CN113755583A

CN113755583A - Method for researching METTL3 or 14 mediated m6A modification regulation and control of EC transfer

Info

Publication number: CN113755583A
Application number: CN202010493357.3A
Authority: CN
Inventors: 俞珏华; 程禹
Original assignee: Wuxi Zhunyin Biotechnology Co ltd
Current assignee: Wuxi Zhunyin Biotechnology Co ltd
Priority date: 2020-06-03
Filing date: 2020-06-03
Publication date: 2021-12-07

Abstract

The invention relates to a method for researching that METTL3 or 14 mediates m6A modification to regulate EC transfer, which comprises the following steps: 1) at the clinical level, the experimental study shows that METTL3/14, HNRNPG, m6A and ERAD7 express polymorphism in EC patients; 2) the applications of METTL3 and METTL14 in regulating m6A modification and HNRNPG function in tumor metastasis are experimentally researched in a cell model; 3) experimental study on the ability of METTL3/14 to influence the tumorigenicity and metastasis of EC tumor stem cells in a PDX mouse model. The invention has the advantages that: the molecular mechanism of regulating m6A modification level of METTL3/14 in EC stem cells to influence the combination of HNRNPG and target RNA, and influencing ERA variable shearing regulation and ERAD7 specific transcription product expression level can be researched, so that a new thought is provided for improving m6A modification level in EC and exploring potential treatment means.

Description

Method for researching METTL3 or 14 mediated m6A modification regulation and control of EC transfer

Technical Field

The invention relates to a method for researching a METTL3 or METTL14 mediated m6A modified regulation endometrial cancer transfer mechanism, and belongs to the technical field of biological medicines.

Background

Endometrial Cancer (EC) accounts for up to 6% of female tumors, the most common gynecological malignancy in the western world. The incidence of endometrial cancer is 15-20/100000 people per year, 89% of which occur in the age range of 65-59 years. Although 75% of patients are treated early, approximately 20% relapse after primary lesion excision. EC is largely divided into two types: estrogen-dependent form I, which refers to excessive exposure to estrogen deprived of progesterone regulation, is manifested by non-ovulating uterine bleeding, infertility, delayed menopause, obesity, endometrial hyperplasia, etc.; the non-estrogen dependent type II has no obvious symptoms and metabolic disorder, but has the characteristics of poor prognosis and easy transfer, and accounts for 10 to 15 percent of the whole EC, and the lethality accounts for 40 percent of the whole EC.

Median survival in patients with metastatic EC is only 7-12 months, and recurrent metastases of EC are closely associated with CD133+ EC tumor stem cells. Tumor stem cells (CSCs) are a rare but drug-resistant population of cells that continually renew themselves and produce differentiated tumor tissue, and are the major cause of tumor recurrence and metastasis. CSCs isolated from 32 human EC tumor tissues have strong self-renewal, clonogenic, and sequential tumorigenic capacities, and the magnitude of these capacities is positively correlated with the level of tumor grade. Therefore, the research aiming at the molecular mechanism of the EC tumor stem cells provides theoretical basis and new thought for the prevention and treatment of EC relapse and transfer.

In type I EC, loss of estrogen receptor alpha (ERA/ESR1) expression is often associated with incomplete differentiation of tumor tissue, suggesting poor survival; ERa variable cleavage products are expressed differently in normal and cancerous endometrial tissues; suggesting that the variable shearing product has different biological functions and may be related to the generation and development of tumors. There were 7 variable splicing mRNA products from the ERa gene previously reported (ERAD 1-D7): ERaD4 cannot bind to DNA or ligand by skipping exon 4 and thus does not function to activate estrogen-dependent downstream gene expression; ERaD3 and ERaD7 (skipping exons 3 and 7, respectively) have Dominant negative (Dominant negative) function that interferes with normal ERa function, but fails to activate ERa downstream transcription; ERAD5 can continuously activate the expression of the gene downstream of ERA without binding to the ligand. In normal and tumor endometrial tissues, ERaD4, D5 and D7 are expressed, ERaD7 is expressed in the cell proliferation phase, not the cell secretion phase, in the normal endometrium; ERaD7 is expressed in EC tissues in slightly differentiated tumors, but not in undifferentiated tumors. The protein encoded by ERAD7 loses its binding domain with hormone, and can regulate ERA and ERb in dominant negative phase. ERa exon 7 has binding sites for 2 mutually antagonistic splicing factors HNRNPG and HTRA2-BETA1, whose variable splicing is regulated by HNRNPG and HTRA2-BETA 1: HTRA2-b1 promoted retention of exon 7 during splicing, while HNRNPG antagonized HTRA2-BETA1, promoting skipping of exon 7 (elevated levels of ERAD 7).

HNRNPG is a member of the heterogeneous nuclear ribonucleoprotein family (hnRNPs), which have important biological functions in RNA processing, transcription, pre-mRNA cleavage, nucleoplasmic transport, translation and turnover of cytoplasmic mRNA. HTRA2-BETA1 belongs to arginine-serine rich proteins (arginine-serine rich proteins-SR proteins), and is another important protein type for regulating the splicing process besides hnRNP. The yeast two-hybrid experiment shows that HNRNPG and HTRA2-BETA1 can interact; HNRNPG and HTRA2-BETA1 antagonize each other in the variable splicing of muscle tissue expression genes α s-tropyosin and dystropin. These findings indicate that HNRNPG and HTRA2-BETA1 antagonize each other in other tissues, regulating the expression of certain mRNA isoforms, and thus the biological function of the protein. In tumors, HNRNPG is thought to have tumor-inhibiting function while HTRA2-BETA1 is thought to have tumor-promoting function (highly expressed in ovarian and breast cancers and its function depends on concentration and substrate binding sequence). In EC, HNRNPG and HTRA2-BETA1 are independent predictors of Progression Free Survival (PFS) in EC patients: patients with high levels of HNRNPG generally have a better prognosis, and the expression levels of HNRNPG in the nucleus are negatively associated with distant metastasis; HTRA2-BETA1 nuclear expression level is inversely correlated with tumor cell differentiation level and positively correlated with tumor lymphatic metastasis. Similar to other tumors, HNRNPG and HTRA2-BETA1 in EC as biomarkers may be predictive of opposite clinical outcomes. Similar to HNRNPG, high expression of ERAD7 mRNA predicts better progression-free survival in EC, and the specific mechanism may be related to HNRNPG promoting formation of ERAD7 and encoding dominant negative ERA inhibiting its downstream growth-related signaling pathway (AP-1, SP1, NF-kB, etc.). However, the specific molecular mechanism by which HNRNPG regulates ERa in EC has not been elucidated.

