CN110904145A

CN110904145A - Method for cultivating tomato resisting TYLCV virus, vector and application thereof

Info

Publication number: CN110904145A
Application number: CN201911156203.9A
Authority: CN
Inventors: 陈克贵; 彭梅芳; 高永峰; 范晓丽; 纳顺贵
Original assignee: SAAS BIOTECHNOLOGY AND NUCLEAR TECHNOLOGY RESEARCH INSTITUTE; Chengdu Yinong Agriculture Technology Co ltd
Current assignee: CHENGDU YINONG AGRICULTURAL TECHNOLOGY Co.,Ltd.; SAAS BIOTECHNOLOGY AND NUCLEAR TECHNOLOGY Research Institute
Priority date: 2016-06-29
Filing date: 2016-06-29
Publication date: 2020-03-24
Also published as: CN106119278B; CN106119278A

Abstract

The invention provides a method for cultivating tomato resisting TYLCV virus, which comprises the following steps: 1) providing a DNA sequence comprising a coding sequence for an endonuclease system, wherein the endonuclease system comprises a targeting moiety and an endonuclease active moiety, wherein the endonuclease active moiety does not itself have the function of recognizing a specific nucleic acid sequence, and is capable of specifically cleaving a DNA molecule of the TYLCV virus under the action of the targeting moiety; and 2) inserting DNA comprising the coding sequence of the endonuclease system into the genome of the tomato by a transgenic method, so that the tomato expresses the endonuclease system, thereby enabling the tomato to obtain the capability of resisting the TYLCV virus. The invention also provides a vector for use in the method and uses of the vector. Tomato varieties with the capacity of resisting TYLCV virus are successfully obtained by using the method.

Description

Method for cultivating tomato resisting TYLCV virus, vector and application thereof

The application is a divisional application of Chinese patent application No.2016105141842, which has an application date of 2016, 6 and 29 and is named as a method for cultivating tomato resisting TYLCV virus, a vector and application thereof.

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to a method for cultivating tomato resistant to TYLCV virus, a vector and application thereof.

Background

Tomato (Lycopersicon esculentum Mill.) is an important vegetable that is popular, but is highly susceptible to Tomato Yellow Leaf Curl Virus (TYLCV) during Tomato growth. TYLCV belongs to the genus Phaseolus (Begomovirus) of the family Geminiviridae (Geminiviridae), and the viral genome is a single-stranded circular DNA of 2.7-2.8kb, sometimes accompanied by satellite virus. The symptoms after tomato is infected with virus mainly include leaf rolling, leaf margin and leaf vein yellowing, and finally leaf blade reduction, plant dwarfing and the like. TYLCV is widely popular in China and tomato producing areas in the world, has great influence on the yield and quality of tomatoes, and often causes serious loss to the tomato production and even causes the failure of production and harvest. TYLCV is transmitted by Bemisia tabaci (Bemisia tabaci) under natural conditions. The bemisia tabaci has strong fecundity and wide hosts, almost covers all common crops such as vegetables, various flowers and the like, and is difficult to limit the TYLCV in one place and prevent the TYLCV from spreading and diffusing. TYLCV was discovered in Israel as early as 1930 and is currently found in all tomato producing areas of the world. Therefore, the cultivation of excellent varieties of the anti-TYLCV is a main way for eliminating the harm of the TYLCV.

In recent years, site-directed and site-directed modification of plant genomes has been successfully achieved by constructing artificial nucleases through recombination to cut genomic DNA at a site. The Zinc Finger Nuclease (ZFN) is the first to appear, and the ZFN technology recognizes a specific DNA sequence through a Zinc finger domain of a Zinc finger protein, and recombines with a nuclease active domain of a type II restriction enzyme fokl to construct an artificial recombinant Zinc finger nuclease. The recombinant zinc finger nuclease binds to a specific genomic DNA site through its zinc finger domain, and then the nuclease active domain from fokl is able to cleave DNA near the site.

In 2012 shortly after ZFNs, Transcription activator-like effector nucleases (TALEN technology) appeared. Based on the principle similar to ZFN, the functional domain of TALE (Transcription activator-like effector) protein for specifically recognizing DNA base and the enzyme cutting active domain of FokI nuclease are combined to synthesize recombinant protein (TALE nucleotides, TALEN). Thus, TALEs have the ability to specifically recognize a specific DNA site in the genome, and the nuclease-active domain of fokl can cut DNA near that site. Unlike ZFNs, TALENs are more prone to artificially alter their ability to recognize and bind DNA base sequences, thereby designing recombinant nucleases that cleave different DNA sites in the genome.

By 2013, another technique has emerged that can cleave genomic DNA, i.e., CRISPR/Cas (clustered regulated interspersed short palindromic repeats/CRISPR-associated proteins). CRISPR/Cas is an adaptive immune defense system present in bacteria and archaea, specifically to combat the foreign DNA of bacteriophages invading the bacteria. The CRISPR/Cas system destroys invading phages by integrating fragments of the phage DNA of the invading bacteria into the CRISPR and using the corresponding CRISPR RNAs (crRNAs) to direct the degradation of the phage foreign DNA homologous sequences of the invading bacteria. By the principle, one of the CRISPR/Cas9 is developed for cutting the genome DNA of higher organisms. The functions of the method are the same as those of the ZFN technology and the TALEN technology, but the method is simpler and more convenient to operate and more flexible to use. In 2015, a new technology called Cpf1 emerged based on CRISPR/Cas technology, which is very similar to CRISPR/Cas9, and binds specific DNA through transcribed RNA, and then cleaves the target DNA.

There is still a need for better methods for breeding good tomato varieties resistant to TYLCV.

Disclosure of Invention

In order to effectively culture tomato resisting TYLCV virus, the invention provides a method for degrading TYLCV virus invading tomato cells based on endonuclease, a vector and application thereof.

Specifically, the present invention provides:

(1) a method of breeding tomatoes that are resistant to TYLCV virus, comprising:

1) providing a DNA sequence comprising a coding sequence for an endonuclease system, wherein the endonuclease system comprises a targeting moiety and an endonuclease active moiety, wherein the endonuclease active moiety does not itself have the function of recognizing a specific nucleic acid sequence, and is capable of specifically cleaving a DNA molecule of the TYLCV virus under the action of the targeting moiety; and

2) inserting DNA containing the coding sequence of the endonuclease system into the genome of the tomato through a transgenic method, and enabling the tomato to express the endonuclease system, so that the tomato can obtain the capability of resisting TYLCV virus.

(2) The method according to (1), wherein the endonuclease system is a recombinant endonuclease comprising the N-terminus of the C1 protein of the TYLCV virus as the targeting moiety and a cleavage active region of an endonuclease as the endonuclease active moiety, wherein the N-terminus of the C1 protein is capable of specifically recognizing and binding to the origin of replication region of the DNA of the TYLCV virus.

(3) The method according to (2), wherein the nucleotide sequence of the N-terminus of the C1 protein is as follows:

a) as shown in a sequence table SEQ ID No. 2;

b) has at least 90 percent of similarity with DNA of a nucleotide sequence shown in a sequence table SEQ ID No. 2; or

c) Can be hybridized with DNA of a nucleotide sequence shown in a sequence table SEQ ID No.2 and is a part of the DNA of the TYLCV virus;

wherein the DNA of the nucleotide sequence as described in a) or b) or C) above is capable of encoding the N-terminus of said C1 protein capable of specifically recognizing and binding to the origin of replication of the DNA of the TYLCV virus.

(4) The method of (2), wherein the N-terminus of the C1 protein is as follows:

d) the amino acid sequence is shown in a sequence table SEQ ID No. 3; or

e) The amino acid sequence of the polypeptide is added and/or replaced and/or deleted by amino acid residues on the basis of the sequence table SEQ ID No.3, and the N terminal of the C1 protein can specifically recognize and bind to the replication origin of the DNA of the TYLCV virus.

(5) The method according to (2), wherein the cleavage active region of the endonuclease is a cleavage active region of a restriction endonuclease.

(6) The method according to (2), wherein the cleavage active region of the endonuclease is the cleavage active region of Eco31I, and the nucleotide sequence is as follows:

i) as shown in a sequence table SEQ ID No. 4;

ii) has at least 90% similarity to the DNA of the nucleotide sequence shown in SEQ ID No.4 of the sequence Listing, and is capable of encoding a cleavage active region of Eco31I having endonuclease activity; or

iii) a cleavage active region capable of hybridizing with the DNA having the nucleotide sequence shown in SEQ ID No.4 of the sequence Listing and encoding Eco31I having endonuclease activity.

(7) The method of (6), wherein the cleavage active regions of Eco31I are as follows:

iv) the amino acid sequence is shown in a sequence table SEQ ID No. 5; or

v) the amino acid sequence of which is added and/or substituted and/or deleted by amino acid residues on the basis of the sequence table SEQ ID No.5 and has the activity of the cleavage active region of Eco 31I.

(8) The method according to (2), wherein the cleavage active region of the endonuclease is an SMR cleavage active region, and the nucleotide sequence is as follows:

I) as shown in a sequence table SEQ ID No. 6;

II) has at least 90% similarity with DNA having the nucleotide sequence shown in SEQ ID No.6 of the sequence Listing, and is capable of encoding an SMR cleavage active region having endonuclease activity; or

III) capable of hybridizing with the DNA having the nucleotide sequence shown in SEQ ID No.6 of the sequence Listing and encoding an SMR cleavage active region having endonuclease activity.

(9) The method of (8), wherein the SMR cleaves the active region as follows:

IV) the amino acid sequence is shown as a sequence table SEQ ID No. 7; or

V) the amino acid sequence of which is added and/or substituted and/or deleted by amino acid residues on the basis of the sequence table SEQ ID No.7 and has the activity of the SMR cleavage active region.

(10) The method of (2) and (6), wherein the targeting moiety of the recombinant endonuclease is the N-terminus of the C1 protein, the cleavage active region of the recombinant endonuclease is the cleavage active region of Eco31I, and the nucleotide sequence of the recombinant endonuclease is as follows:

A) as shown in a sequence table SEQ ID No. 8;

B) has at least 90 percent of similarity with DNA of a nucleotide sequence shown in a sequence table SEQ ID No. 8; or

C) Can be hybridized with DNA of a nucleotide sequence shown in a sequence table SEQ ID No. 8;

wherein the DNA of the nucleotide sequence as described in A) or B) or C) above is capable of encoding a recombinant endonuclease specifically recognizing and binding to the origin of replication of DNA of TYLCV virus and having endonuclease activity.

(11) The method according to (10), wherein the recombinant endonuclease is as described below:

D) the amino acid sequence is shown in a sequence table SEQ ID No. 9; or

E) The amino acid sequence of the recombinant endonuclease is added and/or replaced and/or deleted by amino acid residues on the basis of the sequence table SEQ ID No.9, and the recombinant endonuclease can specifically recognize and combine with a DNA replication origin of the TYLCV virus and has endonuclease activity.

(12) The method according to (2) and (8), wherein the targeting portion of the recombinant endonuclease is the N-terminus of the C1 protein, the cleavage active region of the recombinant endonuclease is the SMR cleavage active region, and the nucleotide sequence of the recombinant endonuclease is as follows:

① is shown in SEQ ID No.10 of the sequence table;

② has at least 90% similarity with DNA of the nucleotide sequence shown in SEQ ID No.10 of the sequence Listing, or

③ can be hybridized with DNA of the nucleotide sequence shown in SEQ ID No.10 of the sequence table;

wherein the DNA of the nucleotide sequence as described above in ① or ② or ③ is capable of encoding a recombinant endonuclease that specifically recognizes and binds to the origin of DNA replication of the TYLCV virus and has endonuclease activity.

(13) The method of (12), wherein the recombinant endonuclease is as described below:

④ the amino acid sequence is shown in SEQ ID No.11 of the sequence table, or

⑤ the amino acid sequence of which is added and/or replaced and/or deleted by amino acid residues on the basis of the sequence table SEQ ID No.11, and the recombinant endonuclease can specifically recognize and combine with the DNA replication origin of the TYLCV virus and has endonuclease activity.

(14) The method according to (1), wherein the endonuclease system is a CRISPR/Cas9 system comprising a gRNA complementary to a fragment in a TYLVC viral DNA as the guide portion and a CRISPR/Cas9 nuclease as the endonuclease active portion.

