing the human GLT8D1 gene in glioma cell line U251;
FIG. 10 shows the results of BrdU incorporation experiments: panel A shows the result of BrdU immunofluorescence staining in the U251 stable cell line, and panel B shows the statistical results of BrdU positive cells in the U251 and A172 stable cell lines;
FIG. 11 shows cell cycle test results: the A diagram is the cell cycle flow detection result in the U251 stable transfer cell line, and the B diagram is the statistical result of the cell cycle in the U251 and A172 stable transfer cell lines;
FIG. 12 shows the result of western blotting of cell cycle related proteins;
fig. 13 is an apoptosis assay: the A diagram is the detection result of apoptosis flow in the U251 stable cell line, and the B diagram is the statistical result of apoptosis in the U251 and A172 stable cell lines;
fig. 14 is a nude mice transplantation neoplasia experiment of different stable strains at limiting dilution: panel A shows the tumorigenic status of stable transgenic cell lines with different transplantation amounts, and panel B shows the mouse tumorigenic statistical result of stable transgenic cell lines knocked down or overexpressed GLT8D1 gene;
FIG. 15 is a graph showing GLT8D1 knockdown response to Temozolomide (TMZ) chemotherapeutic drug;
FIG. 16 shows the results of apoptosis-related Western blotting of U251 stable transgenic cell lines after temozolomide treatment;
FIG. 17 is a graph showing response of different stable strains of nude mice transplanted tumor to Temozolomide (TMZ) chemotherapeutic drugs, wherein graph A shows a flow chart and nude mice transplanted tumor formation, and graph B shows statistical results of tumor mass and tumor volume;
fig. 18 shows immunohistochemical results for nude mice transplanted tumors of different stable transformants treated with temozolomide: panel A shows the results of immunohistochemical staining of cell proliferation marker Ki67 and apoptosis marker cleaved caspase3 (CC 3), and panel B shows the statistical results of the immunohistochemical staining of Ki67 and CC 3.
Detailed Description
The present invention will be described in further detail by way of examples, but the scope of the invention is not limited to the description, and the methods in the examples are conventional methods unless otherwise specified, and the reagents used in the examples are conventional commercially available reagents or reagents prepared by conventional methods.
Example 1: pathophysiological detection
The glioblastoma chip entrusts Shanghai core super company to implement immunohistochemical experiments, and analyzes the correlation between the high and low expression of GLT8D1 and clinical grading of glioma patients; the removed mouse tumor tissue was subjected to immunohistochemical staining and HE staining experiments autonomously by the present laboratory.
Immunohistochemical staining experiments were performed by fixing the tissue to be detected overnight with 4% PFA, rinsing the fixed tissue mass with running water for 30min;75% ethanol for 1h;80% ethanol for 1h;90% ethanol for 1h;95% ethanol I1 h;95% ethanol II for 1h;100% ethanol I1 h;100% ethanol II for 1h; xylene I for 35min; xylene II for 35min; wax dipping: paraffin I1 h; paraffin II for 1h; embedding the tissue into a mold for later use; freezing paraffin block at-20deg.C for 15min, slicing to 3 μm thickness, selecting complete and flat slice, spreading in hot water at 56 deg.C, and baking at 65deg.C for 30min; then, dyeing operation is carried out: 3 cylinders of dimethylbenzene, wherein each cylinder is used for 10min; absolute ethyl alcohol 2 cylinders, each cylinder for 2min;95% ethanol for 2min;85% ethanol for 2min;75% ethanol for 2min, flowing tap water for 2min; washing with distilled water for 2min; placing the sample into citric acid repairing liquid, performing antigen repairing for 25min by using an autoclave, removing a power supply for 10min, opening a cover of the autoclave, and taking out a container containing the citric acid antigen repairing liquid (containing the sample) from the container to normal temperature; washing the sample with distilled water for 1min; incubating for 20min with 3% hydrogen peroxide; drawing a sample in a circle by an oily pen, dripping PBS+1% Tween-20+10% normal goat serum on the surface of the sample in the circle, and sealing for half an hour; incubating the primary antibody; PBS was washed for 3min and repeated twice; PBS+1% Tween-20 for 3min; incubating the secondary antibody for 1h, washing with PBS for 3min, and repeating twice; PBS+1% Tween-20 for 3min; DAB color development is carried out for 5min; washing with distilled water for 1min; hematoxylin for 2-3min; washing with distilled water for 1min; differentiation of 1% hydrochloric acid alcohol for several seconds; bluing with distilled water for 2min;75% ethanol for 20s;85% ethanol for 20s;95% ethanol for 30s; absolute ethyl alcohol 2 cylinders, each cylinder for 30s; xylene for 2min, repeated twice; and (5) sealing the piece.