Binding of HNRNPG to RNA is regulated by m6A methylation modification. m6A (mRNA N6 is methylated) is the most common post-transcriptional modification on eukaryotic mRNA and lnRNA, is a hotspot of research in recent years, and is involved in various physiological or pathological processes such as cell differentiation, embryonic development, tumor progression and the like: such as obesity, neurological diseases, male reproductive ability, etc. The regulation of m6A levels, distribution and function in vivo is mediated primarily by "write proteins", "erase proteins" and "read proteins": the written protein comprises METTL3-METTL14-WTAP, and forms m6A modification on RNA; erasing proteins including FTO (fat mass and organism-associated protein) and ALKBH5 can remove m6A modifications on RNA; reading proteins, including YTH, can recognize m6A modifications and regulate translation of mRNA. Recent studies have used siRNA to silence METTL3, METTL14 and HNRNPG, respectively, in human cell models (HeLa and HEK293T), and found that HNRNPG tends to bind to and regulate expression of RNA with m6A modification via its C-terminal Arg-Gly repeat. The m6A modification in the HNRNPG binding sequence can change the spatial configuration of RNA, increasing the affinity of HNRNPG to the binding sequence, and the m6A modified HNRNPG binding sequence is present in most transcripts (13191 m6A modified HNRNPG specific sites). Comparison of the RNA-seq data of HNRNPG knockdown, METTL3, or METTL14 knockdown cells shows that the changes in the up-down and variable cleavage patterns of the gene following HNRNPG knockdown are similar to METTL3 or METTL14 knockdown, further demonstrating that the function of HNRNPG is regulated by METTL3-METTL14 mediated RNA methylation modification. In addition, studies in Nature Cell Biology indicate that: m6A levels were lower in 70% EC tumors than in normal adjacent tissues; a hot spot mutation (amino acid 298) that causes the dysfunction of METTL14 is present in about 1.5% of patients' tumor tissues; meanwhile, METTL3 was significantly reduced in most EC tumor tissues relative to control normal tissues and a reduction in METTL3 levels was positively correlated with increased mortality; selective knockdown of METTL14 or METTL3 in EC cell lines resulted in increased cell clonality, increased growth rate and increased invasive capacity. In breast cancer, the high expression of ALKBH5 caused by oxygen deficiency can promote m6A demethylation and the overall reduction of m6A modification level of mRNA, promote CSC formation and tumor progression, and indicate that the correlation between the reduction of m6A level and the degree of tumor malignancy is probably mediated by CSC.

Taken together, inactivating mutations of METTL14 and downregulation of METTL3 expression in EC patients can result in a reduced level of m6A modification on the overall mRNA, resulting in reduced affinity of HNRNPG to specific RNA sequences, thereby affecting RNA variable cleavage and mRNA expression. Because CSCs can differentiate into tumor tissue forming clones, inactivating mutations of METTL14 and METTL3 expression in most EC cells down-regulate to the original CSCs, while decreased levels of m6A in CSCs can lead to increased sternness. Consistent with HNRNPG, high expression levels of ERaD7 are predictive of a better prognosis for EC, and ERaD7 is a product of HNRNPG regulation of ERa variable cleavage.

Thus, it is presumed that: the reduced function of METTL14 or METTL3 in CSCs of EC may cause a reduction in m6A levels, reduced binding of HNRNPG to ERa seventh exon, resulting in a reduction in ERaD7 levels, resulting in activation of molecular signaling pathways downstream of ERa, resulting in increased CSC dryness, increased tumor malignancy, and promotion of EC metastasis.

The invention discloses a method for researching a METTL3 or METTL14 mediated m6A modified regulation EC transfer mechanism, which can provide a new idea for exploring a potential treatment means.

Disclosure of Invention

The invention provides a method for researching METTL3 or 14-mediated m6A modified regulation and control of EC transfer, and aims to fill the gap in the prior art and provide a new idea for exploring a potential EC treatment means.

The technical solution of the invention is as follows: a method of studying modulation of EC transfer by METTL3 or 14 mediated m6A modification comprising the steps of:

1) studies the polymorphisms expressed by METTL3, METTL14, HNRNPG, m6A, ERaD7 in EC patients at the clinical level;

2) the effects of METTL3 and METTL14 in regulating m6A modification and HNRNPG function in tumor metastasis are experimentally researched in a cell model;

3) the ability of regulating METTL3/METTL14 to influence the tumorigenesis and metastasis of EC tumor stem cells is experimentally researched in a PDX mouse model.

Preferably, the step 1) comprises:

collecting peripheral blood samples consisting of an experimental group and a control group and tissue samples consisting of fresh tissue samples and paraffin-embedded samples;

② measuring the m6A level in peripheral blood, fresh tissue and CSC cells;

③ separating the CSC cells in the EC tumor tissues;

fourthly, determining the mRNA expression levels of METTL3, METTL14, HNRNPG and ERAD7 in peripheral blood, fresh tissues and CSC;

determining the expression of METTL3, METTL14 and HNRNPG protein and the activation level of downstream AP-1, SP-1 and NF-kB pathways in fresh tumor tissues and separated CSC;

sixthly, determining the mRNA expression levels of METTL3, METTL14, HNRNPG and ERAD7 in the paraffin tissue sample;

seventhly, immunohistochemical staining or immunofluorescence staining for METTL3, METTL14 and HNRNPG in paraffin tissue samples;

and eighthly, carrying out data statistical analysis.