(15) The method of (14), wherein the CRISPR/Cas9 system includes one or more grnas complementary to a fragment in the positive strand DNA of the TYLVC virus.

(16) The method of (14), wherein the CRISPR/Cas9 system includes one or more grnas complementary to a fragment in the negative strand DNA of a TYLVC virus.

(17) The method of (14), wherein the CRISPR/Cas9 system includes one or more grnas complementary to a fragment in the positive strand DNA of the TYLVC virus and one or more grnas complementary to a fragment in the negative strand DNA of the TYLVC virus.

(18) A vector for use in the method of culturing a tomato resistant to TYLCV virus according to any one of (1) to (17).

(19) Use of the vector according to (18) for the cultivation of tomato resistant to TYLCV virus.

Compared with the prior art, the invention has the following advantages and positive effects:

by the conception and the method, the endonuclease system constructed by the invention can specifically cut off the DNA molecule of the TYLCV virus, so that the tomato variety with the capability of resisting the TYLCV virus is successfully obtained by the invention.

The invention has great value for cultivating tomato with tomato leaf curl virus resistance.

Drawings

FIG. 1 shows a schematic diagram of an overlapping PCR method and process.

Fig. 2 shows a schematic diagram of the method and process for constructing a gRNA expression cassette by overlapping PCR.

FIG. 3 shows a schematic diagram of construction of a pBI121+ Cas9-gRNA (F-LIR) vector by a double enzyme digestion method in one embodiment of the present invention.

FIG. 4 shows a schematic diagram of construction of a pBI121+ Cas9-gRNA (R-LIR) vector by a double enzyme digestion method in one embodiment of the present invention.

Figure 5 shows the morphology of wild type tomato after inoculation with TYLCV virus by agrobacterium.

FIG. 6 shows the morphology of transgenic tomato of the invention after inoculation with Agrobacterium TYLCV virus.

Figure 7 shows the morphology of wild type tomatoes after inoculation with TYLCV virus by bemisia tabaci.

Fig. 8 shows the morphology of the transgenic tomatoes of the invention after inoculation with TYLCV virus by bemisia tabaci.

Figure 9 shows the morphology of wild type tomatoes after infection with TYLCV virus in the field.

FIG. 10 shows the morphology of the transgenic tomato of the invention that is not infected by TYLCV virus in the field.

Detailed Description

The present invention is further described in the following description of the embodiments with reference to the drawings, which are not intended to limit the invention, and those skilled in the art may make various modifications or improvements based on the basic idea of the invention, but within the scope of the invention, unless departing from the basic idea of the invention.

In order to develop a better method for cultivating excellent tomato varieties resisting TYLCV virus, the inventor of the invention carries out earnest theoretical research and experimental groping, and finally forms a smart concept and an effective method of the invention, namely: the virus DNA invading into the cell is degraded, thereby blocking the replication of the virus and effectively controlling the development of virus diseases. Therefore, the DNA of the endonuclease system for coding and cutting off the DNA molecule of the TYLCV virus is transferred into the tomato by a transgenic method, so that the tomato expresses the endonuclease system, thereby effectively preventing the DNA replication of the TYLCV virus and inhibiting the transmission of the TYLCV virus in the tomato body, and further providing a good tomato variety resisting the TYLCV virus.

Specifically, the invention provides a method for culturing tomato resisting TYLCV virus, which comprises the following steps:

In the present invention, the term "endonuclease system" refers to a complex having endonuclease activity, which includes a targeting portion and an endonuclease active portion. The endonuclease system may be a recombinant protein or a complex comprising other molecules with targeting (e.g., RNA) and proteins with endonuclease activity.

The term "targeting moiety" as used herein refers to a portion of an endonuclease system that is capable of directing a targeted cleavage of an active portion of the endonuclease to a target nucleic acid sequence, which may be, for example, a polypeptide, a protein, an RNA, or the like.

The term "endonuclease active portion" as used herein refers to a portion of an endonuclease system that has endonuclease activity but does not itself have a specific function of recognizing a specific nucleic acid sequence, and is required to cleave DNA at a specific site under the guidance of the "targeting portion". The endonuclease active portion may be a complete endonuclease (e.g., CRISPR/Cas9 nuclease), or may be a nucleic acid cleavage region or a part thereof of an endonuclease having a nucleic acid recognition region and a nucleic acid cleavage region independently (as long as the endonuclease activity can be exerted).

In one embodiment of the invention, the endonuclease system is a recombinant endonuclease comprising the N-terminus of the C1 protein of the TYLCV virus as the targeting moiety and a cleavage active region of an endonuclease as the endonuclease active moiety, wherein the N-terminus of the C1 protein is capable of specifically recognizing and binding to the origin of replication region of the DNA of the TYLCV virus.

The term "cleavage active region of an endonuclease" refers to a nucleic acid cleavage region or a part thereof of an endonuclease having a nucleic acid recognition region and a nucleic acid cleavage region, respectively, which are independent of each other (as long as the endonuclease activity can be exerted).

In the TYLCV genome, the C1 gene encodes a protein responsible for the replication of viral DNA (i.e., the C1 protein, GenBank: AGG35491.1) that specifically binds to viral DNA and initiates replication of the viral genome by the host cell's replication machinery. The N-terminus of the C1 protein contains a region that specifically recognizes the viral origin of replication and binds to the origin of replication; while the C-terminal region is associated with initiation of viral DNA replication. Accordingly, the present invention constructed a recombinant nuclease having an N-terminus of C1 protein capable of specifically recognizing and binding to the viral origin of replication region and a cleavage active region of endonuclease. The DNA fragment of the recombinant nuclease is cloned into a plant expression vector and is expressed in a tomato body, so that virus DNA molecules are cut in a replication origin region of an invaded virus, and the replication and diffusion of the virus are effectively blocked. The region of the viral origin of replication recognized and bound by the N-terminus of the C1 protein is described in the literature "Campos-Olivas, R., Louis, J.M., Cl rot, D., Gronenborn, B., & Gronenborn, A.M.2002.the structure of a replication initiatives variants of nucleic acid metabolism. proceedings of the national academy of Sciences,99: 10310-.

The N-terminal DNA fragment encoding the C1 protein can be cloned from TYLCV genome (genome sequence is shown in SEQ ID No.1 of sequence table, GenBank: KC211184.1) by PCR method, and the used primer sequences are different according to the cloning method and the cutting active region of the recombined and connected endonuclease. Those skilled in the art understand that cloning to obtain the N-terminus of the C1 protein can be performed using conventional methods known in the art.

The DNA fragment encoding the cleavage active region of the endonuclease can also be cloned by conventional PCR methods.

The DNA molecule of the recombinant endonuclease can be cloned into a plant expression vector by a recombinant PCR method and/or a restriction endonuclease method. Conventional methods and materials known in the art can be used for these methods and materials.

In a specific embodiment of the present invention, the nucleotide sequence of the N-terminus of the C1 protein is as follows:

a) as shown in a sequence table SEQ ID No. 2;

b) has at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) similarity to DNA having a nucleotide sequence set forth in SEQ ID No.2 of the sequence Listing; or

Preferably, the N-terminus of the C1 protein is as follows:

d) the amino acid sequence is shown in a sequence table SEQ ID No. 3; or

In one embodiment, in the recombinant endonuclease of the present invention, the cleavage active region of the endonuclease is a cleavage active region of a restriction endonuclease. The cleavage active region of the recombinantly ligated restriction enzyme may be derived from any restriction enzyme having separate nucleic acid recognition and nucleic acid cleavage regions, provided that the targeting portion is capable of directing site-directed cleavage of the active portion of the endonuclease of the TYLCV virus DNA.

Preferably, the endonuclease is Eco31I (GenBank: AAM09638.2) or SMR (small MutS-related domain, GenBank: AAZ37220.1), and the cleavage active region of the endonuclease is the cleavage active region of Eco31I or the cleavage active region of SMR.

In the case of the cleavage active region of Eco31I, the cleavage active region of Eco31I may be amino acid 250 to amino acid 579 of Eco 31I.

Preferably, the nucleotide sequence of the cleavage active region of Eco31I is as follows:

i) as shown in a sequence table SEQ ID No. 4;

ii) has at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) similarity to the DNA of the nucleotide sequence set forth in SEQ ID No.4 of the sequence Listing, and is capable of encoding a cleavage active region of Eco31I having endonuclease activity; or

Preferably, the cleavage active regions of Eco31I are as follows:

iv) the amino acid sequence is shown in a sequence table SEQ ID No. 5; or

v) the amino acid sequence of which is added and/or substituted and/or deleted by amino acid residues on the basis of the sequence table SEQ ID No.5, and the cleavage active region of Eco31I has endonuclease activity.

In the case of the cleavage active region of Eco31I, the nucleotide sequence of the recombinant endonuclease is preferably as follows:

A) as shown in a sequence table SEQ ID No. 8;

B) has at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) similarity to DNA having a nucleotide sequence set forth in SEQ ID No.8 of the sequence Listing; or

Preferably, the recombinant endonuclease is as follows:

D) the amino acid sequence is shown in a sequence table SEQ ID No. 9; or

In the case of SMR cleavage active region, the SMR cleavage active region may be from amino acid 95 to amino acid 185 of Pseudomonas-SMR functional protein.

Preferably, the nucleotide sequence of the SMR cleavage active region is as follows:

I) as shown in a sequence table SEQ ID No. 6;

II) has at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) similarity to the DNA sequence of the nucleotide sequence shown in SEQ ID No.6 of the sequence Listing, and is capable of encoding an SMR cleavage active region having endonuclease activity; or

Preferably, the SMR cleaved active regions are as follows:

IV) the amino acid sequence is shown as a sequence table SEQ ID No. 7; or

V) the amino acid sequence of which is added and/or substituted and/or deleted by amino acid residues on the basis of the sequence table SEQ ID No.7, and the SMR cleavage active region has endonuclease activity.

In the case of SMR cleavage of the active region, the nucleotide sequence of the recombinant endonuclease is preferably as follows:

① is shown in SEQ ID No.10 of the sequence table;

② has at least 90% (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) similarity to the DNA of the nucleotide sequence shown in SEQ ID No.10 of the sequence Listing, or

Preferably, the recombinant endonuclease is as follows:

④ the amino acid sequence is shown in SEQ ID No.11 of the sequence table, or

In another embodiment of the invention, to control viral DNA replication, the invention also constructs a CRISPR/Cas9 system that includes a gRNA complementary to a fragment in the TYLVC viral DNA as the guide portion, and a CRISPR/Cas9 nuclease as the endonuclease active portion.

The gRNA and the complementary virus DNA segment are paired to form a DNA-RNA hybrid molecule, so that the combination of the CRISPR/Cas9 nuclease and the DNA-RNA hybrid molecule is guided, the virus DNA near the DNA-RNA hybrid site is specifically cut, the effect of effectively blocking the virus DNA replication is achieved, and the tomato can obtain the tomato yellow leaf curl virus resistance.

The enzyme cutting activity of CRISPR/Cas9 is known to depend on the PAM sequence, i.e., NGG, next to the hybridized DNA (N stands for any of the four bases A, T, C and G). Therefore, if NGG is present in the TYLCV genome, a guide RNA, i.e., a gRNA, can be designed in the vicinity thereof using viral DNA as a template. The template may include a viral strand (positive strand) and a complementary strand (negative strand) of the viral DNA.

In the present invention, the CRISPR/Cas9 system can include one or more grnas complementary to a fragment in the positive strand DNA of the TYLVC virus; one or more grnas complementary to a fragment in the negative strand DNA of the TYLVC virus may also be included; one or more grnas complementary to a fragment in the plus strand DNA of the TYLVC virus, and one or more grnas complementary to a fragment in the minus strand DNA of the TYLVC virus, can also be included. That is, one or more gRNA coding sequences that direct CRISPR/Cas9 binding to TYLCV genomic DNA may be present in the plant expression vector, and the gRNA may specifically bind to a viral strand of viral DNA or may pair with a complementary strand of viral DNA.

After the target sequence of the gRNA is determined, a DNA sequence encoding the gRNA may be obtained by a cloning method that is conventional in the field of molecular biology.