HE staining was as follows: the prepared slice is treated by xylene I for 5min; xylene II treatment for 5min;100% ethanol for 2min;95% ethanol for 2min;85% ethanol for 2min;75% ethanol for 2min; washing with tap water for 2min; washing with distilled water for 2min; hematoxylin for 5-10min; washing with tap water for 1min;1% hydrochloric acid alcohol differentiated for several seconds (visual redness is the degree); washing with tap water for 1min; bluing with warm water (50 ℃) for 5min; or bluing with 1% ammonia water for 30s, washing with tap water for 5-10min; distilled water for 1min;95% ethanol for 1min; eosin for several seconds. Serial gradient alcohol dehydration and transparency: 75% ethanol for 20s;85% ethanol for 20s;95% ethanol for 30s;95% ethanol for 30s;100% ethanol for 30s;100% ethanol for 30s. Xylene for 2min; xylene for 2min; and finally, sealing the sheet when the xylene is not dried.
As shown in fig. 1 and 2, the protein expression level of GLT8D1 was positively correlated with the grade of glioma, and the higher the grade, the higher the protein expression of GLT8D 1; protein expression in III and III-IV phases is higher than that in II and II-III phases, and protein expression in IV phase is higher than that in III and III-IV phases.
Example 2: bioinformatics analysis
Transcriptomics, clinical data, etc. of glioma patients were downloaded from TCGA database (www.cancergenome.nih.gov) and CGGA database (www.cgga.org.cn) and the correlation of GLT8D1 expression with clinical grade, survival, etc. of patients was analyzed.
As shown in FIG. 3, the expression of GLT8D1 is inversely related to the survival time, the survival time of the patient with high expression of GLT8D1 is short, and the survival time of the patient with low expression of GLT8D1 is long; FIGS. 4 and 5 show that in TCGA and CGGA databases, GLT8D1 expression is positively correlated with clinical grade in patients, and that the higher the grade, the higher the GLT8D1 protein expression.
Example 3: real-time quantitative PCR (polymerase chain reaction) detection of mRNA expression condition 1 of human GLT8D1 in normal glial cells and glioma cell lines and extraction of cellular RNA
Extracting RNA of normal glial cells (NHA) and glioma-related cell lines (U87 MG, U251, A172, 20180131, GSC11 and 20171016B) respectively;
2. reverse transcription reaction
Taking 1 mug of the extracted RNA for reverse transcription; the method comprises the following steps: removing genome DNA reaction, preparing a reaction mixed solution on ice according to a table, then sub-packaging the reaction mixed solution into each reaction tube, and finally adding RNA samples; gently mixing, and reacting at 42 ℃ for 2min;
Figure BDA0002542776450000061
placing the obtained reaction solution on ice, preparing a mixed Mix according to the following table, and then sub-packaging 10 mu L of the mixed Mix into each reaction tube;
Figure BDA0002542776450000062
carrying out reverse transcription reaction immediately after gentle mixing, wherein the reaction program is that the temperature is 37 ℃ for 15min;85 ℃,5s;4 ℃.
3、qPCR
Preparing a reaction system according to the following table, setting three repetitions of each sample, uniformly mixing, adding into a 96-well plate, sealing a film, and centrifuging to enable liquid to gather at the bottom of a pipe; real-time quantitative PCR reactions were performed according to the following conditions, with the following thermal cycling parameters: 50 ℃ for 2min;95 ℃ for 2min;95 ℃ for 10min;95 ℃,15s,60 ℃,1min,40 cycles; the primers for GLT8D1 used were: SEQ ID NO. 1: ACTTGCCAATTCTGGTTCCCA; SEQ ID NO. 2: CGGATGACAACTTTAGTAGAGGC.
Figure BDA0002542776450000063
Figure BDA0002542776450000071
As a result, the RNA expression of GLT8D1 was higher in tumor cells than in normal glial cells, as shown in the bar chart of FIG. 6 (upper panel).