Preferably, the step 2) comprises:

grouping experimental cells, knocking down genes and carrying out over-expression treatment;

② carrying out cell proliferation test;

thirdly, carrying out a ball forming test;

fourthly, carrying out soft agarose cloning molding test;

fifthly, carrying out drug sensitivity test;

sixthly, carrying out cell migration and invasion tests;

seventhly, performing ultraviolet crosslinking ribonucleic acid (RNA) immunoprecipitation and ultraviolet crosslinking methylated RNA immunoprecipitation combined with RNA next generation sequencing and verification;

and eighthly, carrying out data statistical analysis.

Preferably, the step 3) comprises:

firstly, carrying out experimental grouping and cell processing;

secondly, constructing a primary tumor cell transplantation mouse model and performing transplantation experiments;

obtaining and analyzing tumor tissues;

analyzing and separating CSC flow type cells;

and fifthly, performing data statistical analysis.

The invention has the advantages that: three subjects were taken: EC tumor tissue samples, EC patient peripheral blood, EC tumor stem cell in vitro models, and EC model mice can study the regulation of m6A modification level in EC stem cells by METTL3 or METTL14 to influence the combination of HNRNPG and target RNA, and from which the molecular mechanism of ERA variable shearing regulation and ERAD7 specific transcription product expression level is influenced, and a new idea is provided for improving m6A modification level in EC to explore potential therapeutic means.

Drawings

FIG. 1 is a schematic view of example 1.

FIG. 2 is a schematic view of example 2.

FIG. 3 is a schematic view of example 3.

Detailed Description

The present invention will be described in further detail with reference to examples and specific embodiments.

A method of studying modulation of EC transfer by METTL3 or 14 mediated m6A modification comprising the steps of:

1) the clinical level experiments investigated the polymorphisms expressed by METTL3, METTL14, HNRNPG, m6A, ERaD7 in EC patients:

② measuring the m6A level in peripheral blood, fresh tissue and CSC cells;

③ separating the CSC cells in the EC tumor tissues;

and eighthly, carrying out data statistical analysis.

2) The effects of METTL3, METTL14 in regulating m6A modification and HNRNPG function in tumor metastasis were experimentally studied in cell models:

② carrying out cell proliferation test;

thirdly, carrying out a ball forming test;

fourthly, carrying out soft agarose cloning molding test;

fifthly, carrying out drug sensitivity test;

sixthly, carrying out cell migration and invasion tests;

and eighthly, carrying out data statistical analysis.

3) The ability of regulating METTL3/METTL14 to influence the tumorigenesis and metastasis of EC tumor stem cells is experimentally studied in a PDX mouse model:

firstly, carrying out experimental grouping and cell processing;

obtaining and analyzing tumor tissues;

analyzing and separating CSC flow type cells;

and fifthly, performing data statistical analysis.

Example 1

As shown in FIG. 1, the clinical level of the polymorphisms expressed by METTL3, METTL14, HNRNPG, m6A, ERAD7 in EC patients was investigated (WB: western blot hybridization; IHC: immunohistochemistry; IF: immunofluorescence)

1.1 conditions of entry

Peripheral blood samples:

experimental groups: in 18-70 years old female EC patients, primary tumors have no metastasis (n-20), primary tumors have distant metastasis (n-20), and recurrent tumors (n-20) are not treated (at the time of diagnosis) or are treated with radiotherapy or chemotherapy 7 days or more (based on the last treatment).

Control group: n is 60 for 18-70 years old healthy women, and the age is matched with the experimental group.

Both experimental and control groups need to satisfy the conditions: no other diseases (normal functions of important organs: heart, lung, liver, kidney and blood), no HIV, HBV and HCV infection, confirmation of HPV infection typing, no history of antibiotic use, no history of steroid/glucocorticoid use within 30 days, no acute infection, fever, no mental disease and no pregnancy.

Tissue sample:

fresh tissue samples: normal endometrial tissue n-5, primary EC tumor tissue n-5 (WHO typing G1), metastatic or recurrent EC tumor tissue n-5. The fresh tissue sample is mainly used for EC tumor stem cell separation, tissue m6A level determination and in-vitro mouse PDX model establishment.

Paraffin-embedded samples: the original sample of the tissue sample bank and the pathological sample of a newly-added patient during the test are adopted, the control group is matched with normal endometrial tissue, and n is 200 in total, and the tissue sample bank is sliced, immunohistochemistry and immunofluorescence staining is carried out.

All blood and tissue samples were obtained with informed consent and approved by the hospital ethics committee. The clinical information needs to be recorded in detail, including the height, weight, age, biochemical detection data, images, pathological typing (typeI or II), WHO typing, FIGO score, tumor size, ECOG score, whether metastasis occurs, whether lymph metastasis occurs, and the like of the patient.

1.2 determination of m6A levels in peripheral blood, fresh tissue, CSC cells

Trizol Total RNA extraction (reagents Sigma, centrifugation steps all at 4 ℃) was performed using 2ml of peripheral blood (EDTA anticoagulated or common Biochemical tubes): and (3) taking 150-250 mu l of whole blood, adding Trizol with the volume of 10 times, fully blowing, uniformly mixing, standing at room temperature for 5min, and centrifuging at 10000g for 10min to remove supernatant. Adding 200 μ l chloroform into 1ml volume, standing for 3min, centrifuging 12000g for 5min, transferring the upper water phase into 1.5ml EP tube, adding 500 μ l isopropanol, turning upside down, mixing for 10s, standing at room temperature for 10min, centrifuging 12000g for 10min, and discarding the supernatant. The precipitate was dried at room temperature for 5-10min, and 50. mu.l of RNase-free-water (Qiagen) was added to dissolve the RNA sufficiently, and the RNA concentration was determined using Nanodrop.