The coding sequence for CRISPR/Cas9 nuclease used in the present invention is known (see documents "Li, J.F., Norville, J.E., Aach, J.E., McCormac, M., Zhang, D., Bush, J.S., Church G.M., and SHEEN, J.2013.multiple and homologus restriction-mediated gene encoding in Arabidopsis and Nicotiana benthamiana using guide RNA and 9.Nature ebiotechnology,31: 688-" 691 "). CRISPR/Cas9 and the designed DNA encoding the gRNA can be cloned into a plant expression vector in a manner that can be conventional in the field of molecular biology, such as the methods shown in fig. 1, 2 and 3.

After cloning a DNA (e.g.a vector) comprising the coding endonuclease system of the present invention, said DNA is inserted into the genome of a tomato, allowing said tomato to express said endonuclease system, thereby allowing said tomato to acquire an ability to resist TYLCV virus.

Generally, DNA encoding the endonuclease system of the present invention may be cloned into a plant expression vector, and the expression of the endonuclease system may be carried out in tomato after transfer into tomato. The plant expression vector may employ any plant expression vector commonly used in the art.

Methods for cloning a DNA comprising the coding endonuclease system of the present invention into a plant expression vector and transferring the vector into tomato are known in the art and can employ materials and reagents conventionally used in the art, and can include, for example, preparation of Agrobacterium competent cells, transformation of Agrobacterium with a vector plasmid, transformation of tomato sterile shoot cotyledons or hypocotyl explants with transformed Agrobacterium, identification of exogenous DNA insertion and expression, identification of anti-TYLCV viruses, and the like.

The invention also provides a vector used in the method for cultivating the tomato resisting the TYLCV virus.

The vector comprises DNA comprising a coding sequence for an endonuclease system of the invention, wherein the endonuclease system comprises a targeting moiety and an endonuclease active moiety, wherein the endonuclease active moiety does not itself have the function of recognizing a specific nucleic acid sequence, and is capable of specifically cleaving a DNA molecule of the TYLCV virus under the action of the targeting moiety.

The vector may be any of the commonly used vectors known in the art, including, for example, cloning vectors, plant expression vectors, and the like.

The invention also provides application of the vector in culturing tomato resisting TYLCV virus.

The concepts and methods disclosed herein may also be applied to obtain the ability to combat DNA virus infection, such as geminivirus, in other plants. "geminivirus" refers to a virus from the family Geminiviridae (Geminiviridae). Geminiviruses may include, but are not limited to, barley yellow dwarf virus, cotton defoliation virus, tomato yellow leaf curl virus, pepper leaf curl virus, bean golden mosaic virus, bean dwarf mosaic virus, crowndaisy twist leaf virus, african cassava mosaic virus, tobacco leaf curl virus, squash leaf curl virus, and the like.

The present invention will be further explained or illustrated below by way of examples, which should not be construed as limiting the scope of the invention.

Examples

The experimental procedures in the following examples are conventional, except where otherwise specified. The experimental materials used in the following examples were purchased from commercially available biochemical reagents, unless otherwise specified.

Example 1: construction of recombinant nuclease C1-E expression vector

In the first step, based on the sequence of the viral C1 gene, PCR primers were designed to amplify a DNA fragment recognizing the N-terminus of the C1 protein in the region of the TYLCV origin of replication using the viral C1 gene as a template.

F1(C1-N-F):

5’-GGATCCATGCCTCGTTTATTTAAAATATATGCC-3', (BamHI cleavage sites are underlined)

R1(OL-AC1/ECO31I-R):

5’-TTAAGATTTTCTTTGGTCCTACCTCCTGGCCGCGCAGCGG-3’

In the second step, a DNA fragment of the cleavage active region of Eco31I was amplified using the gene sequence encoding Eco31I as a template using the following primers.

F2(OL-AC1/ECO31I-F):

5’-CCGCTGCGCGGCCAGGAGGTAGGACCAAAGAAAATCTTAA-3’

R2(Eco31I-R):

5’-TCTAGATTACTCTATAAATTCTTCTGGGAT-3', (XbaI cleavage site is underlined)

And thirdly, using the DNA fragments obtained by the first and second steps as a template, and amplifying by using overlapping PCR (primers: F1(C1-N-F) and R2(Eco 31I-R); the overlapping PCR method is shown in figure 1) to obtain a recombinant gene C1-E of the DNA coding the N end of the C1 protein and the DNA coding the cleavage active region of Eco31I, which is shown as a sequence table SEQ ID No. 8. C1-E was ligated to pMD18-T vector (purchased from TAKARA, cat # D101A) by TA cloning and verified by DNA sequencing.

Fourthly, cloning the recombinant gene C1-E into BamHI and XbaI sites of a plant expression vector pHB (see references "Mao, J., Zhang, Y.C., san g, Y., Li, Q.H., & Yang, H.Q.2005.A role for Arabidopsis microorganisms and COP1 in the regulation of storage options. proceedings. of National Academy of Sciences of the United States of America,102: 12270-12275") by a double-enzyme digestion method to obtain a recombinant nuclease C1-E expression vector.

Example 2: construction of recombinant nuclease C1-S expression vector

In the first step, a PCR primer was designed based on the sequence of the viral gene C1, and a DNA fragment recognizing the N-terminus of the C1 protein in the replication origin region of TYLCV was amplified using the viral C1 gene as a template.

F1(C1-N-F):

R1(OL-AC1/SMR-R):

5’-CTCATGCCGTGTAAGTCCAGACCGCCACCTCCTGGCCGCG-3’

In the second step, a DNA fragment encoding the SMR cleavage active region was amplified using the coding sequence of the SMR as a template using the following primers.

F2(OL-AC1/SMR-F):

5’-CGCGGCCAGGAGGTGGCGGTCTGGACTTACACGGCATGAG-3’

R2(SMR-R):5’-TCTAGATTACTCGTCGCGTCCTTCC-3', (XbaI cleavage site is underlined)

And thirdly, using the DNA fragments obtained by the amplification in the first step and the second step as a template, and amplifying by using overlapping PCR (primers: F1(C1-N-F) and R2 (SMR-R); the overlapping PCR method is shown in figure 1) to obtain the recombinant gene C1-S of the N end of the C1 protein and the SMR cleavage active region, which is shown in a sequence table SEQ ID No. 10. C1-S was ligated to pMD18-T vector (purchased from TAKARA, cat # D101A) by TA cloning and verified by DNA sequencing.

Fourthly, cloning the recombinant gene C1-S into BamHI and XbaI sites of the plant expression vector pHB by a double-enzyme cutting method to obtain a recombinant nuclease C1-S expression vector.

Example 3: construction of CRISPR/Cas9 expression vector with one gRNA complementary to positive strand DNA of TYLVC virus

1. The following sequences of the large spacer (LIR) of the positive strand of the TYLVC virus were selected as gRNA target sequences in the CRISPR/Cas9 system:

5’-ATCCGTATAATATTACCGGATGG-3’

2. u6 PCR amplification and cloning of gRNA (F-LIR) expression cassette

A DNA fragment of U6-gRNA (F-LIR) was amplified by overlap PCR as shown in FIG. 1. Primers were designed based on the gRNA target sequence determined from the large spacer DNA sequence of the TYLCV plus strand and the HBT-pcoCas9 plasmid (http:// www.addgene.org/, plasmid number: 52254): f1, R2, R1 and F2, and the first round amplification template is HBT-pcoCas9 plasmid DNA.

F1:5’-GGGCCCAGAAATCTCAAAATTCCGGC-3', (ApaI restriction sites are underlined)

R2:

(SalI cleavage sites are underlined, EcoRI cleavage sites are underlinedDot)

R1:

5’-TCCGGTAATATTATACGGATAATCACTACTTCGTCTCT-3’

F2:

5’-ATCCGTATAATATTACCGGAGTTTTAGAGCTAGAAATAGC-3’

The overlapping PCR amplified DNA fragment was ligated to pMD18-T vector (purchased from TAKARA, cat # D101A) by TA cloning, and the cloned U6-gRNA (F-LIR) fragments were verified by DNA sequencing.

3. PCR amplification and cloning of SPA terminator (SPA-Ter)

Primers used for amplification:

SPAter-F:5’-CTGCAGGTAAGTCATTGAAAAATTTGC-3', (PstI cleavage sites are underlined);

SPAter-R:5’-AAGCTTCTTTGTTAACCATCATTTAGTG-3' (HindIII cleavage sites are underlined).

A Soybean genome DNA is used as a template to amplify an SPA terminator (SPA-Ter) DNA sequence (SEQ ID No.12 of a sequence table).

The resulting PCR product was ligated into pMD18-T (purchased from TAKARA, cat # D101A) vector by TA cloning and the cloned terminator DNA fragment was verified by sequencing.

4. Construction of CRISPR/Cas9 vector for expressing gRNA

The U6-gRNA (F-LIR) fragment was cleaved by double digestion (SalI and ApaI) from pMD18-T vector, cloned into pGreenII0179 (http:// www.pgreen.ac.uk /), and pcoCas9 gene was cleaved by double digestion (BamHI and PstI) from HBT-pcoCas9 plasmid and ligated into pGreenII0179, after which terminator (SPA-Ter) was also ligated into pGreenII0179 by double digestion (PstI and HindIII), finally pGreenII0179 + pcoCas9-gRNA (F-LIR) vector was obtained. U6 connection sequence of gRNA (F-LIR) expression cassette, pcoCas9 gene, terminator (SPA-Ter) on pGreenII0179 is shown in figure 3.

In order to facilitate the transformation of tomato and screening of transformed plants, the vector pGreenII0179-pcoCas9+ gRNA (F-LIR) is subjected to double enzyme digestion (BamHI and EcoRI), the obtained pcoCas9+ gRNA (F-LIR) fragment is connected to the plant expression vector pBI121(https:// www.arabidopsis.org/, plasmid number: 3CD3-388), and finally the plant expression vector pBI121+ pcoCas9-gRNA (F-LIR) is obtained (see figure 3).

Example 4: construction of CRISPR/Cas9 expression vector with one gRNA complementary to TYLVC viral negative strand DNA

1. The following sequences of the large spacer (LIR) of the tyrvc viral negative strand were selected as gRNA target sequences in the CRISPR/Cas9 system:

5’-ATCCGGTAATATTATACGGATGG-3’

2. u6 PCR amplification and cloning of gRNA (R-LIR) expression cassette

A DNA fragment of U6-gRNA (R-LIR) was amplified by overlap PCR as shown in FIG. 1. Designing primers according to a gRNA target sequence determined by a large spacer DNA sequence of a TYLCV negative strand and an HBT-pcoCas9 plasmid (http:// www.addgene.org, plasmid number: 52254): f1, R2, R1 and F2: the first round amplification template was HBT-pcoCas9 plasmid DNA.

F1:5’-GGGCCCAGAAATCTCAAAATTCCGGC-3', (ApaI restriction sites are underlined)

(SalI cleavage sites are underlined, EcoRI cleavage sites are underlined)

R1:

5’-TCCGTATAATATTACCGGATAATCACTACTTCGTCTCT-3’

F2:

5’-ATCCGGTAATATTATACGGAGTTTTAGAGCTAGAAATAGC-3’

The overlapping PCR amplified DNA fragment was ligated to pMD18-T (purchased from TAKARA, cat # D101A) vector by TA cloning method, and the resulting clone U6-gRNA (R-LIR) fragment was verified by DNA sequencing.

3. PCR amplification of SPA terminator (SPA-Ter)

Primers used for amplification:

SPAter-F:5’-CTGCAGGTAAGTCATTGAAAAATTTGC-3, (PstI cleavage site is underlined);

A DNA sequence (SEQ ID No.12 of a sequence table) of an SPA terminator (SPA-Ter) is amplified by taking Soybean genome DNA as a template.

The PCR product obtained by amplification was ligated to pMD18-T (purchased from TAKARA, cat # D101A) vector by TA cloning method, and the cloned terminator DNA fragment was verified by sequencing.

4. Construction of CRISPR/Cas9 vector for expressing gRNA

The U6-gRNA (R-LIR) fragment is cut from a pMD18-T vector by a double-enzyme digestion (SalI and ApaI) method, then is inserted into a vector pGreenII0179 (http:// www.pgreen.ac.uk /), meanwhile, a pcoCas9 gene is cut from an HBT-pcoCas9 plasmid by a double-enzyme digestion (BamHI and PstI) method and is connected to the vector pGreenII0179, and then a terminator (SPA-Ter) is also connected to the vector pGreenII0179 by a double-enzyme digestion (PstI and HindIII) method, so that a pGreenII0179 + pcoCas9-gRNA (R-LIR) vector is finally formed. U6 connection sequence of gRNA (R-LIR) expression cassette, pcoCas9 gene, terminator (SPA-Ter) on pGreenII0179 is shown in figure 4.