Example 4: western Blot (Western Blot) for detecting expression of GLT8D1 protein in different cells
1. Extraction of cell total protein
The cells treated according to the specific experiment were discarded, and the supernatant medium was washed 1 time with PBS; adding corresponding cell lysate according to the amount of cell precipitation, repeatedly freezing and thawing and cracking on ice for 3 times, and continuously blowing during the period; centrifuging at 15000rpm/min at 4deg.C for 10min, collecting supernatant, and discarding precipitate for subsequent experiment;
2. adding 5 Xloading buffer solution after quantitative BCA protein, and placing in a metal dry heat instrument at 100 ℃ for boiling for 5min; taking out, packaging, and preserving at-80deg.C or directly performing polyacrylamide gel electrophoresis (SDS-PAGE); adding 30-50 μg protein into each hole, running out concentrated gel by electrophoresis under 80V voltage, and running out bromophenol blue by electrophoresis under 120V voltage. Transferring: placing the film rotating frame in film rotating liquid, wherein the black plastic plate faces downwards, the white color is upwards, a sponge cushion is placed above the black plate, and two pieces of filter paper are placed above the sponge cushion; gently taking off gel from an electrophoresis glass plate, then placing the gel on filter paper, placing PVDF film on the gel, placing two pieces of filter paper on the filter paper, placing a sponge cushion on the filter paper, fixing the black and white plastic plates firmly, and placing the black and white plastic plates in pre-cooled film transfer buffer solution; under ice bath condition, 83V voltage film transferring is carried out for 3h; putting the PVDF film into TBST containing 5% skimmed milk powder, slowly shaking on a shaking table, and sealing at room temperature for 2h; primary antibody diluted with TBST containing 3% bsa was added and incubated overnight with slow shaking at 4 ℃; TBST washing the membrane for 10min multiplied by 3 times; adding HRP-labeled secondary antibody and incubating for 2h at room temperature; TBST washing the membrane for 10min multiplied by 3 times; PVDF film was transferred onto a luminescent plate, ECL reagent (equal amount of mixing of solutions A and B before use) was added under light-shielding conditions, and developed and photographed.
As shown in the lower graph of FIG. 6, the protein expression level of GLT8D1 was higher in tumor cells than in normal glial cells.
Example 5: construction of GLT8D1 stable knockdown or over-expression cell lines
Constructing a GLT8D1 over-expression vector by using a lentiviral gene over-expression vector pCDH-MSCV-eGFP-3 xFlag, designing a PCR primer to amplify a coding region sequence of a human GLT8D1 gene, and cloning the coding region sequence into the over-expression vector, wherein the PCR primer is F ATGTCATTCCGTAAAGTAAAC and R TCACTTTATGTTTGAGATCTC, and the negative control is pCDH-MSCV-eGFP-3 xFlag; designing a shRNA target sequence according to a human GLT8D1 gene sequence by using a pLKO.1shRNA expression vector, synthesizing 2 pairs of oligonucleotide sequences, synthesizing a control oligonucleotide sequence at the same time, coupling the oligonucleotide sequences, cloning the coupled oligonucleotide sequences onto the pLKO.1 vector, and carrying out negative control on the sequence of the scrambleshRNA: GCACTACCAGAGCTAACTCAG; the 21bp shRNA sequence of the targeting GLT8D1 is shRNA #1: AGCCAGCACTTGCTCATTTAA; shrna#2: TCTCAGGAAGTCCTGGAAGAT. Packaging lentiviruses in tumor cell lines U251 and A172 by using HEK-293T cells and packaging plasmids, collecting culture medium supernatant for generating lentiviral particles, infecting target cells, and screening by using drug resistance marker puromycin contained on a carrier to obtain stable knockdown or over-expression cell strains; the culture medium for subculturing U251 and A172 cells is DMEM+10% FBS+1% penicillin/streptomycin;
as a result, as shown in fig. 7, the RNA level of GLT8D1 was lower than that of the control group cells (ctrshrna) in both the knockdown stably transformed cell lines (g8dsh#1 and g8dsh#2) of U251 or a 172; in the over-expressed stable cell line (G8 Dove), the RNA level of GLT8D1 was higher than that of the control cell line (pCDH-Vec); the protein expression level of GLT8D1 in knockdown stable transgenic cell lines (G8 Dsh#1 and G8 Dsh#2) was lower than that in control cell line (ctrshRNA), while the protein level of GLT8D1 in overexpressed stable transgenic cell line (G8 Dove) was higher than that in control cell line (pCDH-Vec).