1/4 pea tissues are placed in a tissue homogenizer, 1.5ml of Trizol is added for full and uniform grinding, the mixture is transferred into a 2ml tube to be stood at room temperature for 5min, 10000g of the mixture is centrifuged for 10min, and the supernatant is removed. Adding 200 μ l chloroform into 1ml volume, standing for 3min, centrifuging 12000g for 5min, transferring the upper water phase into 1.5ml EP tube, adding 500 μ l isopropanol, turning upside down, mixing for 10s, standing at room temperature for 10min, centrifuging 12000g for 10min, and discarding the supernatant. The precipitate was dried at room temperature for 5-10min, and 50. mu.l of RNase-free-water (Qiagen) was added to dissolve the RNA sufficiently, and the RNA concentration was determined using Nanodrop.

A small number of CSC primary Cells (4000-20000) isolated from tumor tissues were used for whole RNA extraction (Cells to CT, Thermofeisher) of smaller samples, and the procedure was performed according to the manufacturer's instructions.

100-300 ng of whole RNA is used for detecting the m6A RNA modification level Abcam, ab185912), and the specific operation steps are carried out according to the instructions of the manufacturer.

1.3 isolation of CSC cells in EC tumor tissue

Fresh tumor tissue is separated into 1-2 mm by tissue scissors under aseptic operation³The small pieces of size were washed 3 times with sterile PBS, digested 2 times (15 min each) with 0.4% collagenic enzyme in a 37 ℃ water bath, and mixed 15 times with a pipette between digestions. The cell suspension after digestion was screened through a 40 μm cell sieve and then aseptically cultured in a petri dish (37 ℃ C., 5% CO)₂). Culture medium: DMEM (Sigma) + 1% Pen/Strep (diabody, Nacalai Tesque) + 1% L-glutamine + 20% FBS (calf serum, Biosera). When the cells were cultured to 70% -85% full, MACS (Magnetic-activated cell sorting) antibody cross-linked Magnetic column sorting was performed.

MACS: cells were digested with 0.25% Trypsin (thermo scientific) and resuspended in MACS solution (pH7.2 PBS + 0.5% BSA +2mM EDTA) at 4 ℃. The cell suspension was incubated for 30min on ice with CD 133-FITC-anti-ice (Miltenyi Biotec) according to the manufacturer's instructions and centrifuged at 1000g for 5min to remove the supernatant. The cell pellet was resuspended, the cells were resuspended using 100. mu.l (20. mu.l anti-FITC crosslinked beads + 80. mu.l MACS solution) of the magnetic bead solution, mixed well and incubated on ice for 15 min. After 3 washes with MACS solution, the cell suspension was placed in a disposable column attached to a magnet, where CD133 positive cells were adsorbed and first washed out as CD133^-Collecting cell suspension as control, removing magnet for the second time, and elutingComing is CD133⁺Cell suspension, which cells are subjected to secondary MACS screening for CXCR 4. The second screening step was as above, with CD133+ cells only, CXCR4-PE (Beckman coulter) as the primary antibody, and PE-resistant cross-linked magnetic beads as the secondary antibody. The final secondary elution yielded CSCs: CD133⁺；CXCR4⁺. Control group was CD133^-CXCR4^-(will CD 133)^-Cells negatively screened CXCR 4).

1.3 determination of mRNA expression levels of METTL3, METTL14, HNRNPG and ERAD7 in peripheral blood, fresh tissue and CSC

Mu.g of whole RNA was reverse transcribed using the Protoscript first strand cDNA Synthesis kit (NEB E6300L), and the reverse transcribed cDNA was subjected to fluorescent quantitative qPCR using SYBR green (TaKaRa, RR420L) or Taqman primer mix (ABI 7500). The PCR procedure was as follows: 1. initial denaturation 95C 4min, 2.35 cycles of amplification (a.94 ℃ C. for 1min, b.60 ℃ C. for 1min, c.72 ℃ C. for 1min),3. final extension (72 ℃ C. for 1 min). The fluorescent quantitative PCR result uses the matched software of the instrument to derive the target gene of the Delta CT-CT (beta-actin) internal reference, and calculates the difference of expression fold (fold 2-Delta CT) by using the Delta CT value of the experimental group and the control group. Wherein the variable shear level of ERaD7 is calculated using the ratio of ERaD 7/total ERa level, as calculated by the formula: ratio ═ E_target ^{ΔCt target(control–target)}/E_HKG ^{ΔCt HKG(control-HKG)}. HKG: housekeeping gene is an internal reference.

The specific detection genes are as follows:

stem cell markers SOX2, Nanog, OctA, internal reference beta-actin, major research genes METTL3, METTL14, HNRNPG and ERaD7, internal reference RPS 18.

Primers have been designed as follows:

SOX2：F:AGTCTCCAAGCGACGAAAAA R：GGAAAGTTGGGATCGAACAA

Nanog：F:CAGAAGGCCTCAGCACCTAC R:CTGTTCCAGGCCTGATTGTT

OctA:F:GAAGCTGGAGAAGGAGAAGCTG R:CAAGGGCCGCAGCTTACACATGTTC

β-actin：F:CGGGACCTGACTGACTAC R:GAAGGAAGGCTGGAAGAG

hnRNPG：F:GGAAGAGGGAGGAAGTGGAGG R:GGTCCCCTGGAAGAACTCAT

ERa：F：GAGGTGTACCTGGACAGCAG R:GGAGACACGCTGTTGAGTG

ERaD7:F:ATTTTGCTTAATTCTGTAACAAAGG R:CTAGTGGGCGCATGTAGG

RPS18:F:TACTCAACACCAACATCGATGGGC R:GCTTTCCTCAACACCACATGAGCA

1.4 determination of METTL3, METTL14, HNRNPG protein expression and downstream AP-1, SP-1, NF-kB and other pathway activation levels in fresh tumor tissues and separated CSC