In order to facilitate the transformation of tomato and screening of transformed plants, the vector pGreenII0179 + pcoCas9-gRNA (R-LIR) is subjected to double enzyme digestion (BamHI and EcoRI), the obtained pcoCas9-gRNA (R-LIR) fragment is connected to the plant expression vector pBI121(https:// www.arabidopsis.org/, plasmid number: 3CD3-388), and finally the plant expression vector pBI121+ pcoCas9-gRNA (R-LIR) is obtained (see figure 4).

Example 5: construction of CRISPR/Cas9 expression vector with 4 gRNAs complementary to TYLVC viral negative strand DNA

1. For grnas in CRISPR/Cas9 system, target sequences of selected TYLVC viruses are as follows:

1) f1: 5'-CATTTCCACGCCCGTCTCGAAGG-3', V1 gene located in TYLCV genome;

2) f2: 5'-GCTGCTGTCCCCATTGTCCAAGG-3', V1 gene located in TYLCV genome;

3) f3: 5'-TCTTCTTGGTTCGTGATAGAAGG-3', V1 gene located in TYLCV genome;

4) f4: ATCCGTATAATATTACCGGATGG-3', located in the large spacer region (LIR) of the TYLCV genome.

2. PCR amplification and cloning of 4 gRNA expression cassettes in CRISPR/Cas9 vector

Each gRNA expression cassette was amplified and cloned into a T-vector using an overlapping PCR method, as shown in fig. 2.

1) gRNA expression cassette 1 (target sequence F1): AtU3b gRNA-F1

Designed PCR primers:

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU3b-F1):

5’-TCGAGACGGGCGTGGAAATGTGACCAATGTTGCTCC-3’；

F2(gRTF1):

5’-CATTTCCACGCCCGTCTCGAGTTTTAGAGCTAGAAAT-3’；

F(Pps-GGL-1):

(BsaI cleavage sites are underlined, SpeI cleavage sites are double underlined);

R(Pps-GG2-1):

5’-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3' (BsaI cleavage sites are underlined).

First round amplification was carried out using pYLgRNA-AtU 3-3 b (GenBank: KR029097) plasmid as a template (primers used: F1(U-F), R2(gR-R), R1(AtU3b-F1), and F2 (gTF 1)), and second round amplification primers F (Pps-GGL-1) and R (Pps-GG 2-1). The amplified fragment was directly ligated to ZT4-blunt vector (purchased from a member of the Zhuang Union, cat number ZC205) and verified by DNA sequencing. The resulting plasmid was digested with BsaI to isolate fragments:

2) gRNA expression cassette 2 (target sequence F2): AtU3d gRNA-F2

Designed PCR primers:

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU3d-F2):

5’-TGGACAATGGGGACAGCAGCTGACCAATGGTGCTTTG-3’；

F2(gRTF2):

5’-GCTGCTGTCCCCATTGTCCAGTTTTAGAGCTAGAAAT-3’；

F(Pps-GG2-2):

5’-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3' (BsaI cleavage sites are underlined);

R(Pps-GG3-1):

5’-AGCGTGGGTCTCGTCTTCACTCCATCCACTCCAAGCTC-3' (BsaI cleavage sites are underlined).

First amplification round (primers used: F1(U-F), R2(gR-R), R1(AtU3d-F2) and F2(gRTF2)) was performed using pYLgRNA-AtU3d (GenBank: KR029099) plasmid as a template, and second amplification round primers F (Pps-GG2-2) and R (Pps-GG 3-1). The amplified fragment was directly ligated to ZT4-blunt vector (purchased from union, cat number ZC205) vector and verified by DNA sequencing. The resulting plasmid was digested with BsaI to isolate fragments:

3) gRNA expression cassette 3 (target sequence F3): AtU6-1 gRNA-F3

Designed PCR primers:

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU6-1-F3):

5’-TCTATCACGAACCAAGAAGACAATCACTACTTCGTCT-3’；

F2(gRTF3):

5’-TCTTCTTGGTTCGTGATAGAGTTTTAGAGCTAGAAAT-3’；

F(Pps-GG3-2):

5’-TTCAGAGGTCTCTAAGACTTTGGAATCGGCAGCAAAGG-3' (BsaI cleavage sites are underlined);

R(Pgs-GG4):

5’-AGCGTGGGTCTCGAGTCCTTTCCATCCACTCCAAGCTC-3' (BsaI cleavage sites are underlined).

First round amplification (primers used: F1(U-F), R2(gR-R), R1(AtU6-1-F3) and F2(gRTF3)) was performed using pYLgRNA-AtU6-1(GenBank: KR029101) plasmid as a template, and second round amplification primers F (Pps-GG3-2) and R (Pgs-GG4) were performed. The amplified fragment was directly ligated to ZT4-blunt vector (purchased from union, cat number ZC205) vector and verified by DNA sequencing. The resulting plasmid was digested with BsaI to isolate fragments:

4) gRNA expression cassette 4 (target sequence F4): AtU6-29, gRNA-F4

Designed PCR primers:

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU6-29-F4):

5’-TCCGGTAATATTATACGGATCAATCTCTTAGTCGACT-3’；

F2(gRTF4):

5’-ATCCGTATAATATTACCGGAGTTTTAGAGCTAGAAAT-3’；

F(Pps-GG4):

5’-TTCAGAGGTCTCTGACTACATGGAATCGGCAGCAAAGG-3' (BsaI cleavage sites are underlined);

R(Pgs-GGR):

(BsaI cleavage sites are underlined, MluI cleavage sites are underlined, SpeI cleavage sites are underlined).

First round amplification was performed using pYLgRNA-AtU6-29(GenBank: KR029102) plasmid as a template (primers used: F1(U-F), R2(gR-R), R1(AtU6-29-F4), and F2 (gTF 4)), and second round amplification primers F (Pps-GG4) and R (Pgs-GGR). The amplified fragment was directly ligated to ZT4-blunt vector (purchased from union, cat number ZC205) vector and verified by DNA sequencing. The resulting plasmid was digested with BsaI to isolate fragments:

3. the 4 BsaI-cleaved fragments obtained above were ligated into the vector pYLCRISPR/cas9P35S-N (GenBank: KR029112) in the following order (5 'to 3' direction) for the 4 gRNA expression cassettes:

example 6: construction of CRISPR/Cas9 expression vector with 4 gRNAs complementary to positive strand DNA of TYLVC virus

1) r1: 5'-CTTCGGCGAACCTTCGAGACGGG-3', V1 gene located in TYLCV genome;

2) r2: 5'-GGACAATGGGGACAGCAGCACGG-3', V1 gene located in TYLCV genome;

3) r3: 5'-TTCTTCACGGTTGCGGTACTGGG-3', V1 gene located in TYLCV genome;

4) r4: 5'-ATCCGGTAATATTATACGGATGG-3', located in the large spacer region (LIR) of the TYLCV genome.

2. PCR amplification and cloning of each gRNA expression cassette in CRISPR/Cas9 vector

Each gRNA expression cassette was amplified and cloned into a T-vector using an overlapping PCR method, which was performed as shown in fig. 2.

1) gRNA expression cassette 1 (target sequence R1): AtU3b gRNA-R1

Designed PCR primers:

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU3b-R1):

5’-GTCTCGAAGGTTCGCCGAAGTGACCAATGTTGCTCC-3’；

F2(gRTR1):

5’-CTTCGGCGAACCTTCGAGACGTTTTAGAGCTAGAAAT-3’；

F(Pps-GGL-1):

R(Pps-GG2-1):

First round amplification was carried out using pYLgRNA-AtU 3-3 b (GenBank: KR029097) plasmid as a template (primers used: F1(U-F), R2(gR-R), R1(AtU3b-R1), and F2 (gTR 1)), and second round amplification primers F (Pps-GGL-1) and R (Pps-GG 2-1). The amplified fragment was directly ligated to ZT4-blunt vector (purchased from union, cat number ZC205) vector and verified by DNA sequencing. The resulting plasmid was digested with BsaI to isolate fragments:

2) gRNA expression cassette 2 (target sequence R2): AtU3d gRNA-R2

Designed PCR primers:

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU3d-R2):

5’-TGCTGCTGTCCCCATTGTCCTGACCAATGGTGCTTTG-3’；

F2(gRTR2):

5’-GGACAATGGGGACAGCAGCAGTTTTAGAGCTAGAAAT-3’；

F(Pps-GG2-2):

R(Pps-GG3-1):

First amplification (primers used: F1(U-F), R2(gR-R), R1(AtU3d-R2) and F2 (gTR 2)) was performed using pYLgRNA-AtU3d (GenBank: KR029099) plasmid as a template, and second amplification primers F (Pps-GG2-2) and R (Pps-GG 3-1). The amplified fragment was directly ligated to ZT4-blunt vector (purchased from union, cat number ZC205) vector and verified by DNA sequencing. The resulting plasmid was digested with BsaI to isolate fragments:

3) gRNA expression cassette 3 (target sequence R3): AtU6-1 gRNA-R3

Designed PCR primers:

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU6-1-R3):

5’-AGTACCGCAACCGTGAAGAACAATCACTACTTCGTCT-3’；

F2(g RTR3):

5’-TTCTTCACGGTTGCGGTACTGTTTTAGAGCTAGAAAT-3’；

F(Pps-GG3-2):

R(Pgs-GG4):

5’-AGCGTGGGTCTCGAGTCCTTTCCATCCACTCCAAGCTC-3', (BsaI cleavage site underlined).

First round amplification (primers used: F1(U-F), R2(gR-R), R1(AtU6-1-R3) and F2 (gTR 3)) was carried out using pYLgRNA-AtU6-1(GenBank: KR029101) plasmid as a template, and second round amplification primers F (Pps-GG3-2) and R (Pgs-GG4) were carried out. The amplified fragment was directly ligated to ZT4-blunt vector (purchased from union, cat number ZC205) vector and verified by DNA sequencing. The resulting plasmid was digested with BsaI to isolate fragments:

4) gRNA expression cassette 4 (target sequence R4): AtU6-29, gRNA-R4

Designed PCR primers:

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU6-29-R4):

5’-TCCGTATAATATTACCGGATCAATCTCTTAGTCGACT-3’；

F2(gRTR4):

5’-ATCCGGTAATATTATACGGAGTTTTAGAGCTAGAAAT-3’；

F(Pps-GG4):

R(Pgs-GGR):

First round amplification was performed using pYLgRNA-AtU6-29(GenBank: KR029102) plasmid as a template (primers used: F1(U-F), R2(gR-R), R1(AtU6-29-R4), and F2 (gTR 4)), and second round amplification primers F (Pps-GG4) and R (Pgs-GGR). The amplified fragment was directly ligated to ZT4-blunt vector (purchased from union, cat number ZC205) vector and verified by DNA sequencing. The resulting plasmid was digested with BsaI to isolate fragments:

example 7: construction of a CRISPR/Cas9 expression vector with 2 gRNAs complementary to the positive strand DNA of TYLVC virus and 2 gRNAs complementary to the negative strand DNA of TYLVC virus

1) f1: 5'-CATTTCCACGCCCGTCTCGAAGG-3', V1 gene located in TYLCV genome;

2) f2: 5'-GCTGCTGTCCCCATTGTCCAAGG-3', V1 gene located in TYLCV genome;

3) r3: 5'-TTCTTCACGGTTGCGGTACTGGG-3', V1 gene located in TYLCV genome;

1) gRNA expression cassette 1 (target sequence F1): AtU3b gRNA-F1

Designed PCR primers:

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU3b-F1):

5’-TCGAGACGGGCGTGGAAATGTGACCAATGTTGCTCC-3’；

F2(gRTF1):

5’-CATTTCCACGCCCGTCTCGAGTTTTAGAGCTAGAAAT-3’；

F(Pps-GGL-1):

R(Pps-GG2-1):

2) gRNA expression cassette 2 (target sequence F2): AtU3d gRNA-F2

Designed PCR primers:

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU3d-F2):

5’-TGGACAATGGGGACAGCAGCTGACCAATGGTGCTTTG-3’；

F2(gRTF2):

5’-GCTGCTGTCCCCATTGTCCAGTTTTAGAGCTAGAAAT-3’；

F(Pps-GG2-2):

5’-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3', (BsaI cleavage sites underlined);

R(Pps-GG3-1):

3) gRNA expression cassette 3 (target sequence R3): AtU6 gRNA-R3

Designed PCR primers:

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU6-1-R3):

5’-AGTACCGCAACCGTGAAGAACAATCACTACTTCGTCT-3’；

F2(gRTR3):

5’-TTCTTCACGGTTGCGGTACTGTTTTAGAGCTAGAAAT-3’；

F(Pps-GG3-2):

R(Pgs-GG4):

4) gRNA expression cassette 4 (target sequence R4): AtU6-29, gRNA-R4

Designed PCR primers:

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU6-29-R4):

5’-TCCGTATAATATTACCGGATCAATCTCTTAGTCGACT-3’；

F2(gRTR4):

5’-ATCCGGTAATATTATACGGAGTTTTAGAGCTAGAAAT-3’；

F(Pps-GG4):

R(Pgs-GGR):

example 8: construction of a CRISPR/Cas9 expression vector with 2 gRNAs complementary to the negative strand DNA of TYLVC Virus and 2 gRNAs complementary to the positive strand DNA of TYLVC Virus

1) r1: 5'-CTTCGGCGAACCTTCGAGACGGG-3', V1 gene located in TYLCV genome;

2) r2: 5'-GGACAATGGGGACAGCAGCACGG-3', V1 gene located in TYLCV genome;

3) f3: 5'-TCTTCTTGGTTCGTGATAGAAGG-3', V1 gene located in TYLCV genome;

4) f4: 5'-ATCCGTATAATATTACCGGATGG-3', located in the large spacer region (LIR) of the TYLCV genome.