Example 6: cell proliferation assay
Taking stable transgenic cell lines growing in logarithmic phase, preparing single cell suspension by digestion with 0.25% pancreatin, and measuring concentration; according to the required cell number U251: 1.5X10 4 well/A172:1.5X10 4 Well, preparing corresponding cell suspension into 12-well plate (1.0 mL/well) with complete culture medium, 37 deg.C, 5% CO 2 Culturing for 6 days; counting at the same time every day, and drawing a growth curve; the results are shown in FIG. 8: knockdown stably transfected cells U251 (panel a) and a172 (panel B) (g8dsh#1 and g8dsh#2) grew at a slower rate than the control group cells (ctrshrna), and the slow-growing phenotype of the knockdown cell line could be rescued by over-expression of GLT8D1 (g8dsh#2+g8dove); FIG. 9 shows comparison of cell growth rates of overexpressing stable transgenic cell lines (G8 Dove)The cells were pooled (pCDH-Vec) rapidly.
Example 7: brdU incorporation assay
Stable cell lines grown in logarithmic phase were prepared by digesting with 0.25% pancreatin to give single cell suspension, and measuring concentration at 3.5X10 per well 4 The total amount of cells was seeded into 8-well plates; adding BrdU (final concentration of 10 μm) into cell culture medium, incubating at 37deg.C for 20min, taking out, slightly rinsing with PBS, discarding supernatant, fixing with 4% paraformaldehyde at room temperature for 20min, washing with PBS for 1 time, adding 2N HCl-0.5% TrionX-100, incubating at room temperature for 30min, incubating with 1M NaHCO 3 After neutralization to no foam production, the cells were washed twice with PBS+0.1% Tween-20, incubated with 10% normal goat serum for half an hour at room temperature, washed twice with PBS+0.1% Tween-20, and then incubated overnight at 4℃with BrdU (1:1000 use) primary antibody. Washing 3 times with PBS+0.1% Tween-20 for 10min each time, adding fluorescent secondary antibody (1:1000 use) and DAPI (1:1000 use), incubating for 2h at room temperature in dark place, discarding unbound dye, washing three times with PBS+0.1% Tween-20 for 10min each time, adding PBS+0.1% Tween-20, preserving in dark place, observing with a microscope, photographing, and counting;
as a result, as shown in FIG. 10, in both the U251 cells and the A172 cells, the knockdown stably transfected cells (G8 Dsh#1 and G8 Dsh#2) had fewer positive cells incorporated by BrdU than the control cells (ctr shRNA).
Example 8: cell cycle assay
Removing supernatant of the culture medium when the stable knockdown cells grow to 80% coverage, washing once with PBS, digesting for 3min with 0.25% pancreatin 1mL, adding 5mL culture medium, stopping, blowing into single cell suspension, counting, and counting according to 5×10 per well 5 The U251 stable knockdown cell strain and the A172 stable knockdown cell strain are planted in a 6-hole plate by individual cells, three repeated holes are arranged on each sample, the mixture is gently mixed to ensure uniform cell distribution, and then the mixture is placed in a temperature of 37 ℃ and 5% CO 2 A carbon dioxide incubator; after 24h, the culture medium supernatant was removed, 2mL of serum-free medium was added to starve overnight, and the complete medium containing serum was replaced for release for 8h the next day; removing culture supernatant, washing with PBS once, digesting with 0.25% pancreatin for 3min, and adding 2mL cultureTerminating the base, gently blowing into single cell suspension; collecting cells into a centrifuge tube, and centrifuging at 1500rpm/min for 5min; adding 5mL PBS, washing once, centrifuging at 1500rpm/min for 5min, and repeating once; remove PBS liquid, resuspend cell pellet with 500. Mu.L PBS, note gentle; dropwise adding into a new centrifuge tube added with 4.5mL of precooled 70% ethanol, standing overnight at 4 ℃, taking out a sample from a refrigerator at 4 ℃, and centrifuging at 1500rpm/min for 5min; removing the fixing solution, adding 5mL of PBS for cleaning, centrifuging at 1500rpm/min for 5min, and repeating for one time; mu.L of PBS containing RNAase (1:500) and 0.1% trion X-100+5. Mu.L of PI solution were added to each tube for staining; detecting the change of the cell cycle by using a flow cytometer after 30min; analyzing the data, and drawing a cell cycle distribution diagram and a statistical diagram;