And (3) separating cell membrane, cytoplasm and cell nucleus protein components in fresh tissues and the separated and cultured CSC by using a cell partition protein extraction kit, and quantifying the protein. And (3) carrying out qualitative and quantitative analysis on different groups of target proteins by adopting a Western hybridization technology: taking 5 mu g of protein per sample, running PAGE gel to separate proteins with different sizes, transferring the proteins onto PVDF or Natural cell Lulose membranes, sealing the membranes for 1 hour at normal temperature by using WB solution (PBS + 0.1% Tween 20+ 5% skim milk) antigen, adding primary antibody (1:1000) for overnight incubation at 4 ℃, washing the membranes for 3 times on the next day by using the WB solution, adding secondary antibody for incubation for 0.5 hour at normal temperature, washing the membranes for 3 times by using the WB solution, adding HRP (horse radish peroxidase) color developing solution for color development and X-ray negative film exposure. The primary antibody comprises METTL3, METTL14, HNRNPG, and marker proteins for resisting activation of ER downstream pathways, and the secondary antibody selects HRP to crosslink anti-primary anti-species IgG antibody. The films producing the bands were scanned and image analysis and band size, depth kurtosis quantification were performed using ImageJ software.

1.5 determination of mRNA expression levels of METTL3, METTL14, HNRNPG and ERAD7 in Paraffin tissue samples

Whole RNA was extracted from fixed, paraffin-embedded tissue samples using FFPE Kit (High Pure RNA paraffin Kit, Roche). RNA should satisfy R260/280>1.7 and show no excessive degradation (integrity test: 2100Access & spark Parts System, Agilent Technologies). The first extracted RNA was incubated with 2.0U DNase I (37 ℃ C., 45min) to remove possibly contaminating gDNA. Mu.g of RNA were used for reverse transcription into cDNA (M-MLV reverse transcriptase, Promega) using 10pM Random hexamer primers (NEB) in a 50. mu.l reaction system. The fluorescent quantitative PCR method, primers, and data analysis method are referenced 1.3.

1.6 immunohistochemical or immunofluorescent staining for METTL3, METTL14, HNRNPG in paraffin tissue samples

Immunohistochemical staining: 200 paraffin-embedded tissues are made into Tissue Microarray (TMA), and a slide glass can be provided with various samples and can be subjected to immunohistochemical staining simultaneously. EC TMA was stained with antibodies against METTL3, METTL14, HNRNPG (Santa Cruz,1:400), respectively, and the negative control was no primary antibody and only secondary antibody.

And (3) immunofluorescence staining: TMA is removed from wax and then subjected to immunofluorescence staining, and the staining comprises CSC markers (CD133:1:100, Novus Biologicals, CXCR4:1:500, Abcam and the like) and target proteins METTL3, METTL14, HNRNPG and the like, and the appearance frequency of the CSC among different samples, the expression levels of METTL3, METTL14 and HNRNPG in the CSC and the distribution position in cells are analyzed. Finally, representative proteins of several pathways downstream of ER are selected for staining, such as AP-1, NF-kB and the like.

All paraffin-embedded samples are 5-8 μm thick on a glass slide, and are subjected to paraffin removal and re-fixation before immunofluorescence or immunohistochemical staining. After three washes with 0.1% Triton-X100/PBS using 1% Triton-X100/PBS, antigen blocking was performed by adding 0.1% Triton-X100/5% FBS/PBS followed by 1 antibody overnight incubation (4C). The next day, 3 times of 1 elution was performed with 0.1% Triton-X100/5% FBS/PBS, 2 antibody was added and incubated at room temperature for 0.5h, and 3 times of elution was performed with 0.1% Triton-X100/5% FBS/PBS. Immunohistochemistry was performed by staining the post-sealing slides with the corresponding color developer (DABkit, Nichirei Biosciences) while counterstaining the post-sealing slides with haemal laun, immunofluorescence adding a sealing slide adhesive containing dapi. After drying in the dark, photographs were taken using a microscope (Confocal, Zeiss). The staining results were then analyzed by 3 pathologists/researchers with unknown tissue numbers for TMA, with intensity 0 (negative), 1 (weak positive), 2 (medium positive), 3 (strong positive), and the percentage of positive cells evaluated (1 unit at 10%) and protein staining locations labeled (cell membrane, cytoplasm, nucleus). At the same time, n-3 photographs were taken for different fields of view for each sample, and cell counting and image analysis were performed using ImageJ.

1.7 statistical analysis of data

Data analysis was performed using SPSS v.22.0. The classification variables are expressed by numbers or rates, and the continuous variables are expressed by mean + standard deviation; continuous variables were analyzed between groups by the method of t-test between groups, and classified variables were accurately tested by Fisher's test. The results of fluorescent quantitative PCR were combined with clinical pathology data analysis using Mann Whitney U test and Spearman's Correlation test. Immunohistochemistry, immunofluorescence data coupled with clinicopathologic data analysis used Krusk-Wallis H test, Ridit test and Spearman's Correlation test. Retrospective studies were performed for tissue sample providers, using Kaplan-Meier survival curves and Log rank test analysis for disease-specific survival (disease-specific survival) and Progression-free survival (Progression-free survival). The factor predictive analysis for multiple variables used the multiple variable Cox regression test. P <0.05 was considered to have significant differences for all tests.

Example 2

As shown in FIG. 2, the effects of METTL3, METTL14 in regulating m6A modification and HNRNPG function in tumor metastasis were studied in cell models

2.1 Experimental cell grouping and Gene knockdown, overexpression

Experimental grouping 1: CD133 isolated from fresh tumor tissue⁺CXCR4⁺Tumor stem cells, control group CD133^-CXCR4^-A tumor cell. Taking the tissue of a patient with n-3, wherein n-1 primary cancer is not metastasized, n-1 primary metastasized cancer is not metastasized, and n-1 recurrent cancer is obtained.