1) gRNA expression cassette 1 (target sequence R1): AtU3b gRNA-R1

Designed PCR primers:

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU3b-R1):

5’-GTCTCGAAGGTTCGCCGAAGTGACCAATGTTGCTCC-3’；

F2(gRTR1):

5’-CTTCGGCGAACCTTCGAGACGTTTTAGAGCTAGAAAT-3’；

F(Pps-GGL-1):

R(Pps-GG2-1):

2) gRNA expression cassette 2 (target sequence R2): AtU3d gRNA-R2

Designed PCR primers:

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU3d-R2):

5’-TGCTGCTGTCCCCATTGTCCTGACCAATGGTGCTTTG-3’；

F2(gRTR2):

5’-GGACAATGGGGACAGCAGCAGTTTTAGAGCTAGAAAT-3’；

F(Pps-GG2-2):

R(Pps-GG3-1):

First amplification (primers used: F1(U-F), R2(gR-R), R1(AtU3d-R2) and F2 (gTR 2)) was performed using pYLgRNA-AtU3d plasmid (GenBank: KR029099) as a template, and second amplification primers F (Pps-GG2-2) and R (Pps-GG 3-1). The amplified fragment was directly ligated to ZT4-blunt vector (purchased from union, cat number ZC205) vector and verified by DNA sequencing. The resulting plasmid was digested with BsaI to isolate fragments:

3) gRNA expression cassette 3 (target sequence F3): AtU6-1 gRNA-F3

Designed PCR primers:

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU6-1-F3):5’

TCTATCACGAACCAAGAAGACAATCACTACTTCGTCT-3’；

F2(gRTF3):

5’-TCTTCTTGGTTCGTGATAGAGTTTTAGAGCTAGAAAT-3’；

F(Pps-GG3-2):

R(Pgs-GG4):

First round amplification was performed using pYLgRNA-AtU6-1(GenBank: KR029101) plasmid as template (primers used: F1(U-F), R2(gR-R), R1(AtU6-1-F3), F2

(gRTF3)), second round amplification primers F (Pps-GG3-2) and R (Pgs-GG 4). The amplified fragment was directly ligated to ZT4-blunt vector (purchased from union, cat number ZC205) vector and verified by DNA sequencing. The resulting plasmid was digested with BsaI to isolate fragments:

4) gRNA expression cassette 4 (target sequence F4): AtU6-29, gRNA-F4

F1(U-F):5’-CTCCGTTTTACCTGTGGAATCG-3’；

R2(gR-R):5’-CGGAGGAAAATTCCATCCAC-3’；

R1(AtU6-29-F4):

5’-TCCGGTAATATTATACGGATCAATCTCTTAGTCGACT-3’；

F2(gRTF4):

5’-ATCCGTATAATATTACCGGAGTTTTAGAGCTAGAAAT-3’；

F(Pps-GG4):

R(Pgs-GGR):

3. the 4 BsaI-cleaved fragments obtained above were ligated to the vector pYLCRISPR/cas9P35S-N (GenBank: KR029112) in the following order (5 'to 3' direction) for the ligation of the 4 gRNA expression cassettes:

example 9: transfer of expression vector of endonuclease system into agrobacterium

1) Preparation of Agrobacterium-infected competent cells

Agrobacterium LBA4404 stored at-70 deg.C was taken (see literature "Hoekema, A., Hirsch, P.R., Hooykaas, P.J.J.,&schilperoort, R.A.1983.A binding plant vector basis association of vir-and T-region of the Agrobacterium tumefaciens Ti-plasmid Nature,303:179-180 ") were streaked onto LB (10 g per liter containing tryptone, 5g of yeast extract, 10g of NaCl, 12g of agar, pH7.0) plates containing 50mg/L rifampicin and incubated at 28 ℃ for 2-3 days. Single colonies were picked, cultured at 28 ℃ in 50ml of liquid LB containing 50mg/L rifampicin (10 g tryptone per liter, 5g yeast extract, 10g NaCl, pH7.0), cultured overnight with shaking at 150rpm, and cultured to OD₆₀₀0.5. Transferring the agrobacterium liquid into a sterile 50ml centrifuge tube, centrifuging for 4 minutes at 4 ℃ and 4000rpm, discarding the supernatant, adding 5ml of precooled 0.15mol/L NaCl suspension cells, centrifuging for 4 minutes at 4 ℃ and 4000rpm, and removing the supernatant; then suspending the cells by using 0.15mol/L NaCl, centrifuging for 4 minutes at 4000rpm, and removing supernatant; 2ml of precooled 20mmol/L CaCl are added₂The solution was gently suspended from the cells, left on ice for 30 minutes, added with 15% (v/v) glycerol to mix well, dispensed 100. mu.l per tube, frozen with liquid nitrogen and stored at-70 ℃.

2) Vector plasmid transformation of agrobacterium

Taking agrobacterium tumefaciens competent cells stored at the temperature of-70 ℃, putting the agrobacterium tumefaciens competent cells into ice water for unfreezing, then taking about 1 mu g of vector plasmid DNA constructed in the embodiment 1, adding the vector plasmid DNA into 100 mu l of the prepared agrobacterium tumefaciens competent cells, uniformly mixing, and carrying out ice bath for 30 minutes; freezing with liquid nitrogen for 1 minute, taking out, carrying out water bath at 37 ℃ for 2 minutes, and carrying out ice bath for 2 minutes; freezing for 1 minute again by liquid nitrogen, taking out, carrying out water bath for 2 minutes at 37 ℃, and carrying out ice bath for 2 minutes; 1ml of liquid LB (pH7.0) was added thereto, and the mixture was shake-cultured at 28 ℃ and 150rpm for about 3 hours. The cells were collected by centrifugation, 100. mu.l of liquid LB was resuspended in Agrobacterium, and plated on LB (pH7.0) plates containing 50mg/L kanamycin and 50mg/L rifampicin, and cultured at 28 ℃ for 2 to 3 days until single colonies were formed. A single colony was inoculated into liquid LB (pH7.0) containing 50mg/L kanamycin and 50mg/L rifampicin, and cultured at 28 ℃ for 16 hours with shaking at 150 rpm. Taking 2 mul of bacterial liquid to carry out PCR verification, and storing the positive clone agrobacterium liquid for later use.

Example 10: agrobacterium is used to transform aseptic tomato seedling cotyledon or hypocotyl explant to obtain transgenic tomato

1) Agrobacterium transformation of tomato

Tomato seeds were soaked in 70% ethanol for 30 seconds, then disinfected with 10% (v/v) sodium hypochlorite for 15 minutes with shaking, then washed 3-5 times with sterile water, and inoculated on 1/2MS medium (the macroelement content of MS medium is halved) for 10 days. Taking cotyledon or hypocotyl of aseptic tomato seedling as explant, and using OD₆₀₀The infected explants were soaked in the agrobacterium solution prepared in example 9 for 5 minutes, which is about 0.3. Taking out the explant, placing the explant on sterile dry filter paper, sucking the residual bacterial liquid, transferring the explant to a dark place on a MS +0.5mg/L IAA (indoleacetic acid) +2.0 mg/L6-BA (6-benzylamino adenine) culture medium (pH5.8) for co-culture for 48 hours, then transferring the explant to an MS +0.5mg/L IAA +2.0 mg/L6-BA +150mg/L carbenicillin +100mg/L cephamycin +50mg/L kanamycin screening culture medium (pH5.8), culturing the explant in a light cycle of 18 hours/dark 6 hours at the temperature of 25 ℃, and changing the culture medium once every three weeks. Differentiating green bud points in about 40 days; when the regeneration bud grows to 3-4cm, cutting off and transferring into 1/2MS (the dosage of macroelements in MS culture medium is halved) +1.0mg/L IBA +100mg/L cephamycin +150mg/L carbenicillin +50mg/L kanamycin rooting culture medium (pH5.8) for culture; transplanting the developed root system to soil.

2) Identification of exogenous DNA insertion in transgenic tomato

Extraction of total DNA from tomato plants (CTAB method, i.e.cetyl trimethyl ammonium bromide method): taking 0.1-0.2g fresh leaves, grinding into powder with liquid nitrogen, transferring into 1.5ml centrifuge tube, adding 600 μ l preheated CTAB lysate (2g CTAB, 8.18g NaCl, 0.74g EDTA. Na)₂.2H₂O, adding 10ml of 1mol/L Tris-HCl (pH8.0) and 0.2ml of mercaptoethanol, adding water to fix the volume to 100ml, carrying out vortex mixing, carrying out water bath at 65 ℃ for 1 hour, adding 600 mu L of chloroform to isoamylol (the volume ratio is 24:1), reversing 50 times, mixing, centrifuging at 10000rpm for 15 minutes, taking the supernatant into a new 1.5ml centrifuge tube, adding equal volume of precooled isopropanol, fully mixing, and standing at-20 ℃ for 30 minutes. Centrifuging at 12000rpm for 15 min, discarding the supernatant, adding 1ml of 75% (v/v) ethanol to wash the DNA precipitate, discarding the ethanol,and (5) air-drying the precipitate. The precipitate was dissolved in 100. mu.l of TE buffer (pH8.0) containing 10mg/mL of RNase A (purchased from Biotechnology, Ltd.; Cat., product No.: B100675), incubated at 37 ℃ for 30 minutes, 100. mu.l of phenol/chloroform (volume ratio: 1) was added thereto, mixed well, centrifuged at 12000rpm for 10 minutes, and the supernatant was collected. 1/10 volumes of 3mol/L NaAc and 2.5 times the volume of absolute ethanol were added, the mixture was left at room temperature for 10 minutes, and then centrifuged at 12000g for 10 minutes, and the supernatant was discarded. The precipitate was air-dried after rinsing with 70% (v/v) ethanol and dissolved in 500. mu.l sterile ddH₂And (4) in O. The DNA samples were stored at-20 ℃ until use.

PCR analysis of exogenous insert DNA: amplification was carried out using primers specific for the exogenous gene transferred into tomato, including the kanamycin resistance gene (primer: NPTII-F: 5'-TCTCATGCTGGAGTTCTTCGC-3'; NPTII-R: 5'-GTCACCGACTTGAGCCATTTG-3') and the gene of interest (primers were used in the examples of the specific embodiment, the length of the primers was about 20 bases, Tm was 55 ℃).

In this example, the kanamycin resistance gene primer was used, and the amplification product was 0.5kb by using transgenic regenerated tomato plant DNA as a template. The PCR amplification procedure was as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 56 ℃ for 30 seconds, extension at 72 ℃ for 50 seconds, and 30 cycles; finally, the extension was carried out at 72 ℃ for 5 minutes. The PCR product was electrophoresed through 1% agarose gel, and the result of electrophoresis showed a fragment of the expected size of 0.5 kb. The fragment was verified by DNA sequencing.