as a result, as shown in FIG. 11, the cell cycle was arrested in the G2/M phase in the knockdown stably transduced cells (G8 Dsh#1 and G8 Dsh#2) regardless of whether it was U251 cells or A172 cells. FIG. 12 shows that the expression of G2/M phase related proteins was up-regulated compared to the control (ctr shRNA) in knock-down stably transfected cells (G8 Dsh#1 and G8 Dsh#2), indicating that the cell cycle is arrested in the G2/M phase.
Example 9: apoptosis detection
When the U251 and A172 stable knockdown cells grow to 80% coverage, removing the culture medium supernatant, washing with PBS once, digesting for 3min with 0.25% pancreatin 1mL, adding 5mL culture medium to stop making single cell suspension, counting, and keeping the total cell volume 4×10 according to the volume of 2mL culture medium per hole 5 Or 6X 10 5 Respectively planting in 6cm culture dish, arranging three repeated holes for each sample, gently mixing to ensure uniform cell distribution, and placing at 37deg.C and 5% CO 2 After overnight in a carbon dioxide incubator for 24 hours, collecting culture medium supernatant, washing once with PBS, digesting for 3 minutes with 0.5mL of 0.25% pancreatin, and then adding 2mL of culture medium to terminate, blowing into single cell suspension, taking care of gentle blowing, and preventing cell injury apoptosis caused by mechanical force; collecting cells in a centrifuge tube, centrifuging at 2000rpm/min for 5min to collect apoptotic cells floating in the supernatant; removing supernatant, adding 5mL PBS, washing once, centrifuging at 2000rpm/min for 5min, and repeating once; according to the instruction of an Annexin V-APC/PI apoptosis detection kit, firstly addingThe cells were resuspended in 1 Xbinding buffer, three control-required cells (negative control, APC single-label control, PI single-label control) were removed, and then each tube of sample was added with 5. Mu.L of each of APC and PI to the cell suspension (control sample: no dye, only 5. Mu.L of APC, only 5. Mu.L of LPI were added), gently mixed; incubating for 30min at 37 ℃ in dark; detecting a change in the apoptosis ratio using a flow cytometer; the data are subjected to sorting analysis, and an apoptosis distribution diagram and a statistical diagram are drawn;
as a result, as shown in FIG. 13, in both U251 and A172 cells, the knockdown stably transformed cells (G8 Dsh#1 and G8 Dsh#2) had higher apoptosis than the control group (ctr shRNA).
Example 10: in vivo limiting dilution nude mouse tumorigenesis model
Will 10 5 、10 4 、10 3 、10 2 100 mu L of stable-rotation knockdown cells and control tumor cells of each U251 cell are respectively injected into the subcutaneous or armpit part of a BALB/c (nu/nu) nude mouse with the age of 5-6 weeks, the weight of tumors, the volume of tumors and the like at the inoculation part are monitored in real time, and a curve is drawn; after three months, when the tumor volume grows to a certain proportion, killing the nude mice, dissecting out tumor mass, recording and photographing;
as shown in fig. 14, in the case of limiting dilution, in knockdown stably transformed cells (g8dsh#1 and g8dsh#2), the transplantation tumorigenicity was lower than that of the control group (ctrshrna), while the overexpressing cells (G8D ove), the transplantation tumorigenicity was higher than that of the control group (pCDH-vec).
Example 11: GLT8D1 knockdown response to Temozolomide (TMZ) chemotherapeutic drug
When the U251 stable cell strain grows to 80% coverage, removing the supernatant of the culture medium, washing once with PBS, digesting for 3min with 0.25% pancreatin by 1mL, adding 5mL culture medium to stop to prepare single cell suspension, counting, and adding 4×10 per well of 2mL culture medium 5 The total amount of each cell is respectively planted in a 6cm culture dish, three repeated holes are arranged on each sample, the cells are gently mixed to ensure uniform distribution, and then the cells are placed in a culture dish with the temperature of 37 ℃ and the concentration of 5 percent CO 2 The carbon dioxide incubator was left overnight. After 24h, 200 mu M TMZ or DMSO (control) was added to each 6cm dish for 0h after the cells had grown wellAfter 48h, the culture medium supernatant was collected, washed once with PBS, digested for 3min with 0.25% pancreatin in 0.5mL, and terminated by adding 2mL of culture medium, and blown into single cell suspension, taking care of gentle blowing, and preventing apoptosis of cell injury due to mechanical force. The cells were collected in a centrifuge tube and centrifuged at 2000rpm/min for 5min to collect apoptotic cells floating in the supernatant. Removing supernatant, adding 5mL PBS, washing once, centrifuging at 2000rpm/min for 5min, and repeating once; detecting the change of the apoptosis proportion by using a flow cytometer according to the specification flow of an Annexin V-APC/PI apoptosis detection kit; the analysis data are arranged, and an apoptosis distribution diagram and a statistical diagram are drawn;