Experimental grouping 2 EC mode cells, 3 cell lines: ishikawa cells (university of Beijing pathology line); HEC-1A (Shanghai Med institute of sciences); RL95-2 cells (ATCC, Manassas, Va., USA).

Gene knockdown treatment:

group 1: CD133⁺CXCR4⁺/CD133^-CXCR4^-+siControl,CD133⁺CXCR4⁺/CD133^-CXCR4^-+siMETTL3,CD133⁺CXCR4⁺/CD133^-CXCR4^-+siMETTL14,CD133⁺CXCR4⁺/CD133^-CXCR4^-+siHNRNPG。

Group 2 Ishikawa/HEC-1A/RL95-2+ siControl, Ishikawa/HEC-1A/RL95-2+ sMETTL 3, Ishikawa/HEC-1A/RL95-2+ sMETTL 14, Ishikawa/HEC-1A/RL95-2+ siHNRNPG.

Gene overexpression treatment:

group 1: CD133⁺CXCR4⁺/CD133^-CXCR4^-+Vector，CD133⁺CXCR4⁺/CD133^-CXCR4^-+oeMETTL3,CD133⁺CXCR4⁺/CD133^-CXCR4^-+oeMETTL14,CD133⁺CXCR4⁺/CD133^-CXCR4^-+oeMETTL3+oeMETTL14

Group 2 Ishikawa/HEC-1A/RL95-2+ Vector,

Ishikawa/HEC-1A/RL95-2+ oeETTL 3, Ishikawa/HEC-1A/RL95-2+ oeETTL 14, Ishikawa/HEC-1A/RL95-2+ oeETTL 3+ oeETTL 14, which were treated experimentally by CSC per cell isolation and control cells CD133-CXCR 4.

The gene knockdown adopts Lipofectamine2000(Thermoscientific) to transfect siRNA, and the gene overexpression adopts Lipofectamine to transfect eukaryotic expression plasmid. Mixing 5X10³After 24 hours of culture in a single well of 24-well plates (medium DMEM/F12+ + 1% Pen/Strep + 1% L-glutamine + 20% FBS, Thermo Scientific), Lipofectamine2000 lipospheres containing siRNA or over-expression plasmids were added for transfection according to the manufacturer's instructions and the levels of knockdown or over-expression were checked after 48 hours using IF or WB.

2.2 cell Proliferation (Proliferation) assay

Mixing 5X10³Cells were cultured in single well of 24-well plates (medium DMEM/F12+ + 1% Pen/Strep + 1% L-glutamine + 20% FBS, Thermo Scientific) and cell counts were digested on days 2 and 12. Trypan blue (Beyotime) staining was performed before the technique to mark dead cells, and the number of live cells and dead cells was counted. Each experimental group was replicated three times with 3 wells each.

2.3 ball formation (Sphere formation) test

After culturing 1000 cells in one well of a 24-well plate (ultra low attachment, Corning) for 7 days (serum-free medium DMEM/F12+ 1% Pen/Strep + 1% L-glutamine, Thermo Scientific), whether clonal spheres are formed or not is observed, and the number, size and sphere morphology of the spheres formed in each well are counted under a microscope and are repeated three times in each experimental group, wherein 3 wells are repeated each time.

2.4 Soft agarose Colony modeling (Soft Agar Colony Formation) assay

2X10⁴Cells were added to 3mL of 0.4% Noble Agar (BD), mixed well, placed in a 60mm petri dish containing 5mL of 0.5% Bacto Agar (BD), and photographed using a microscope after culturing for 14 days. Any 10 fields per dish were photographed and the photographs were analyzed by ImageJ software. Clones with a diameter of more than 500 μm were counted analytically. Each experimental group was replicated three times with 3 wells each.

2.5 drug susceptibility test

Susceptibility testing was determined using the Cell Counting Kit-8(Dojindo, Japan) according to the manufacturer's instructions: mixing 5X10³After culturing the cells in one well of a 96-well plate for 24 hours, adding cissplatin and paclitaxel at different concentrations, and further culturing for 24 hours, 10. mu.l of CCK-8 solution was added to each well and the incubation was continued for 2 hours (37 ℃, 5% CO)₂). Cell viability was then determined by measuring the 450nm absorbance using a spectrophotometer (Filter Max F5, Molecular Devices). Each experimental group was replicated three times with 3 wells each.

2.6 Cell migration and invasion (Cell migration and invasion) assay

The cells were suspended in 200. mu.l of serum-free medium, cultured in the upper part of a 24-well cell culture chamber having a pore size of 8 μm (the chamber was previously plated with 500ng/ml Matrigel (BD) if the invasion assay was carried out, and the migration assay was carried out without pre-plating), and 600. mu.l of a medium containing 10% FBS was placed in the lower part of the chamber. 37 ℃ and 5% CO₂After 22h of culture (migration test) or 24h (invasion test). After removing the upper immobile cells using a cotton swab, the upper culture chamber was taken and subjected to crystal biolet (Solarbio Life Sciences) staining using 4% PFA fixed migrated or invaded cells. Any 10 fields were photographed under the microscope and image analysis and cell counting were performed using ImageJ software. Each experimental group was replicated three times with 3 wells each.