3) Identification of exogenous gene expression of transgenic tomato

Extracting total RNA of tomato plants (Trizol reagent method): 0.1-0.2g of fresh leaves were taken, pulverized with liquid nitrogen, transferred into a 1.5ml centrifuge tube, immediately added with 1ml of Trizol reagent (purchased from Invitrogen, cat # 15596-018), covered with a cap, shaken vigorously for 15 seconds sufficiently and allowed to stand at room temperature for 5 minutes, and centrifuged at 12000g at 2-8 ℃ for 15 minutes. After centrifugation, the samples were separated into layers, the upper aqueous phase containing RNA and the lower organic phase containing protein and DNA. Absorbing the upper layer, transferring into a 1.5ml centrifuge tube, adding isopropanol with the same volume, mixing gently, standing at room temperature for 10 minutes, centrifuging at 12000g at 2-8 ℃ for 10 minutes, discarding the supernatant, adding 1ml 75% (v/v) ethanol, mixing gently, centrifuging at 7500g at 2-8 ℃ for 5 minutes, and discarding the supernatant. The precipitated RNA samples were air-dried and dissolved by adding 50. mu.l of purified water treated with DEPC (diethyl pyrocarbonate). RNA samples were stored at-70 ℃ until use.

RT-PCR analysis of exogenous gene CRISPR/Cas9 expression: the cDNA was obtained by reverse transcription of RNA using a commercial kit (purchased from TAKARA, Inc., cat # RR064A) according to the manufacturer's instructions. The cDNA is used as a template, and PCR amplification is carried out by using CRISPR/Cas9 gene specific primers (RT-Cas9-F: 5'-ACCCAGTTGAGAACACCC-3'; RT-Cas9-R: 5'-CTTAGCGGTAGCCTTTCC-3'), wherein the size of an amplification product is 0.7 kb. The PCR amplification procedure was as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 56 ℃ for 30 seconds, extension at 72 ℃ for 50 seconds, 35 cycles; finally, the extension was carried out at 72 ℃ for 5 minutes. The PCR product was electrophoresed through 1% agarose gel, and the result of electrophoresis showed a fragment of the expected size of 0.7 kb. The fragment was verified by DNA sequencing.

Example 11: tomato TYLCV virus-resistant agrobacterium infection inoculation identification

1) Constructing clone for infecting agrobacterium with TYLCV: the following primers were designed:

TY-F:5’-GTCTGTCTTGCAATATGTGGGATCC-3’

TY-R:5’-GGAAATTCATTTAGAAGTGGATCCCAC-3’

using the TYLCV genome (GenBank: KC211184.1, SEQ ID No.1) isolated and cloned in this laboratory as a template, a viral DNA fragment was amplified and cloned into the pMD18-T vector, which was then digested with BamHI and SacI to isolate a 0.6kb viral DNA fragment and cloned into the BamHI and SacI sites of pGreenII 0029(http:// www.pgreen.ac.uk /) vector. The full-length viral DNA was excised with BamHI in the pMD18-T vector clone described above and cloned into the BamHI site of the pGreenII 0029 plasmid containing 0.6Kb of DNA described above to give a virus-infected clone.

2) Transfer of the infecting clone into Agrobacterium: the Agrobacterium for tomato infestation was obtained by transferring the invaded clone into Agrobacterium C58C1 (see "Van Larebeke, N., G. Engler, M. holsters, S. Van den Elsacker, I. Zaenen, R.A. Schilperoort, and J.Schell.1974.Large plasmid in Agrobacterium tumefaciens infection for crop gain infection availability. Nature,252: 169-170") using the Agrobacterium transformation method described in example 9.

3) Preparation of Agrobacterium for infection: the above-mentioned Agrobacterium was inoculated into 50ml of LB liquid medium (containing 10g of tryptone, 5g of yeast extract, 10g of NaCl, 50mg/L of rifampicin and 50mg/L of kanamycin per liter, pH7.0) and cultured overnight at 28 ℃ with shaking at 150 rpm. The bacterial cells were collected by centrifugation when the bacterial solution concentration was about OD600 ═ 0.6, and then suspended in an infecting solution (10mmol/L MgCl)₂10mM 2-morpholinoethanesulfonic acid (2-morpholinoethanesulfonic acid, purchased from Sigma-Aldrich, cat. No. M3671), pH 5.2) to make the bacterial liquid concentration OD₆₀₀About 2.0. Acetosyringone (purchased from Sigma-Aldrich, cat # D134406) was added to 200. mu. mol/L prior to use.

4) Infection of tomato branches: cutting tomato young branches about 6cm long, placing into a beaker containing the above Agrobacterium solution, placing the beaker into a vacuum container, and vacuumizing (-0.09MPa) for 5 min. And after the vacuum is finished, taking out the infected branches, inserting the infected branches into nutrient soil to take roots and grow buds (at 25 ℃), and observing the disease condition of the rooted plants in 30 days. FIG. 5 shows symptoms of viral infection after infection with wild type. FIG. 6 shows that the transgenic plants prepared as described in example 10 are significantly free of symptoms of viral disease after infection.

Example 12: bemisia tabaci inoculation identification with TYLCV

Transgenic tomato plants prepared as described in example 10 and their non-transgenic controls were placed in an insect-protected greenhouse and cultured at 25 ℃ with a light cycle of 16 hours/8 hours dark, predation and virus transmission were carried out by bemisia tabaci carrying TYLCV, and the plant symptoms were observed after 30 days. Figure 7 shows that wild type tomatoes develop symptoms of viral infection after inoculation with bemisia tabaci. FIG. 8 shows that the transgenic plants are significantly free of symptoms of viral disease after inoculation with Bemisia tabaci.

Planting the plant in a field, finding that the non-transgenic plant is seriously infected, the new leaves at the upper half part of the plant are obviously curled and shrunk, the plant is dwarfed, and the flowering is not smooth at the later stage of the growing period (figure 9); the transgenic plants were not affected by disease and grew normally (FIG. 10).

Example 13: southern hybridization analysis of viruses in plants after TYLCV inoculation of tomato

In examples 12 and 13, it can be judged from the plant phenotype whether the tomato is infected, such as the distortion of new leaves at the top of the plant, the shortening of yellow internodes, etc., indicating that the plant is infected, and on the contrary, after virus inoculation, the tomato grows like a virus-uninoculated plant, indicating that the tomato is cultivated to resist virus. However, to better illustrate the problem, a molecular assay can be used to determine whether the plant contains TYLCV viral DNA, and Southern hybridization analysis (see "Southern, E.M.1975.detection of specific sequences and DNA fragments isolated by molecular biology. journal of molecular biology 98: 503-517") is a commonly used technique.

The extraction method of tomato plant DNA described in example 10 (CTAB method) was used to extract total DNA from tomato leaves inoculated with TYLCV virus, the DNA was separated by agarose electrophoresis and transferred to nitrocellulose membrane using 10-fold SSC (saline sodium citrate) buffer. The DNA probe of C1 gene labeled with digoxin was hybridized using hybridization kit (purchased from Roche, Inc., Cat. No.: 11175041910) according to the protocol recommended by the manufacturer, detected by ChemiDocXRS from Bell (BIO-RAD) and photographed.

Example 14

The procedures described in examples 9-13 were repeated, except that Agrobacterium was transformed with the vector plasmid DNA prepared in example 2, followed by transformation of tomato, and tomato plants resistant to TYLCV virus were also obtained.

Examples 15 to 20

Experimental procedures were carried out as described in example 14, except that Agrobacterium was transformed with the vector plasmid DNA prepared in examples 3-8, and tomato was transformed, respectively, to obtain tomato plants resistant to TYLCV virus as well.

SEQUENCE LISTING

<110> Chengdu agricultural science and technology Limited

Institute of biotechnology and nuclear technology of academy of agricultural sciences of Sichuan province

<120> method and vector for cultivating tomato resisting TYLCV virus and application thereof

<130>FI-196152-59:53/C

<160>11

<170>PatentIn version 3.5

<210>1

<211>2781

<212>DNA

<213> Tomato yellow leaf curl viruses (Tomato yellow leaf curl viruses)

<400>1

accggatggc cgcgcctttt ctttttatgt ggtccccacg agggttccac agacgtcact 60

gtcaaccaat caaattgcat cctcaaacgt tagataagtg ttcatttgtc tttatatact 120

tggtccccaa gtagtctgtc ttgcaatatg tgggatccac ttctaaatga atttcctgaa 180

tctgttcacg gatttcgttg tatgttagct attaaatatt tgcagtccgt tgaggaaact 240

tacgagccca atacattggg ccacgattta attagggatc ttatatctgt tgtaagggcc 300

cgtgactatg tcgaagcgac caggcgatat aatcatttcc acgcccgtct cgaaggttcg 360

ccgaaggctg aacttcgaca gcccatacag cagccgtgct gctgtcccca ttgtccaagg 420

cacaaacaag cgacgatcat ggacgtacag gcccatgtac cggaagccca gaatatacag 480

aatgtatcga agccctgatg ttcctcgtgg atgtgaaggc ccatgtaaag tccagtctta 540

tgagcaacgg gatgatatta agcatactgg tattgttcgt tgtgttagtg atgttactcg 600

tggatctgga attactcaca gagtgggtaa gaggttctgt gttaaatcga tatatttttt 660

aggtaaagtc tggatggatg aaaatattaa gaagcagaat cacactaatc aggtcatgtt 720

cttcttggtt cgtgatagaa ggccttatgg aaacagtcca atggattttg gacaggtttt 780

taatatgttc gataatgagc ccagtaccgc aaccgtgaag aatgatttgc gggataggtt 840

tcaagtgatg aggaaatttc atgctacagt tattggtggg ccctctggaa tgaaggaaca 900

ggcattagtt aagagatttt ttagaattaa cagtcatgta acttataatc atcaggaggc 960

agccaagtat gagaaccata ctgaaaacgc cttgttattg tatatggcat gtacgcatgc 1020

ctctaatcca gtgtatgcaa ctatgaaaat acgcatctat ttctatgatt caatatcaaa 1080

ttaataaaat ttatatttta tatcatgagt ttctgttaca tttattgtgt tttcaagtac 1140

atcatacaat acatgatcaa ctgctctgat tacattgtta attgaaatta caccaagact 1200

atctaaatac ttaagaactt gatatctaaa tactcttaag aaacgaccag tctgaggctg 1260

taatgtcgtc caaattcgga agttgagaaa acatttgtga atccccaata tcttcctgat 1320

gttgtggttg aatcttatct gaatggaaat gatgtcgtgg ttcattagaa atggcctctg 1380

gctgtgttct gttatctcga aatagagggg attgtttatc tcccagataa aaacgccatt 1440

ctctgcttga ggagcagtga tgagttcccc tgtgcgtgaa tccatgattg ttgcagttga 1500

tgtggaggta gtatgagcag ccacagtcta ggtctacacg cttacgcctt attggtttct 1560

tcttggctat cttgtgttgg accttgattg atacttgcga acagtggctc gtagagggtg 1620

atgaaggttg cattcttgag agcccaattt ttcaaggata tgtttttttc ttcgtctaga 1680

tattccctat atgaggaggt aggtcctgga ttgcagagga agatagtggg aattccccct 1740

ttaatttgaa tgggcttccc gtactttgtg ttgctttgcc agtccctctg ggcccccatg 1800

aattccttga agtgctttaa atagtgcggg tctacgtcat caatgacgtt gtaccacgca 1860

tcattactgt acacctttgg gcttaggtct agatgtccac ataaataatt atgtgggcct 1920

agagacctgg cccacattgt cttgcctgtt ctgctatcac cctcaatgat aatacttatg 1980

ggtctccatg gccgcgcagc ggaagatacg acgttctcgg cgacccactc ttcaagttca 2040

tctggaactt gattaaaaga agaagaaaga aatggagaaa cataaacttc taaaggagga 2100

ctaaaaatcc tatctaaatt tgaacttaaa ttatgaaatt gtaaaatata gtcctttggg 2160

gccttctctt ttaatatatt gagggcctcg gatttactgc ctgaattgag tgcctcggca 2220

tatgcgtcgt tggcagattg ctgacctcct ctagctgatc tgccatcgat ttggaaaact 2280

ccaaaatcaa tgaagtctcc gtctttctcc acgtaggtct tgacatctgt tgagctctta 2340

gctgcctgaa tgttcggatg gaaatgtgct gacctgtttg gggataccag gtcgaagaac 2400

cgttggttct tacattggta cttgccttcg aattggataa gcacatggag atgtggttcc 2460

ccattctcgt ggagttctct gcaaactttg atgtattttt tatttgttgg ggtttctagg 2520

ttttttaatt gggaaagtgc ttcctcttta gagagagaac aattgggata tgttaggaaa 2580

taatttttgg catatatttt aaataaacga ggcatgttga aatgaattgg tgtccctcaa 2640

agctctatgg caatcggtgt atcggtgtct tacttatacc tggacaccca atggctattt 2700

ggtaattttg taaaagtaca ttgcaataca aaattcaaaa ttcaaaaatc aaatcattaa 2760

agcggccatc cgtataatat t 2781

<210>2

<211>627

<212>DNA

<213> Tomato yellow leaf curl viruses (Tomato yellow leaf curl viruses)

<400>2

atgcctcgtt tatttaaaat atatgccaaa aattatttcc taacatatcc caattgttct 60

ctctctaaag aggaagcact ttcccaatta aaaaacctag aaaccccaac aaataaaaaa 120

tacatcaaag tttgcagaga actccacgag aatggggaac cacatctcca tgtgcttatc 180

caattcgaag gcaagtacca atgtaagaac caacggttct tcgacctggt atccccaaac 240

aggtcagcac atttccatcc gaacattcag gcagctaaga gctcaacaga tgtcaagacc 300

tacgtggaga aagacggaga cttcattgat tttggagttt tccaaatcga tggcagatca 360

gctagaggag gtcagcaatc tgccaacgac gcatatgccg aggcactcaa ttcaggcagt 420

aaatccgagg ccctcaatat attaaaagag aaggccccaa aggactatat tttacaattt 480

cataatttaa gttcaaattt agataggatt tttagtcctc ctttagaagt ttatgtttct 540

ccatttcttt cttcttcttt taatcaagtt ccagatgaac ttgaagagtg ggtcgccgag 600

aacgtcgtat cttccgctgc gcggcca 627

<210>3

<211>209

<212>PRT

<213> Tomato yellow leaf curl viruses (Tomato yellow leaf curl viruses)

<400>3

Met Pro Arg Leu Phe Lys Ile Tyr Ala Lys Asn Tyr Phe Leu Thr Tyr

1 5 10 15

Pro Asn Cys Ser Leu Ser Lys Glu Glu Ala Leu Ser Gln Leu Lys Asn

20 25 30

Leu Glu Thr Pro Thr Asn Lys Lys Tyr Ile Lys Val Cys Arg Glu Leu

35 40 45

His Glu Asn Gly Glu Pro His Leu His Val Leu Ile Gln Phe Glu Gly

50 55 60

Lys Tyr Gln Cys Lys Asn Gln Arg Phe Phe Asp Leu Val Ser Pro Asn

6570 75 80

Arg Ser Ala His Phe His Pro Asn Ile Gln Ala Ala Lys Ser Ser Thr

85 90 95

Asp Val Lys Thr Tyr Val Glu Lys Asp Gly Asp Phe Ile Asp Phe Gly

100 105 110

Val Phe Gln Ile Asp Gly Arg Ser Ala Arg Gly Gly Gln Gln Ser Ala

115 120 125

Asn Asp Ala Tyr Ala Glu Ala Leu Asn Ser Gly Ser Lys Ser Glu Ala

130 135 140

Leu Asn Ile Leu Lys Glu Lys Ala Pro Lys Asp Tyr Ile Leu Gln Phe

145 150 155 160

His Asn Leu Ser Ser Asn Leu Asp Arg Ile Phe Ser Pro Pro Leu Glu

165 170 175

Val Tyr Val Ser Pro Phe Leu Ser Ser Ser Phe Asn Gln Val Pro Asp

180 185 190

Glu Leu Glu Glu Trp Val Ala Glu Asn Val Val Ser Ser Ala Ala Arg

195 200 205

Pro

<210>4

<211>996

<212>DNA

<213> Escherichia coli (Escherichia coli)

<400>4

ggaggtagga ccaaagaaaa tcttaaatct tatgttactg acagaagagt tttcgaatat 60

tgggtggatg gtgattgggt agctgcagac aggctaatgg gccaagttag aacaaataat 120

atatttatta acgaggaatg tttgaatgcc ggaaatggtg gtttacatcc aactccttgc 180

caagcagatc acattggccc aatctcacta gggttttccc atcgcccaca atttcaacta 240

ctttgcaaat catgtaatag tgccaaaaac aatcgtatgt atttaagtga tataatctct 300

ttattagaag ctgagaatga aggtcatacg gttatttcat ggttcgcaga agaagtatgg 360

aatcgactaa aacactctgt agatgatagt gaaaaagcct taagactaag taaaatacta 420

cgtgataata gacatacata tatgaatctt cttaaaaaaa taatggatga aggttattat 480

actttccttg caagtctttt acatcttgag gtagccaatt ataacccaat atttgaggga 540

ttatgcattt caaatcattt aactcattat aaatcattaa aaaaaataaa acgtgaatca 600

aaatatgctg ctgtgcaaaa aacaagacga atcagaatag catttacttc attgaatgat 660

tatcatagaa aagaaaatcg gaacgcattt attgtatcaa atgaattatc tgagaagttt 720

ttctctgaag ctatggataa tttaaaatca ttaagtgaaa ttacatcttg cttagatgaa 780

aaaatatccg gaataatatc tgagaattca gattcaaaaa atgaatttcg aacaatcatt 840

acagatctac gagaaatagt gacaaacaat aaagaaaaat tcaacttgat attaaaatat 900

ctaatatcag ggatgagcga aataggaaaa gaactggaat catattggga aaatgatcgt 960

tatgttcgct caatcccaga agaatttata gagtaa 996

<210>5

<211>331

<212>PRT

<213> Escherichia coli (Escherichia coli)

<400>5

Gly Gly Arg Thr Lys Glu Asn Leu Lys Ser Tyr Val Thr Asp Arg Arg

1 5 10 15

Val Phe Glu Tyr Trp Val Asp Gly Asp Trp Val Ala Ala Asp Arg Leu

20 25 30

Met Gly Gln Val Arg Thr Asn Asn Ile Phe Ile Asn Glu Glu Cys Leu

35 40 45

Asn Ala Gly Asn Gly Gly Leu His Pro Thr Pro Cys Gln Ala Asp His

50 55 60

Ile Gly Pro Ile Ser Leu Gly Phe Ser His Arg Pro Gln Phe Gln Leu

65 70 75 80

Leu Cys Lys Ser Cys Asn Ser Ala Lys Asn Asn Arg Met Tyr Leu Ser

85 90 95

Asp Ile Ile Ser Leu Leu Glu Ala Glu Asn Glu Gly His Thr Val Ile

100 105 110

Ser Trp Phe Ala Glu Glu Val Trp Asn Arg Leu Lys His Ser Val Asp

115 120 125

Asp Ser Glu Lys Ala Leu Arg Leu Ser Lys Ile Leu Arg Asp Asn Arg

130 135 140

His Thr Tyr Met Asn Leu Leu Lys Lys Ile Met AspGlu Gly Tyr Tyr

145 150 155 160

Thr Phe Leu Ala Ser Leu Leu His Leu Glu Val Ala Asn Tyr Asn Pro

165 170 175

Ile Phe Glu Gly Leu Cys Ile Ser Asn His Leu Thr His Tyr Lys Ser

180 185 190

Leu Lys Lys Ile Lys Arg Glu Ser Lys Tyr Ala Ala Val Gln Lys Thr

195 200 205

Arg Arg Ile Arg Ile Ala Phe Thr Ser Leu Asn Asp Tyr His Arg Lys

210 215 220

Glu Asn Arg Asn Ala Phe Ile Val Ser Asn Glu Leu Ser Glu Lys Phe

225 230 235 240

Phe Ser Glu Ala Met Asp Asn Leu Lys Ser Leu Ser Glu Ile Thr Ser

245 250 255

Cys Leu Asp Glu Lys Ile Ser Gly Ile Ile Ser Glu Asn Ser Asp Ser

260 265 270

Lys Asn Glu Phe Arg Thr Ile Ile Thr Asp Leu Arg Glu Ile Val Thr

275 280 285

Asn Asn Lys Glu Lys Phe Asn Leu Ile Leu Lys Tyr Leu Ile Ser Gly

290 295 300

Met Ser Glu Ile Gly Lys Glu Leu Glu Ser Tyr Trp Glu AsnAsp Arg

305 310 315 320

Tyr Val Arg Ser Ile Pro Glu Glu Phe Ile Glu

325 330

<210>6

<211>288

<212>DNA

<213> Pseudomonas (Pseudomonas savastanoi pv. Phaseolicola)

<400>6

ggaggtggcg gtctggactt acacggcatg agtgtggaag tggcgcgtga gacgctgtgg 60

gagtttctgg ctgaagcgac ccgactggaa atacgctgcg tacgtgtcac ccacggcaag 120

gcggtacgcc tggacggcaa gcgccccatg atcaagagcc acgtcaacac ctggctgcgt 180

cagcattcgc aggtactggg cttttgttca tgcctggcca aacatggggg tgcgggtgcg 240

gtgtacgtga tactcagacg caccatgatg gaaggacgcg acgagtaa 288

<210>7

<211>95

<212>PRT

<213> Pseudomonas (Pseudomonas savastanoi pv. Phaseolicola)

<400>7

Gly Gly Gly Gly Leu Asp Leu His Gly Met Ser Val Glu Val Ala Arg

1 5 10 15

Glu Thr Leu Trp Glu Phe Leu Ala Glu Ala Thr Arg Leu Glu Ile Arg

20 25 30

Cys Val Arg Val Thr His Gly Lys Ala Val Arg Leu Asp Gly Lys Arg

35 40 45

Pro Met Ile Lys Ser His Val Asn Thr Trp Leu Arg Gln His Ser Gln

50 55 60

Val Leu Gly Phe Cys Ser Cys Leu Ala Lys His Gly Gly Ala Gly Ala

65 70 75 80

Val Tyr Val Ile Leu Arg Arg Thr Met Met Glu Gly Arg Asp Glu

85 90 95

<210>8

<211>1623

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>8

atgcctcgtt tatttaaaat atatgccaaa aattatttcc taacatatcc caattgttct 60

ctctctaaag aggaagcact ttcccaatta aaaaacctag aaaccccaac aaataaaaaa 120

tacatcaaag tttgcagaga actccacgag aatggggaac cacatctcca tgtgcttatc 180

caattcgaag gcaagtacca atgtaagaac caacggttct tcgacctggt atccccaaac 240

aggtcagcac atttccatcc gaacattcag gcagctaaga gctcaacaga tgtcaagacc 300

tacgtggaga aagacggaga cttcattgat tttggagttt tccaaatcga tggcagatca 360

gctagaggag gtcagcaatc tgccaacgac gcatatgccg aggcactcaa ttcaggcagt 420

aaatccgagg ccctcaatat attaaaagag aaggccccaa aggactatat tttacaattt 480

cataatttaa gttcaaattt agataggatt tttagtcctc ctttagaagt ttatgtttct 540

ccatttcttt cttcttcttt taatcaagtt ccagatgaac ttgaagagtg ggtcgccgag 600

aacgtcgtat cttccgctgc gcggccagga ggtaggacca aagaaaatct taaatcttat 660

gttactgaca gaagagtttt cgaatattgg gtggatggtg attgggtagc tgcagacagg 720

ctaatgggcc aagttagaac aaataatata tttattaacg aggaatgttt gaatgccgga 780

aatggtggtt tacatccaac tccttgccaa gcagatcaca ttggcccaat ctcactaggg 840

ttttcccatc gcccacaatt tcaactactt tgcaaatcat gtaatagtgc caaaaacaat 900

cgtatgtatt taagtgatat aatctcttta ttagaagctg agaatgaagg tcatacggtt 960

atttcatggt tcgcagaaga agtatggaat cgactaaaac actctgtaga tgatagtgaa 1020

aaagccttaa gactaagtaa aatactacgt gataatagac atacatatat gaatcttctt 1080

aaaaaaataa tggatgaagg ttattatact ttccttgcaa gtcttttaca tcttgaggta 1140

gccaattata acccaatatt tgagggatta tgcatttcaa atcatttaac tcattataaa 1200

tcattaaaaa aaataaaacg tgaatcaaaa tatgctgctg tgcaaaaaac aagacgaatc 1260

agaatagcat ttacttcatt gaatgattat catagaaaag aaaatcggaa cgcatttatt 1320

gtatcaaatg aattatctga gaagtttttc tctgaagcta tggataattt aaaatcatta 1380

agtgaaatta catcttgctt agatgaaaaa atatccggaa taatatctga gaattcagat 1440

tcaaaaaatg aatttcgaac aatcattaca gatctacgag aaatagtgac aaacaataaa 1500

gaaaaattca acttgatatt aaaatatcta atatcaggga tgagcgaaat aggaaaagaa 1560

ctggaatcat attgggaaaa tgatcgttat gttcgctcaa tcccagaaga atttatagag 1620

taa 1623

<210>9

<211>540

<212>PRT

<213> Artificial sequence (artificial sequence)

<400>9

Met Pro Arg Leu Phe Lys Ile Tyr Ala Lys Asn Tyr Phe Leu Thr Tyr

1 5 10 15

Pro Asn Cys Ser Leu Ser Lys Glu Glu Ala Leu Ser Gln Leu Lys Asn

20 25 30

Leu Glu Thr Pro Thr Asn Lys Lys Tyr Ile Lys Val Cys Arg Glu Leu

35 40 45

His Glu Asn Gly Glu Pro His Leu His Val Leu Ile Gln Phe Glu Gly

50 55 60

Lys Tyr Gln Cys Lys Asn Gln Arg Phe Phe Asp Leu Val Ser Pro Asn

65 70 75 80

Arg Ser Ala His Phe His Pro Asn Ile Gln Ala Ala Lys Ser Ser Thr

85 90 95

Asp Val Lys Thr Tyr Val Glu Lys Asp Gly Asp Phe Ile Asp Phe Gly

100 105 110

Val Phe Gln Ile Asp Gly Arg Ser Ala Arg Gly Gly Gln Gln Ser Ala

115 120 125

Asn Asp Ala Tyr Ala Glu Ala Leu Asn Ser Gly Ser Lys Ser Glu Ala

130 135 140

Leu Asn Ile Leu Lys Glu Lys Ala Pro Lys Asp Tyr Ile Leu Gln Phe

145 150 155 160

His Asn Leu Ser Ser Asn Leu Asp Arg Ile Phe Ser Pro Pro Leu Glu

165 170 175

Val Tyr Val Ser Pro Phe Leu Ser Ser Ser Phe Asn Gln Val Pro Asp

180 185 190

Glu Leu Glu Glu Trp Val Ala Glu Asn Val Val Ser Ser Ala Ala Arg

195 200 205

Pro Gly Gly Arg Thr Lys Glu Asn Leu Lys Ser Tyr Val Thr Asp Arg

210 215 220

Arg Val Phe Glu Tyr Trp Val Asp Gly Asp Trp Val Ala Ala Asp Arg

225 230 235 240

Leu Met Gly Gln Val Arg Thr Asn Asn Ile Phe Ile Asn Glu Glu Cys

245 250 255

Leu Asn Ala Gly Asn Gly Gly Leu His Pro Thr Pro Cys Gln Ala Asp

260 265 270

His Ile Gly Pro Ile Ser Leu Gly Phe Ser His Arg Pro Gln Phe Gln

275 280 285

Leu Leu Cys Lys Ser Cys Asn Ser Ala Lys Asn Asn Arg Met Tyr Leu

290 295 300

Ser Asp Ile Ile Ser Leu Leu Glu Ala Glu Asn Glu Gly His Thr Val

305 310 315 320

Ile Ser Trp Phe Ala Glu Glu Val Trp Asn Arg Leu Lys His Ser Val

325 330 335

Asp Asp Ser Glu Lys Ala Leu Arg Leu Ser Lys Ile Leu Arg Asp Asn

340 345 350

Arg His Thr Tyr Met Asn Leu Leu Lys Lys Ile Met Asp Glu Gly Tyr

355 360 365

Tyr Thr Phe Leu Ala Ser Leu Leu His Leu Glu Val Ala Asn Tyr Asn

370 375 380

Pro Ile Phe Glu Gly Leu Cys Ile Ser Asn His Leu Thr His Tyr Lys

385 390 395 400

Ser Leu Lys Lys Ile Lys Arg Glu Ser Lys Tyr Ala Ala Val Gln Lys

405 410 415

Thr Arg Arg Ile Arg Ile Ala Phe Thr Ser Leu Asn Asp Tyr His Arg

420 425 430

Lys Glu Asn Arg Asn Ala Phe Ile Val Ser Asn Glu Leu Ser Glu Lys

435 440 445

Phe Phe Ser Glu Ala Met Asp Asn Leu Lys Ser Leu Ser Glu Ile Thr

450 455 460

Ser Cys Leu Asp Glu Lys Ile Ser Gly Ile Ile Ser Glu Asn Ser Asp

465 470 475 480

Ser Lys Asn Glu Phe Arg Thr Ile Ile Thr Asp Leu Arg Glu Ile Val

485 490 495

Thr Asn Asn Lys Glu Lys Phe Asn Leu Ile Leu Lys Tyr Leu Ile Ser

500 505 510

Gly Met Ser Glu Ile Gly Lys Glu Leu Glu Ser Tyr Trp Glu Asn Asp

515 520 525

Arg Tyr Val Arg Ser Ile Pro Glu Glu Phe Ile Glu

530 535 540

<210>10

<211>915

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>10

atgcctcgtt tatttaaaat atatgccaaa aattatttcc taacatatcc caattgttct 60

ctctctaaag aggaagcact ttcccaatta aaaaacctag aaaccccaac aaataaaaaa 120

tacatcaaag tttgcagaga actccacgag aatggggaac cacatctcca tgtgcttatc 180

caattcgaag gcaagtacca atgtaagaac caacggttct tcgacctggt atccccaaac 240

aggtcagcac atttccatcc gaacattcag gcagctaaga gctcaacaga tgtcaagacc 300

tacgtggaga aagacggaga cttcattgat tttggagttt tccaaatcgatggcagatca 360

gctagaggag gtcagcaatc tgccaacgac gcatatgccg aggcactcaa ttcaggcagt 420

aaatccgagg ccctcaatat attaaaagag aaggccccaa aggactatat tttacaattt 480

cataatttaa gttcaaattt agataggatt tttagtcctc ctttagaagt ttatgtttct 540

ccatttcttt cttcttcttt taatcaagtt ccagatgaac ttgaagagtg ggtcgccgag 600

aacgtcgtat cttccgctgc gcggccagga ggtggcggtc tggacttaca cggcatgagt 660

gtggaagtgg cgcgtgagac gctgtgggag tttctggctg aagcgacccg actggaaata 720

cgctgcgtac gtgtcaccca cggcaaggcg gtacgcctgg acggcaagcg ccccatgatc 780

aagagccacg tcaacacctg gctgcgtcag cattcgcagg tactgggctt ttgttcatgc 840

ctggccaaac atgggggtgc gggtgcggtg tacgtgatac tcagacgcac catgatggaa 900

ggacgcgacg agtaa 915

<210>11

<211>304

<212>PRT

<213> Artificial sequence (artificial sequence)

<400>11

Met Pro Arg Leu Phe Lys Ile Tyr Ala Lys Asn Tyr Phe Leu Thr Tyr

1 5 10 15

Pro Asn Cys Ser Leu Ser Lys Glu Glu Ala Leu Ser Gln Leu Lys Asn

20 25 30

Leu Glu Thr Pro Thr Asn Lys Lys Tyr Ile Lys Val Cys Arg Glu Leu

35 40 45

His Glu Asn Gly Glu Pro His Leu His Val Leu Ile Gln Phe Glu Gly

50 55 60

Lys Tyr Gln Cys Lys Asn Gln Arg Phe Phe Asp Leu Val Ser Pro Asn

65 70 75 80

Arg Ser Ala His Phe His Pro Asn Ile Gln Ala Ala Lys Ser Ser Thr

85 90 95

Asp Val Lys Thr Tyr Val Glu Lys Asp Gly Asp Phe Ile Asp Phe Gly

100 105 110

Val Phe Gln Ile Asp Gly Arg Ser Ala Arg Gly Gly Gln Gln Ser Ala

115 120 125

Asn Asp Ala Tyr Ala Glu Ala Leu Asn Ser Gly Ser Lys Ser Glu Ala

130 135 140

Leu Asn Ile Leu Lys Glu Lys Ala Pro Lys Asp Tyr Ile Leu Gln Phe

145 150 155 160

His Asn Leu Ser Ser Asn Leu Asp Arg Ile Phe Ser Pro Pro Leu Glu

165 170 175

Val Tyr Val Ser Pro Phe Leu Ser Ser Ser Phe Asn Gln Val Pro Asp

180 185 190

Glu Leu Glu Glu Trp Val Ala Glu Asn Val Val Ser Ser Ala Ala Arg

195 200 205

Pro Gly Gly Gly Gly Leu Asp Leu His Gly Met Ser Val Glu Val Ala

210 215 220

Arg Glu Thr Leu Trp Glu Phe Leu Ala Glu Ala Thr Arg Leu Glu Ile

225 230 235 240

Arg Cys Val Arg Val Thr His Gly Lys Ala Val Arg Leu Asp Gly Lys

245 250 255

Arg Pro Met Ile Lys Ser His Val Asn Thr Trp Leu Arg Gln His Ser

260 265 270

Gln Val Leu Gly Phe Cys Ser Cys Leu Ala Lys His Gly Gly Ala Gly

275 280 285

Ala Val Tyr Val Ile Leu Arg Arg Thr Met Met Glu Gly Arg Asp Glu

290 295 300

<210>12

<211>297

<212>DNA

<213> Soybean (Glycine max (Linn.) Merr.)

<400>12

gtaagtcatt gaaaaatttg caaagcatct gtagccaccc cactttgttt gttgtactta 60

aactacattc ccatttgttt ttgctttatg agatttcatc atcctgtatt tttggtttct 120

gttttcggac ttcaatggaa attaatggat gagaactaat gaataagcta ttgtgttgtg 180

ttgctttgtt tccaaataac ttcaagaacc cattgtcctt gcatttccat cttgtgggtt 240

gaaattagtc tcttctaaat ttaagttaat tgtgtcacta aatgatggtt aacaaag297

Claims

1. A method of breeding tomatoes that are resistant to TYLCV virus, comprising:

2) inserting a DNA comprising the coding sequence of said endonuclease system into the genome of a tomato by transgenic means, allowing said tomato to express said endonuclease system, thereby allowing said tomato to acquire resistance to TYLCV virus,

wherein the endonuclease system is a CRISPR/Cas9 system.

2.The method of claim 1, wherein the CRISPR/Cas9 system includes a gRNA complementary to a fragment in TYLVC viral DNA as the guide portion and a CRISPR/Cas9 nuclease as the endonuclease active portion.

3. The method of claim 1, wherein the CRISPR/Cas9 system includes one or more grnas that are complementary to a fragment in the positive strand DNA of the TYLVC virus.

4. The method of claim 1, wherein the CRISPR/Cas9 system includes one or more grnas complementary to a fragment in the negative strand DNA of a TYLVC virus.

5. The method according to any one of claims 1-4, wherein the CRISPR/Cas9 system includes one or more gRNAs complementary to a fragment in the positive strand DNA of TYLVC virus and one or more gRNAs complementary to a fragment in the negative strand DNA of TYLVC virus.

6. A vector for use in the method of cultivating tomato resistant to TYLCV virus of any one of claims 1-5, wherein the vector comprises a DNA sequence of a coding sequence for an endonuclease system, wherein the endonuclease system comprises a targeting portion and an endonuclease active portion, the endonuclease active portion not having a function of recognizing a specific nucleic acid sequence itself, which is capable of specifically cleaving a DNA molecule of TYLCV virus under the action of the targeting portion;

the endonuclease system is a CRISPR/Cas9 system.

7. The vector of claim 6 wherein the CRISPR/Cas9 system comprises a gRNA complementary to a fragment in TYLVC viral DNA as the guide portion and CRISPR/Cas9 nuclease as the endonuclease active portion.

8. Use of the vector of claim 6 for the cultivation of tomato resistant to TYLCV virus.