the results of fig. 15 show that apoptosis in knockdown stable transgenic cells (g8dsh#1 and g8dsh#2) is higher than that in control group (ctrshrna), and when knockdown stable transgenic cells (g8dsh#1 and g8dsh#2) were subjected to Temozolomide (TMZ), they showed that cells were more sensitive than those in control group (DMSO), and the number of apoptosis was significantly increased; the results of western blot in fig. 16 show that when knock-down stable transgenic cells (g8dsh#1 and g8dsh#2) were subjected to temozolomide treatment, the expression of apoptosis-related proteins (clear PARP, clear caspase3, bax 2) in the cells was significantly increased, while apoptosis-inhibiting protein (Bcl-2) was significantly decreased, indicating that knock-down stable transgenic cell lines (g8dsh#1 and g8dsh#2) after temozolomide treatment were more apoptotic and more sensitive to temozolomide.
Example 13: response experiment of nude mice transplanted tumor bodies of different stable strains to temozolomide curative drugs is 1.6X10 6 Stable transgenic knockdown cells of (2) and 1.5X10 6 Is injected into the groin of a BALB/c (nu/nu) nude mouse of 5 to 6 weeks old, and after about two weeks, the tumor volume is as long as 50mm 3 About, the inguinal injection was carried out weekly in accordance with the TMZ amount of 60mg/kg into mice; 5 times of injection, monitoring the weight and the volume of the tumor at the inoculation part in real time, and drawing a growth curve; after about 30-40 days, after the tumor volume grows to a certain proportion, killing the nude mice, dissecting out tumor mass, weighing and recording the tumor weight, and detecting the expression level change of apoptosis related proteins such as clear Caspase3, proliferation markers Ki67 and the like by using an immunohistochemical biochemical method;
the results of fig. 17 demonstrate that the grafts formed by knockdown stable cells (g8dsh#1 and g8dsh#2) in vivo are more susceptible to temozolomide than the grafts formed by control (ctrshrna) cells, both the size and the volume of the tumor are significantly smaller; the results in FIG. 18 show that in temozolomide-treated nude mice transplanted tumors, the expression of ki67 in tumors formed by knockdown stably transduced cells (G8 Dsh#1 and G8 Dsh#2) was significantly lower than in tumors formed by control (ctr shRNA) cells, whereas the expression of clear-caspase 3 (CC 3) was the opposite.
Sequence listing
<110> Kunming animal institute of China academy of sciences
Application of <120> human GLT8D1 gene in clinical diagnosis and treatment of tumor
<160> 11
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial sequence (Artifical)
<400> 1
acttgccaat tctggttccc a 21
<210> 2
<211> 23
<212> DNA
<213> Artificial sequence (Artifical)
<400> 2
cggatgacaa ctttagtaga ggc 23
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence (Artifical)
<400> 3
agccagcact tgctcattta a 21
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence (Artifical)
<400> 4
tctcaggaag tcctggaaga t 21
<210> 5
<211> 58
<212> DNA
<213> Artificial sequence (Artifical)
<400> 5
ccggagccag cacttgctca tttaactcga gttaaatgag caagtgctgg cttttttg 58
<210> 6
<211> 58
<212> DNA
<213> Artificial sequence (Artifical)
<400> 6
aattcaaaaa agccagcact tgctcattta actcgagtta aatgagcaag tgctggct 58
<210> 7
<211> 58
<212> DNA
<213> Artificial sequence (Artifical)
<400> 7
ccggtctcag gaagtcctgg aagatctcga gatcttccag gacttcctga gatttttg 58
<210> 8
<211> 58
<212> DNA
<213> Artificial sequence (Artifical)
<400> 8
aattcaaaaa tctcaggaag tcctggaaga tctcgagatc ttccaggact tcctgaga 58
<210> 9
<211> 21
<212> DNA
<213> Artificial sequence (Artifical)
<400> 9
atgtcattcc gtaaagtaaa c 21
<210> 10
<211> 21
<212> DNA
<213> Artificial sequence (Artifical)
<400> 10
tcactttatg tttgagatct c 21
<210> 11
<211> 21
<212> DNA
<213> Artificial sequence (Artifical)
<400> 11
gcactaccag agctaactca g 21