2.7 PAR-CLIP (Photoactivatable-amplified cross-linking-immunoprecipitation of UV cross-linked ribonucleic acid) and PAR-CLIP-MeRIP (PAR-CLIP-methylated RNA-immunopotentiation UV cross-linked methylation RNA immunoprecipitation) in combination with RNA next generation sequencing and validation

The PAR-CLIP procedure is based on published literature with corresponding modifications: cells were first harvested by 365nm UV irradiation on 8 15cm dishes (exchange the day before the experiment, with 100. mu.M 4SU added) and digested with 0.5% trypsin (thermo scientific), followed by lysis with NP 40. RNase T1 was added to the lysate, Protein-G magnetic beads crosslinked with anti-HNRNPG antibody were added, and the beads were separated with a magnet after incubation (shaking table) overnight at 4 ℃. The beads were washed 3 times with phosphate buffer and resuspended, and the RNA dephosphorylated by addition of bovine small intestine alkaline phosphatase (alkaline phosphatase). After washing the magnetic beads for 3 times, the crosslinked RNA is labeled by incubation with radioactive ATP and Polynucleotide kinase (Polynucleotide kinase). The protein-RNA complexes were separated and eluted using SDS-PAGE gel electrophoresis. After elution, the protein was digested with proteinase K and RNA was purified using phenol chloroform. A50-fold volume of H was added using RNaseI (AM2295, Ambion, 12. mu.l)₂O dilution) and Turbo DNase (2. mu.l) lysis and digestion (3min,37 ℃, shaker at 1100 rpm). The lysate was immediately centrifuged at 14000rpm in a 4 ℃ centrifuge for 30min and the supernatant was placed on ice until use. HNRNPG binding sites were analyzed using a PARalyzer v1.1 basis set.

PAR-CLIP-mediP A HNRNPG PAR-CLIP RNA sample was co-immunoprecipitated using anti-m 6A antibody: HNRNPG PAR-CLIP RNA was incubated with anti-m 6A specific antibody (202003, SYSY), RNase inhibitor (80U, Sigma-Aldrich), human placental RNase inhibitor (NEB) in 200. mu.l of 1XIP buffer (50mM pH7.4 Tris-Cl,750mM NaCl, 0.5% (v/v) Igepal CA-630) with gentle shaking at 4 ℃ for 2 h. Protein A magnetic beads (10002D, Thermo Scientific, 20. mu.l/sample) were washed 2 times with 1ml 1XIP buffer, blocked with 100. mu.l (1XIP buffer +0.5mg/ml BSA + Nase inhibitor + human placental RNase inhibitor) of antigen at room temperature for 2h, and washed 2 times with 100. mu.l 1XIP buffer for use. The previously blocked Protein A magnetic beads were added to the co-immunoprecipitated RNA sample obtained in the previous step, and after further incubation at 4 ℃ for 2h, the sample was washed 3 times with 100. mu.l of 1XIP buffer, and then 20. mu.l of an eluent (1XIP buffer +6.7mM m6A, Sigma) was added and incubated gently for 1 h. The eluted and dissolved RNA was purified by using an alcohol precipitation method. The purified RNA is subjected to next step of library construction or qPCR verification.

High-throughput sequencing: PAR-CLIP-meriP RNA was pooled using TruSeq Small RNA pooling kit (RS-200-0012, Illumina), and single-end 50bp high throughput sequencing was performed using Illumina HiSeq 4000. After the original sequence was subjected to tag sequence elimination by means of a trimmatic computer program v0.30, the sequence was aligned to the human genome hg19 using Bowtie software. And counting, statistically analyzing, charting and generating a site list for reads.

qPCR verification: after reverse transcription, PAR-CLIP-meriP RNA was subjected to qPCR using primers that discriminate ERAD7 and no ERA variable cleavage, as described in 1.3. It was determined that regulation of ERa variable cleavage by HNRNPG was mediated through m 6A.

2.8 statistical analysis

Data analysis was performed using SPSS v.22.0. The classification variables are expressed by numbers or rates, and the continuous variables are expressed by mean + standard deviation; continuous variables were analyzed between groups by the method of t-test between groups, and classified variables were accurately tested by Fisher's test. P <0.05 was considered to have significant differences.

Example 3

As shown in FIG. 3, the ability of modulating METTL3/METTL14 to affect the tumorigenesis and metastasis of EC tumor stem cells was investigated in a PDX mouse model

3.1 Experimental grouping and cell processing

Experimental group 1:

selection of previously Primary isolated EC tumor Stem cells (CD 133)⁺CXCR4⁺) METTL3/METT14 knockdown a.CD133⁺CXCR4⁺+pLenti-shRNAcontrol；b.CD133⁺CXCR4⁺+pLenti-shMETTL3；c.CD133⁺CXCR4⁺+pLenti-shMETTL14

Overexpression:

a.CD133⁺CXCR4⁺+pLenti-oeGFP；b.CD133⁺CXCR4⁺+pLenti-oeMETTL3；c.CD133⁺CXCR4⁺+pLenti-oeMETTL14；d.CD133⁺CXCR4⁺+pLenti-oeMETTL3+14

control group 1:

knock-down a.CD133^-CXCR4^-+pLenti-shRNAcontrol；b.CD133^-CXCR4^-+pLenti-shMETTL3；c.CD133^-CXCR4^-+pLenti-shMETTL14

Overexpression:

a.CD133^-CXCR4^-+pLenti-oeGFP；b.CD133^-CXCR4^-+pLenti-oeMETTL3；c.CD133^-CXCR4^-+pLenti-oeMETTL14；d.CD133^-CXCR4^-+pLenti-oeMETTL3+14

experimental group 2:

2 of the 3 EC cell lines in the previous experiment, such as Ishikawa cells, are selected, and the knockdown and overexpression experiments are repeated to study whether Ishikawa can simulate the in vivo experimental results of primary cells or can be used as a classical model cell for in vitro molecular and biochemical studies.

Cell treatment: since cells were treated for in vivo experiments, shRNA and oe expression vectors were encapsulated with Lentivirus (Lentivirus), for met 3/met tl14 overexpression to boost m6A levels to increase the affinity of HNRNPG at ERa seventh exon, Tet-On tetracycline-induced lentiviral vectors were used for tetracycline-dosing induction (jiman biotechnology, shanghai). Experimental method for lentivirus transfection of suspension cells at 2X10⁵Adding polybrene to 6 mug/ml of suspension cells and a proper amount of virus into the suspension cells, and fully and uniformly mixing. Incubation was performed at 37 ℃. Or 150g for 4 hours at room temperature (as part of the cell lines that are difficult to transfect may be used to increase transfection efficiency). 2. (selection of cells sensitive to polybrene toxicity for this step) 4 hours later (or after centrifugation) an equal volume of fresh medium was added to dilute the polybrene. 3. And (5) continuing to culture for 3-4 days (if the vector is a Tet-On vector, adding medicine to induce expression for 48 hours after 1 day of culture). The intermediate can be passaged or changed according to the growth condition of the cells. Whether lentivirus-mediated knockdown, overexpression or drug-induced overexpression (tetracycline medium administration of 6. mu.g/ml) is successful or not is verified by IF, WB and the like, and the lentivirus expression efficiency is confirmed.

3.2 Primary tumor cell transplantation (Patien-derived xenoraft-PDX) mouse model construction and transplantation experiment

The male immunodeficiency Nude mice of 6-8 weeks old are bred in a pathogen-free animal room (high cleanliness). Mice were injected subcutaneously with 1X10 separately²，1X10³，1X10⁴，1X10⁵Cells of experimental and control groups were examined for tumor formation at 12 weeks post-injection, such as tumor size (maximum diameter), tumor weight, whether metastasis occurred, and the percentage of CSCs in the tumor, and the optimal neoplastic cell concentration was first determined. Concentration determination thereafter tumorigenic experiments were performed using METTL3, METTL14, HNRNPG siRNA treated cells and control siRNA treated cells.

In examining whether induced overexpression of METTL3/METTL14 could reverse the EC induced by the experimental group cells, tetracycline 2mg/ml was administered with water 4 weeks after cell injection into mice, and tumor tissues were harvested at 12 weeks for corresponding analysis.

For CSC sequential tumorigenesis experiments, the CSC separated by MACS (see 1.3) or FACS (see 3.4) in 12-week tumor tissues of the first PDX mice was 1X10²，1X10³Reinjecting the obtained product into subcutaneous male Nude mice with the concentration of 6-8 weeks, harvesting tumor tissues after 12 weeks for corresponding analysis, continuously separating CSC for a new round of Nude mouse transplantation, and repeating 3 rounds in this way, namely P0 PDX mice->P1 CSC transplantation mice>P2 CSC transplantation mice>P3 CSC transplanted mice.

All animal experiments need to be subject to animal ethical approval, and the weight and survival data of the mice are recorded every week.

3.3 tumor tissue acquisition and analysis

After 12 weeks of subcutaneous implantation of cells into mice (when tumors were lethal and the death time was less than 12 weeks from the start of the experiment, tumor tissue was harvested at the time of death), experimental mice were euthanized, sterilized with iodophor at the site of cell injection, skin and subcutaneous tissue were cut using sterile tissue dissecting scissors, tumor tissue was exposed, tumor tissue was carefully dissected, three sides were washed in PBS, surface moisture was carefully wiped off using Kimwipe, weighing was performed with a balance, and the number, weight, and maximum diameter of subcutaneous tumors were recorded for each mouse by taking photographs (with a scale attached beside) with a camera. The abdomen of the mouse is cut open by a dissecting scissors, whether tumors are transferred to the abdominal cavity or not is observed, if yes, the tumor tissues are dissected carefully, the number, the weight and the maximum diameter of the tumors are recorded according to the steps, and a picture is taken.

3.4 CSC flow cytometry analysis and isolation

Fresh tumor tissues are harvested from experimental mice, washed 3 times with PBS, and decomposed into 1-2 mm tumor tissues by using tissue scissors³The digestion was performed after the small blocks (see 1.3). Suspension of cells in PBS (1X 10 per sample)⁶Individual cells) were washed 3 times, antigen blocked with PBS + 3% BSA for 30min, and primary antibody with cross-linked fluorophores was added for incubation staining at 4 ℃ (anti CD133-FITC, Miltenyi Biotec; anti CXCR4-PE, Beckman Coulter)30 min. The stained cells were washed 2 times with PBS and resuspended. Flow cytometry (BD) was performed using FACS Diva or cells were sorted in PBS buffer containing 15% FBS for mouse cell transplantation experiments.

3.5 statistical analysis

Data analysis was performed using SPSS v.22.0. The classification variables are expressed by numbers or rates, and the continuous variables are expressed by mean + standard deviation; continuous variables were analyzed between groups by the method of t-test between groups, and classified variables were accurately tested by Fisher's test. For the survival curves of the mice, Kaplan-Meier survival curves and Log rank test were used for the analysis. P <0.05 was considered to have significant differences.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various changes and modifications can be made without departing from the inventive concept of the present invention, and these changes and modifications are all within the scope of the present invention.

Claims

1. A method for researching that METTL3 or 14 mediates m6A modification to regulate EC transfer is characterized by comprising the following steps:

2. The method for studying METTL3 or 14-mediated m6A modification regulated EC transfer as claimed in claim 1, characterized in that said step 1) comprises:

② measuring the m6A level in peripheral blood, fresh tissue and CSC cells;

③ separating the CSC cells in the EC tumor tissues;

and eighthly, carrying out data statistical analysis.

3. The method for studying METTL3 or 14 mediated m6A modification regulated EC transfer as claimed in claim 1, characterized in that said step 2) comprises:

② carrying out cell proliferation test;

thirdly, carrying out a ball forming test;

fourthly, carrying out soft agarose cloning molding test;

fifthly, carrying out drug sensitivity test;

sixthly, carrying out cell migration and invasion tests;

and eighthly, carrying out data statistical analysis.

4. The method for studying METTL3 or 14 mediated m6A modification regulated EC transfer as claimed in claim 1, characterized in that said step 3) comprises:

firstly, carrying out experimental grouping and cell processing;

obtaining and analyzing tumor tissues;

analyzing and separating CSC flow type cells;

and fifthly, performing data statistical analysis.