Claims (9)

1. Application of human GLT8D1 gene expression level detection reagent in preparation of glioma clinical diagnostic reagent.
2. The use according to claim 1, characterized in that: the human GLT8D1 gene expression level detection reagent is a reagent for detecting the high expression level of the human GLT8D1 gene.
3. The use according to claim 2, characterized in that: detecting the expression level of the human GLT8D1 gene, namely designing a primer sequence of mRNA of the human GLT8D1 by utilizing the gene sequence of the human GLT8D1, and detecting the level of the mRNA of the human GLT8D1 by a real-time quantitative PCR method; the primer sequences of the mRNA are as follows:
SEQ ID NO:1：ACTTGCCAATTCTGGTTCCCA；
SEQ ID NO:2：CGGATGACAACTTTAGTAGAGGC。
4. a use according to claim 3, characterized in that: the level of the human GLT8D1 gene expression level is positively correlated with glioma clinical classification.
5. The use according to claim 2, characterized in that: the detection of the human GLT8D1 gene expression level is to detect the protein level of human GLT8D1 by using a human GLT8D1 protein antibody and a western blotting method and/or an immunohistochemical method.
6. The application of the glioma therapeutic drug is screened aiming at inhibiting the expression of the human GLT8D1 gene.
7. The use according to claim 6, characterized in that: cloning shRNA sequences for inhibiting the expression of human GLT8D1 genes into a lentiviral vector to obtain RNA interference lentivirus, wherein the shRNA sequences are used for screening glioma therapeutic drugs and comprise two inverted repeat sequences of target human GLT8D1 gene encoding DNA, and the middle of the inverted repeat sequences are separated by a stem-loop sequence; wherein, the two inverted repeated sequences are respectively shRNA target sequences of GLT8D1 genes and complementary sequences thereof; the shRNA target nucleotide sequence of the GLT8D1 gene is selected from the following nucleotide sequences:
SEQ ID NO:3：AGCCAGCACTTGCTCATTTAA；
SEQ ID NO:4：TCTCAGGAAGTCCTGGAAGAT。
8. the use according to claim 7, characterized in that: the sequence of the sense strand of the shRNA expression sequence is shown as SEQ ID NO. 5, and the sequence of the antisense strand is shown as SEQ ID NO. 6; or the sense strand sequence is shown as SEQ ID NO. 7, and the antisense strand sequence is shown as SEQ ID NO. 8.
9. The application of a method or a medicine for knocking down or inhibiting the expression of human GLT8D1 genes in preparing medicines for increasing the sensitivity of glioma cells to chemotherapeutic drugs.
CN202010551772.XA 2020-06-17 2020-06-17 Application of human GLT8D1 gene in clinical diagnosis and treatment of tumor Active CN111575384B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010551772.XA CN111575384B (en) 2020-06-17 2020-06-17 Application of human GLT8D1 gene in clinical diagnosis and treatment of tumor

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010551772.XA CN111575384B (en) 2020-06-17 2020-06-17 Application of human GLT8D1 gene in clinical diagnosis and treatment of tumor

Publications (2)

Publication Number Publication Date
CN111575384A CN111575384A (en) 2020-08-25
CN111575384B true CN111575384B (en) 2023-06-02

Family

ID=72120159

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010551772.XA Active CN111575384B (en) 2020-06-17 2020-06-17 Application of human GLT8D1 gene in clinical diagnosis and treatment of tumor

Country Status (1)

Country Link
CN (1) CN111575384B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114480653B (en) * 2022-03-01 2023-11-21 中国科学院昆明动物研究所 Application of human MRGPRF gene in clinical diagnosis and treatment of tumor

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111529690B (en) * 2020-06-17 2023-03-31 中国科学院昆明动物研究所 New application of human CD133 protein 1-108 peptide fragment
CN111803497A (en) * 2020-09-02 2020-10-23 中国科学院昆明动物研究所 Application of lercanidipine drugs in preparation of drugs for treating human glioma

Also Published As

Publication number Publication date
CN111575384A (en) 2020-08-25

Similar Documents

Publication Publication Date Title
CN106591306B (en) Application of the siRNA of targeting interference tumour PTN-PTPRZ1 access in immunotherapy of tumors
CN108467891A (en) Applications of the SNHG5 in breast cancer diagnosis and assessment and outcome prediction
CN111718995B (en) Biomarker for nasopharyngeal carcinoma metastasis diagnosis and/or prognosis evaluation
CN107630027B (en) Preparation and application of medicine for over-expressing PCNP gene
CN111575384B (en) Application of human GLT8D1 gene in clinical diagnosis and treatment of tumor
CN113584173B (en) Application of lncRNA SLC25A21-AS1 AS esophageal squamous cell carcinoma marker
CN108660212B (en) Application of WDR1 gene in preparation of non-small cell lung cancer treatment and detection products
CN109055374A (en) Specificity inhibits shRNA and the application of OCT1 gene expression
CN111096962A (en) Application of fatty acid oxidation inhibitor in preparation of medicine for treating colorectal cancer
CN114672460B (en) Preparation method and application of CD 44-targeted heterogeneous CIC cell model
CN114703190B (en) Application of ShRNA for targeted inhibition of KIAA1429 gene expression in chronic myelocytic leukemia
CN110951880B (en) Application of reagent for detecting lncRNA marker of hypopharynx cancer in preparation of product for diagnosing hypopharynx cancer
CN109536639A (en) Application of the Epstein-Barr virus latent membrane protein in preparation nasopharyngeal carcinoma induction treatment diagnostic reagent
CN111529690B (en) New application of human CD133 protein 1-108 peptide fragment
CN114231529A (en) Human PKMYT1AR gene and application thereof
CN108949974B (en) Application of E3 ubiquitin ligase ASB3 in preparation of liver cancer treatment medicine
CN110607368B (en) Application of miRNA3926-1 gene as pancreatic cancer diagnosis and curative effect marker
CN108034719A (en) The application of GINS4 genes or GINS4 albumen as biomarker in the pre- diagnostic reagent for preparing adenocarcinoma of lung
CN108918874A (en) The MiR-210 experimental method that related target is predicted in glioma
CN114561466B (en) Application of FTO in diagnosis and treatment of osteosarcoma
CN112280859B (en) Breast cancer marker and application thereof
CN115786515B (en) Application of PDPN in HER2 positive gastric cancer diagnosis and treatment of lapatinib resistance
CN115058517B (en) Application of PRKD1 gene as non-small cell lung cancer diagnosis or prognosis marker
CN115976203B (en) Application of HAP1 in preparation of products for diagnosing, preventing and/or treating gastric cancer
CN109880828B (en) siRNA for interfering Mroh7 gene expression and application, interference method and medicament thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant