CN110885851B

CN110885851B - Recombinant vector, preparation method thereof and method for improving turnip mosaic virus resistance and/or yield of vegetable crops

Info

Publication number: CN110885851B
Application number: CN201810928575.8A
Authority: CN
Inventors: 郭惠珊; 汪晶晶; 崔辰; 房媛媛
Original assignee: Institute of Microbiology of CAS
Current assignee: Institute of Microbiology of CAS
Priority date: 2018-08-15
Filing date: 2018-08-15
Publication date: 2023-01-17
Anticipated expiration: 2038-08-15
Also published as: CN110885851A

Abstract

The invention relates to a recombinant vector, a preparation method thereof and a method for improving turnip mosaic virus resistance and/or yield of vegetable crops. The recombinant vector provided by the invention comprises: and a binding site complementary to the RNA sequence shown in SEQ ID NO. 8. The transcription RNA product of the recombinant vector mediates the degradation of miR1885a or inhibits the regulation and control of the miR1885a on a target through the combination with miR1885 a.

Description

Recombinant vector, preparation method thereof and method for improving turnip mosaic virus resistance and/or yield of vegetable crops

Technical Field

The invention relates to the field of biotechnology, in particular to a recombinant vector, a preparation method thereof and a method for improving turnip mosaic virus resistance and/or yield of vegetable crops.

Background

Micro RNA microRNA (miRNA) can regulate the mRNA expression level and translation of a target gene, and therefore plays an important role in the growth and development of plants and the stress resistance process. In the process of resisting diseases, miRNA influences the interaction between plants and pathogenic microorganisms by targeting important genes in the process of resisting diseases.

The inventor finds that the miRNA bra-miR1885a cloned from rape can be specifically induced to be expressed by Turnip Mosaic Virus (TuMV). TuMV belongs to Potyviridae (Potyviridae) and is one of five major plant pathogenic viruses causing the most serious damage to vegetable crops in the world. Meanwhile, miR1885a is found to be capable of targeting a series of R genes, and the plant R gene can play a disease-resistant role through a downstream Salicylic Acid (SA) pathway. However, the role of miR1885a in the interaction between rape and TuMV cannot be deeply researched because the reference sequence of the genome of early rape is not complete.

Disclosure of Invention

The invention aims to provide a plasmid vector capable of capturing miRNA bra-miRNA1885a of vegetable crops, which mediates the degradation of miR1885a or inhibits the regulation and control of the miR1885a on a target through combining with the miR1885 a. Also provides a preparation method of the vector and a method for improving turnip mosaic virus resistance and/or yield of vegetable crops.

The invention provides a recombinant vector, wherein the recombinant vector comprises: and a binding site complementary to the RNA sequence shown in SEQ ID NO. 8.

Preferably, the recombinant vector according to the preceding, wherein the binding sites are fully complementary or not fully complementary.

More preferably, the recombinant vector according to the preceding, wherein said incomplete complementarity is that said binding site comprises 3-4 consecutive bases which are not complementary to the RNA sequence shown in SEQ ID NO.8, most preferably said binding site sequence is GGAATCATACCCctaTTTCATTGATG (SEQ ID NO. 11).

Preferably, the recombinant vector comprises a DNA sequence shown in SEQ ID NO. 5.

Or more preferably, a recombinant vector according to the foregoing, wherein the original vector is a plant binary expression vector. Preferably pCAMBIA-1300 or pBI121.

The invention also provides a preparation method of the recombinant vector, wherein the method comprises the following steps:

(1) Amplifying a DNA fragment, wherein the DNA fragment comprises a binding site with complementary RNA sequence shown as SEQ ID NO. 8;

(2) Inserting the DNA fragment into the original vector by recombination reaction.

Preferably, the preparation method comprises the following steps:

(a) Amplifying a DNA fragment comprising the sequence shown in SEQ ID NO. 5;

(b) Inserting the DNA fragment into the original vector by recombination reaction.

The invention also provides a method for improving turnip mosaic virus resistance and/or yield of vegetable crops, wherein the method comprises the step of inhibiting the function of miR1885a in the vegetable crops.

Preferably, the method according to the preceding, wherein said miR1885a inhibition function is to degrade miR1885a and/or to inhibit modulation of the target by miR1885 a.

More preferably, the method according to the preceding, wherein said method comprises transforming the aforementioned recombinant vector into said vegetable crop.

Still more preferably, according to the aforementioned method, wherein said vegetable crop is rape, cabbage or cauliflower.

The transcription product of the vector provided by the invention mediates the degradation of miR1885a or inhibits the regulation and control of the miR1885a on a target through the combination with the miR1885 a. The vector is transformed into vegetable crops to obtain positive transgenic vegetable crops, and the positive transgenic vegetable crops not only have stronger resistance to virus TuMV; and the leaf area is increased, and the pod is enlarged and lengthened. Meanwhile, the vector provided by the invention is a plasmid vector related to disease resistance and yield, and can be used for regulating and controlling the disease resistance and yield of target plants.

Drawings

FIG. 1 is the electrophoresis diagram of the T1 generation transgenic plant DNA PCR sequence STTM-1885-1885;

FIG. 2 shows RNA RT-PCR detection of STTM-1885-1885RNA fragment expression in T1 transgenic positive plant;

FIG. 3 shows leaf phenotype of T1 transgenic positive plants, in which B.napus (Westar) is wild type, STTM-1885-1885 is T1 transgenic positive plants;

FIG. 4 shows the pod phenotype of transgenic positive plants in T1 generation, where B.napus (Westar) is wild type, STTM-1885-1885 is the T1 transgenic positive line No.1, and STTM-1885-1883 is the T1 transgenic positive line No. 3;

FIG. 5 shows TuMV virus-induced cross-inoculation experiments on T2-generation transgenic positive plants, wherein A is the whole plant symptoms (7 days and 14 days) of TuMV infection with STTM-1885-1885 transgenic B.napus, B is the inoculated leaf symptoms (7 days and 14 days) of TuMV infection with STTM-1885-1885 transgenic B.napus, C is the systemic leaf symptoms (7 days and 14 days) of TuMV infection with STTM-1885-1885 transgenic B.napus, B.napus is wild type, STTM-1885-3 is the ST2-generation transgenic positive plant in No.1, TM-1885-2 is the 2-positive plant in No.3, 7DAI is 7 days after infection, and 14DAI is 14 days after infection.

FIG. 6 shows the results of TuMV virus rubbing inoculation Northern blotting of T2 transgenic positive plants, wherein napus is wild type, and STTM-1885-1885#1 and STTM-1885-1885# 3 are T2 transgenic positive plants.

Detailed Description

The following detailed description of the present invention, taken in conjunction with the accompanying drawings and examples, is provided to enable the invention and its various aspects and advantages to be better understood. However, the specific embodiments and examples described below are for illustrative purposes only and are not intended to limit the invention.

2011, the genome sequence of the cabbage type rape is published, and the possibility is provided for further researching the function of miR1885 a. Through the research of the inventor, the bra-MIR1885a (miRBase access MI 0008302) gene can be processed to generate two miRNAs, namely bra-miR1885a (miRBase access MIMAT 0009213) and bra-miR1885b (miRBase access MIMAT 0023015). The two miR1885 can target a series of TIR-NBS-LRR target genes, and the target regions of the genes are positioned in the coding sequence of the TIR structural domain. 22 nt Bra-miR1885a is capable of cleaving Bra027889 (NCBI ACCESSION GBEQ 01027272) and producing 21 nt phased small-interfering RNAs (phasiRNAs), which in turn are capable of targeting other R genes. And the plant R gene can play a disease-resistant role through a downstream SA (SA) way.

Based on the research, the invention provides a recombinant vector which can inhibit the function of miR1885a in vegetable crops. One or more miR1885a binding sites are designed at the downstream of the recombinant vector promoter, and the transcription product of the miR1885a mediates the degradation of the miR1885a or inhibits the miR1885a from regulating and controlling a target through the combination with the miR1885 a. The recombinant vector is transformed into vegetable crops to obtain positive transgenic plants. The positive transgenic plant has stronger resistance to TuMV and shows the phenotype that the leaf area is increased and the pod is enlarged and lengthened.

The transcript of this binding site is fully or incompletely complementary to miR1885 a. By incomplete complementary is meant that the binding site sequence comprises 3-4 consecutive bases, preferably 3 consecutive bases, which are not complementary to miR1885 a. When the transcription product of the binding site is combined with miR1885a, the continuous bases form bulges (bulked), and the combination and inhibition effects of the sequence of the binding site on miR1885a are improved. Most preferably, the binding site sequence is GGAATCATACCCctaTTTCATTGATG.

The original vector of the recombinant vector is a plasmid vector. The constructed recombinant vector is transformed into a vegetable crop, and a target gene is integrated into the genome of the vegetable crop and then transcribed. The original vector can be plant binary expression vector such as pCAMBIA-1300, pBI121, etc.

In one embodiment, the invention specifically provides a mimicry plasmid vector STTM-1885-1885 of miR1885 a. The STTM-1885-1885 carrier can mediate degradation of miR1885a or inhibit regulation of the miR1885a on a target through combination with miR1885 a.

Based on the research, the invention also provides a method for improving the turnip mosaic virus resistance and/or the yield of vegetable crops. The method comprises inhibiting the function of miR1885a in the vegetable crop, and the regulation and control of a target by degrading miR1885a and/or inhibiting miR1885 a. The recombinant vector provided by the invention is transformed into a vegetable crop, so that the vegetable crop transcribes and captures the RNA segment of miR1885 a.

The vegetable crops are plants except grains which can be used for making dishes and cooked into food. Specifically rape, chinese cabbage, cauliflower, etc.

The present invention is further illustrated by the following examples. Unless otherwise indicated, the technical means used in the examples are conventional means well known to those skilled in the art and commercially available instruments and reagents, which are referred to in molecular cloning laboratory manual (3 rd edition), scientific press, microbiological experiment (4 th edition), high education press, and manufacturer's instructions for the corresponding instruments and reagents.

Agrobacterium tumefaciens EHA105 (Elizabeth E.hood. New Agrobacterium tumefaciens plasmids for gene transfer to plants. Transgenic Research, july 1993, volume 2, issue 4, pp 208-218) in the examples described below was publicly available from the institute of microbiology, a national academy of sciences, and this biomaterial was used only for the repetition of experiments related to the present invention and was not used for other purposes.

The pOT2-poly-cis vector (Silencing of Stress-Regulated miRNAs in Plants by Short Target mix (STTM) Aproach (Teotia and Tang, 2017) in the examples described below was given benefit by professor Guiliang Tang.

pOT2-poly-cis vectors can also be prepared by the preparation methods disclosed in the references Construction of short distance target microorganisms (STTM) to block the functions of plants and animal microRNAs (Guiliang Tang et c. 2012).

Example 1 construction of STTM-1885-1885 vector

(1) PCR amplification was carried out using pOT2-poly-cis vector as template and the following primers under catalysis of LongAmp Taq enzyme (purchased from NEB Co.);

upstream primer (5 '→ 3'): gccatttaatatggtctaaagaaagaaataatGGAATCATACCctaTTTCAT TGATGgaattcggtaacgctgaaatccagcag (reverse complement of bra-miR1885a is underlined) (SEQ ID NO. 1)

Downstream primer (5 '→ 3'): gccatttaattagaccataacaacaacaacaacaacaacCATCAATGAAAtagGGTATG ATTCCaagcttgggctgtcccttcaaaatg (sequence bra-miR1885 a) (SEQ ID No. 2).

PCR amplification procedure:

94 ℃ for 2 minutes;

[94 ℃,30 seconds; 30 seconds at 58 ℃;68 ℃,4 minutes ]30 cycles;

10 minutes at 68 ℃;

4 ℃ for 1 minute.

After recovery of the PCR product, swaI single cleavage was performed. After the enzyme digestion fragments are purified and recovered by a DNA purification column, the linear enzyme digestion products are self-connected into a circular carrier under the catalysis of DNA ligase.

The circular vector was identified and sequenced using the following primer amplifications:

upstream primer (5 '→ 3'): CATTTGGAGGGACAGCCAAG (SEQ ID NO. 3)

Downstream primer (5 '→ 3'): CTGGTGATTTTCAGCGTACCGAA, (SEQ ID NO. 4).

The vector containing the DNA molecule shown in SEQ ID No.5, which is indicated by the sequencing result, is named as pOT2-STTM-1885-1885.

(2) Using pOT2-STTM-1885-1885 vector as template, removing amplification starting site on the pOT vector by the following primer amplification:

an upstream primer (5' → 3) TCCCTTAATTAAGTTTGCAAGCAGCAGTATTACGCG (SEQ ID NO. 6),

downstream primer (5' → 3): TCCCTTAATTAAGAAAGGCGCAGGTATCCGGTAAG (SEQ ID NO. 7).

And purifying and recovering the PCR product through a DNA purification column, and purifying after PacI single enzyme digestion to obtain an enzyme digestion fragment. The plasmid is connected with a linearized plasmid (a commercial vector is offered by the professor Guiliang Tang, or purchased from various companies such as Changsheng biotechnology Limited liability company in Beijing Ding), transformed, subjected to PCR and enzyme digestion and sequencing to identify a recombinant vector, a fragment between PacI sites of the pCAMBIA-1300 is replaced by a DNA molecule containing a gene STTM-1885-1885 (namely a sequence SEQ ID No. 5) and a chloramphenicol screening gene, and the recombinant vector obtained by keeping other nucleotides of the pCAMBIA-1300 unchanged is named as STTM-1885-1885.

Example 2 obtaining of Brassica napus/STTM-1885-1885

Using Westar ecotype brassica napus (B.napus cv.Westar) as a recipient plant, the recombinant vector STTM-1885-1885 is transferred into Westar ecotype brassica napus to obtain the brassica napus/STTM-1885-1885 expressing the STTM-1885-1885 fragment.

The specific method comprises the following steps:

(I) transformation of Brassica napus

1.1 preparation of the culture Medium

Murashige & Skoog (MS) medium powder (from Duchefu Co.)

Medium 0 Medium: 1/2MS (MS 2.2 g) and 30g of cane sugar, adding double distilled water to 950ml, adjusting pH to 5.8-6.0, adding double distilled water to 1000ml, adding 3.5g of plant agar Phytagel (purchased from Sigma company) and sterilizing for 20min by high-temperature steam at 113 ℃.

Diluting the culture medium: MS 4.4g, sucrose 30g, adding double distilled water to 1000ml, adjusting pH to 5.8, and sterilizing with 113 deg.C high temperature steam for 20min. After the liquid culture medium is cooled, adding 1ml of 100mM Acetosyringone (AS) into a super clean bench and mixing uniformly for later use.

Medium 2 Medium: MS 4.4g, sucrose 30g, mannitol (Manitol) 18g, kinetin (Kinetin) 0.3mg, phytagel 3.5g, double distilled water added to 1000ml to adjust pH 5.8, high temperature steam sterilization at 113 ℃ for 20min. 1ml of 1mg/ml 2,4-D,1ml of 500mg/ml Carbenicillin (Carbenicillin) and 200. Mu.l of 50mg/ml Hygromycin B (Hygromycin B) were added to the medium after cooling to 50 ℃ and poured into a petri dish.

Medium 3 Medium: MS 4.4g, glucose 10g, xylose (Xylose) 0.25g, 2- (N-morpholine) ethanesulfonic acid Monohydrate (MES) 0.6g, phytagel 3.5g, double distilled water to 1000ml, pH adjusted to 5.8, high temperature steam sterilization at 113 ℃ for 20min. After cooling the medium to 50 ℃ 1ml of 2mg/ml Zeatin (Zeatin), 100. Mu.l of 1mg/ml indoleacetic acid (IAA), 1ml of 500mg/ml Carbenicilin and 200. Mu.l of 50mg/ml Hygromycin B were added and mixed well and poured into a petri dish.

Medium 4 Medium MS 4.4g, sucrose 10g, phytagel 3.2g, double distilled water to 1000ml, adjusting pH to 5.8, and sterilizing with 113 deg.C high temperature steam for 20min. Directly pouring the culture medium when the culture medium is cooled to 50 ℃; alternatively, 100. Mu.l of 1mg/ml IAA may be added and the plate inverted.

1.2 transformation of Brassica napus

(a) Cabbage type rape seeds are sterilized in 84 percent of disinfectant solution for 10-15min, washed 3 times with sterile water, placed on Medium 0 Medium (high bottle), and grown in the dark at 24 ℃ or 27 ℃ for about 6 days (depending on the growth rate, most of the hypocotyls of the rape plantlets are flush with the height of the high bottle).

(b) Plasmid STTM-1885-1885 was transferred into Agrobacterium tumefaciens strain EHA105, and individual colonies were picked up and shake-cultured overnight at 28 ℃ and 250rpm in 5ml LB medium containing kanamycin. After centrifugation, the cells were suspended in about 2ml of a dilution medium.

(c) And (c) dripping 3-5 drops (adjusted according to the concentration of the suspension liquid, if the suspension liquid is excessive, the growth of the agrobacterium cannot be inhibited in the later stage) of the agrobacterium suspension liquid in the step (b) into 20-30ml of dilution medium.

(d) The hypocotyls of Brassica napus cultured in (a) for 6 days were cut into small pieces of about 1cm long, and immersed in the diluted medium of step (c) for 30min. The soaked hypocotyls were placed on sterilized filter paper and cultured in the dark at 24 ℃ or 27 ℃ for 3 days.

(e) Transferring the hypocotyl of step (d) to Medium 2 Medium, culturing at 25-28 deg.C under light for 16-21 days (generally 18 days, taking care to prevent browning).

(f) Transferring the hypocotyl treated in step (e) to Medium 3 Medium, and changing Medium 3 Medium every two weeks, and culturing at 25-28 deg.C under illumination.

(j) Transferring the germinated callus onto Medium 4 Medium at 25-28 deg.C, and culturing under light until it roots.

(II) screening and identification of Brassica napus/STTM-1885-1885

The current generation plant obtained after transformation is the T0 generation transgenic plant. In this experiment, 3 transgenic plants were obtained. Transferring the T0 generation plants to soil with imported soil and vermiculite 1, and culturing at 22 ℃ for 16hr illumination/8 hr to collect seeds. The obtained transgenic seeds are T1 generation transgenic seeds.

The T1 generation transgenic seeds are paved in the soil of the imported soil and vermiculite 1, and cultured for 7 to 9 days in the environment of 16hr light/8 hr dark at the temperature of 22 ℃, and then the plants capable of normal germination and growth are selected and transferred to a separate pot filled with the imported soil and the vermiculite 1 for culture. And after the seedling transplantation is successful, taking a small amount of cotyledon materials, and performing crude extraction on DNA by using a CTAB method. Using DNA as a template, amplifying and identifying a transgenic plant by the following primers:

upstream primer (5 '→ 3'): CATTTGGAGGGACAGCCAAG (SEQ ID NO. 3),

downstream primer (5 '→ 3'): CTGGTGATTTTCAGCGTACCGAA (SEQ ID NO. 4).

The target sequence is 148bp, the sample with the amplified target size band is a sample containing a transgenic fragment, and the corresponding plant is a T1 transgenic plant which is named as a cabbage type rape/STTM-1885-1885 plant.

In the process, 23 seedlings of the T0 generation No.1 strain are transplanted, 17 survivors and 12 positive seedlings are obtained; the No.2 strain T1 generation seeds are rare and have very small germination quantity, and are discarded; no.3 strains germinated and transplanted 5 strains, survived 5 strains, and positive 2 strains (see FIG. 1).

And continuously culturing the transgenic positive plants, and discarding the transgenic negative plants. After the leaves were collected at 21 days of culture, the total RNA of the leaves was extracted with Trizol reagent, and then expression of the RNA fragment of STTM-1885-1885 was detected by semi-quantitative RT-PCR (see FIG. 2).

In these STTM-1885-1885 transgenic positive strains, the STTM-1885-1885RNA fragments were expressed to varying degrees, whereas in the water negative control samples, no expression of the transgenic fragment was detected. These results further demonstrate that STTM-1885-1885 transgenic rape positive strains are indeed capable of expressing the corresponding RNA fragments.

Phenotypic observations of Brassica napus (III) type/STTM-1885-1885

As shown in FIGS. 3 and 4, among T1-generation Brassica napus/STTM-1885-1885 plants, 14 positive plants of the transgenic plants No.1 and No.3 exhibited phenotypes of increased leaf area, increased pod size and increased fruit length: the growth rate of leaf length is 20.82% + -3.38%, the growth rate of leaf width is 16.80% + -4.40%, the growth rate of pod length is 3.31% + -1.87%, and the growth rate of pod diameter is 21.79% + -1.87%.

Growth rates were calculated as leaf length and width, pod length and diameter measured on wild type plants (WT) and T1 generation Brassica napus/STTM-1885-1885 plants (1885), respectively. WT and T1 plants were measured 10 plants each, 5 leaves were measured at the same position per plant selection and compared, and 5 pods were measured per plant.

(IV) TuMV Virus inoculation of Brassica napus/STTM-1885-1885

Collecting seeds of T1 generation transgenic positive plants, planting T1 generation seeds to obtain T2 generation rape seedlings, and performing TuMV virus inoculation treatment on the seedlings. Observing the resistance reaction of the T2 generation transgenic plants to TuMV; and (3) respectively collecting leaves 9 days and 14 days after infection, extracting total RNA by a hot phenol method, and carrying out Northern blotting to detect the TuMV virus accumulation amount and the bra-miR1885a expression amount in the RNA.

Selecting T2 generation STTM-1885-1885 transgenic positive rape plants with seedling age of 20 days for TuMV virus rubbing inoculation.

The method comprises the following specific steps:

(1) The mortar was placed on ice for pre-cooling, and then a certain amount of arabidopsis thaliana leaves containing TuMV virus particles were put in the pre-cooled mortar and ground by adding a small amount of 5mM sodium hydrogen phosphate buffer (pH 7.2).

(2) Plant leaves are sprayed for several times by a spraying pot filled with carborundum until a proper amount of carborundum is sprayed on the leaves.

(3) The ground juice was gently rubbed against the leaf while taking care to rub the leaf from the leaf apex towards the leaf base.

(4) After the rubbing is finished, the leaves are rinsed lightly with clear water after 5-10 min.

(5) Culturing the rubbed plant in dark environment with high humidity for 24hr, and culturing normally.

TuMV infection symptoms (lesion size and number) are observed 14 days after TuMV infection, and the symptom condition is counted. It was observed that the TuMV symptoms in the STTM-1885-1885 transgenic oilseed rape plants were significantly reduced compared to the control wild-type oilseed rape (see FIG. 5). The same experiment was repeated twice. In the first experiment, 9T 2 transgenic STTM-1885-1885 plants No.1 had reduced symptoms, and the disease spots were small and few compared with wild type B.napus; no. 2T 2 transgenic plants of 5T 2-1885-1885 exhibited reduced symptoms. In the second experiment, no. 1T 2 transgenic STTM-1885-1885 plants in 7 plants were relieved of symptoms; no.2 of 8T 2 transgenic STTM-1885-1885 plants had reduced symptoms, therefore, the STTM-1885-1885 transgenic oilseed rape plants had at least reduced symptom resistance to TuMV.

(V) Northern blotting detection of TuMV virus amount in RNA

And collecting plant leaves after the TuMV is infected for 14 days, extracting RNA by a pyrogallol method, and detecting the TuMV virus amount in the RNA by Northern blotting.

5.1. The method for extracting the plant tissue RNA by the hot phenol method comprises the following steps:

5.1.1 reagents required

Extraction buffer (0.1M LiCl,100mM Tris 8.0,10mM EDTA,1% SDS), phenol mixed solution (water-saturated phenol: chloroform: isoamyl alcohol 25, 24), chloroform, isopropanol, 3M NaAC (pH 5.6), 75% ethanol, 50% deionized formamide, RNase-free H ₂ O。

5.1.2 extraction procedure

(a) 100-200 mg of plant material soaked with liquid nitrogen is ground into powder in a precooled mortar by using liquid nitrogen, the powder is added into 700 mul of extraction buffer solution preheated at 65 ℃ and 700 mul of liquid of phenol mixed solution, and the mixture is shaken and evenly mixed.

(b) Standing at 65 deg.C for 5min, and standing at room temperature for 5min.

(c) Centrifuging at 13000rpm for 15min at 4 deg.C, transferring the supernatant to a new tube, adding equal volume of phenol mixed solution, and shaking for mixing.

(d) Centrifuging at 13000rpm for 10min at 4 deg.C, transferring the supernatant to a new tube, adding equal volume of chloroform, and shaking to mix well.

(e) Centrifuging at 13000rpm for 10min at 4 deg.C, transferring the supernatant to a new tube, adding isopropanol (stored at-20 deg.C) at the same volume, mixing by inversion, and standing at room temperature for 10min.

(f) Centrifuge at 13000rpm for 15min at 4 ℃, discard the supernatant and retain the precipitate.

(g) The precipitate was large molecular weight RNA and was rinsed with 1ml 75% ethanol.

(h) Centrifuging at 13000rpm for 5min at 4 ℃, and removing ethanol. Centrifugation was carried out at 13000rpm for 1min at 4 ℃ to remove residual liquid.

(i) The precipitate was dissolved in 30-50. Mu.l of 50% deionized formamide.

After extracting RNA, the TuMV virus content in the RNA is detected by Northern blotting with 28S ribosomal RNA as internal reference. The method comprises the following steps:

5.2 preparation of probes

Amplifying TuMV virus DNA probe by Reverse Transcription PCR (RTPCR) by using the following primers, wherein a template is RNA extracted from arabidopsis thaliana leaves containing TuMV virus particles:

upstream primer (5' → 3): GCGACAAGGAAGTAAATGCTG (SEQ ID NO. 9)

Downstream primer (5' → 3): TCGGTTAAATTGCGCTGAAGA. (SEQ ID NO. 10)

The obtained PCR product was recovered and purified, and then the probe was labeled with Random Primer labeling kit (Rediprime (TM) II Random Primer labeling System) from Amersham, according to the following steps:

(a) 25ng of DNA to be labeled was taken, and sterile water was added to amplify the volume to 45. Mu.l.

(b) The temperature is kept at 98 ℃ for 5min, and DNA is denatured.

(c) The DNA was collected at the bottom of the centrifuge tube by centrifugation and placed on ice.

(d) Denatured DNA was added to the labeling mixture and gently mixed until pellet completely melted (not blown with a gun).

(e) Add 1. Mu.l of Klenow enzyme (to prevent inactivation of Klenow in the labeling mix) and centrifuge.

(f) Add 3. Mu.l of alpha-32P-dCTP, blow gently with a gun, and centrifuge.

(g) Reacting for 30-60 min at 37 ℃; the labeled DNA probe was denatured at 98 ℃ for 5min, centrifuged and placed on ice.

(h) An appropriate amount of the probe was taken for hybridization, and the remaining probe was stored in a 4 ℃ refrigerator.

5.3 Total RNA electrophoresis

Required reagent

Preparation of 20 XSSC solution: 175.3g NaCI,88.2g trisodium citrate, adjusting pH to 7.0 with HCl, metering to 1L, and autoclaving.

Preparation of 10 × MOPS buffer: 41.8g of MOPS,6.56g of NaAc,20ml of 0.5M EDTA, adjustment of pH to 7.0 with NaOH, volume fixing to 1L, packaging in a brown bottle, and autoclaving or filter sterilization.

Preparation of methylene blue staining solution (500 ml): 0.15 g of methylene blue (final concentration of 0.03%) was completely dissolved in 500ml of 0.3M NaAc (pH 5.2).

37% Formaldehyde (formaldehydes), deionized Formamide (formaldehydized)

RNA electrophoresis

Preparation of 1.2% agarose formaldehyde denatured gel:

agarose and water were added to a 500ml beaker and heated until the agarose was completely melted. Cooling the flask to 60 ℃, adding 10 XMOPS and 37% formaldehyde solution, uniformly mixing, introducing into an RNA electrophoresis gel tank, and cooling for later use.

Preparation of RNA samples (dissolved in 50% deionized formamide, loaded at 15-30. Mu.g):

mixing Sample buffer mix and RNA Sample in equal volume, denaturing at 65 deg.C for 5min, placing on ice for 5min, adding RNA Sample buffer, mixing, and loading.

RNA electrophoresis: electrophoresis buffer 1 XMOPS

Voltage =110V, approximately 3hr

5.4 transfer film (ascending capillary transfer method)

(a) Slab rubber with the length and width larger than that of gel is used as a platform, the platform is placed in a plastic disc, 20 XSSC is poured in, a piece of filter paper with the width equal to that of the platform and the length larger than that of the platform is cut, one end of the filter paper is soaked in the plastic disc and is slowly placed on the platform until the other end is also soaked in the 20 XSSC, and air bubbles between the filter paper and the platform are removed.

(b) Cutting a nylon membrane with length and width slightly larger than gel, cutting off upper left corner, soaking in sterile water completely, taking out membrane, and soaking in 20 × SSC for at least 5min.

(c) After the electrophoresis is finished, the gel is cut off at the useless part, and a corner is cut off at the upper left corner to be used as an orientation mark. The gel was rinsed in 20 XSSC for a few moments.

(d) The gel was inverted on the platform in the center of the filter paper, air bubbles between the gel and the filter paper were driven out, and Parafilm was used to surround the gel without touching the sample on the gel.

(e) The gel was soaked in 20 XSSC and a wet nylon membrane was placed over the gel such that the cut corners overlapped and air bubbles were driven out of the space between the nylon membrane and the gel.

(f) 5 pieces of filter paper having the same size as the nylon membrane were soaked in 20 XSSC, and placed on the nylon membrane to remove air bubbles between the filter paper and the nylon membrane.

(g) A stack of paper towels, 15cm thick and slightly smaller than the filter paper, was cut and placed on top of the filter paper, a glass plate was placed on the paper towels, a 500g weight was then applied, and the stack was transferred overnight.

(h) Remove the paper towel, filter paper and Parafilm over the gel, flip the gel and nylon membrane over, place the gel side up in a plastic tray, and mark the location of the gel wells with a pencil on the nylon membrane.

(i) The nylon membrane is taken out and placed on the wet filter paper, and the RNA is fixed by ultraviolet crosslinking.

(j) Staining with methylene blue staining solution until clear ribosomal RNA band is seen, washing with distilled water for decolorization, wrapping with preservative film, and storing at 4 deg.C.

5.5 hybridization

(a) Pre-hybridization: the hybridization buffer was heated to complete dissolution. Pouring into a hybridization tube, putting the cross-linked and fixed membrane, and pre-hybridizing at 65 ℃ for 1-2 hr.

(b) And (3) hybridization: mu.l of labeled probe was added to the hybridization tube and hybridized overnight at 65 ℃.

(c) Washing the membrane: washing the membrane twice with a membrane washing buffer 2 XSSC/2% SDS at 65 ℃/20 min; SDS was further resolved into fractions of 0.2 XSSC/0.2, and the membrane was washed once at 65 ℃/20 min.

(d) Tabletting: and taking the washed film out of the hybridization tube, transferring the film to two layers of plastic films, detecting the strength of a hybridization signal, and putting the films into a dark clamp for tabletting at normal temperature overnight.

(e) Scanning hybridization results: after the membrane was placed in a phosphor screen (GE Healthcare) for overnight, the signal intensity of the phosphor screen was measured with a phosphor screen imaging system (GE Healthcare).

Northern blotting results are shown in FIG. 6, which shows that strong TuMV hybridization signals are observed in the Westar ecotype rape (recipient plant). In contrast, in the two T2-generation brassica napus/STTM-1885-1885 lines STTM-1885-1885, the TuMV virus hybridization signal is obviously weakened in both inoculated leaves (Localaves) and systemic leaves (systematic leaves).

It can be seen that the leaves of transgenic rape transformed with STTM-1885-1885RNA fragment accumulate less virus than wild rape, and the STTM-1885-1885 transgenic rape has stronger resistance to TuMV. These results indicate that STTM-1885-1885RNA is disease resistance-related RNA and may be used in regulating yield and disease resistance of target plant.

Finally, it should be noted that: it should be understood that the above examples are only for clearly illustrating the present invention and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. This need not be, nor should it be exhaustive of all embodiments. And obvious variations or modifications of the invention may be made without departing from the scope of the invention.

Sequence listing

<110> institute of microbiology of Chinese academy of sciences

<120> recombinant vector, method for preparing the same, and method for increasing turnip mosaic virus resistance and/or yield of vegetable crops

<130> 180299CI

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 81

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gccatttaaa tatggtctaa agaagaagaa tggaatcata ccctatttca ttgatggaat 60

tcggtacgct gaaatcacca g 81

<210> 2

<211> 81

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gccatttaaa ttagaccata acaacaacaa ccatcaatga aatagggtat gattccaagc 60

ttgggctgtc ctctccaaat g 81

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

catttggaga ggacagccca ag 22

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctggtgattt cagcgtaccg aa 22

<210> 5

<211> 148

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

catttggaga ggacagccca agcttggaat cataccctat ttcattgatg gttgttgttg 60

ttatggtcta atttaaatat ggtctaaaga agaagaatgg aatcataccc tatttcattg 120

atggaattcg gtacgctgaa atcaccag 148

<210> 6

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tcccttaatt aagtttgcaa gcagcagatt acgcg 35

<210> 7

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tcccttaatt aagaaaggcg gacaggtatc cggtaag 37

<210> 8

<211> 22

<212> RNA

<213> Brassica napus (Brassica napus)

<400> 8

caucaaugaa agguaugauu cc 22

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gcgacaagga agtaaatgct g 21

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tcggttaaat tgcgctgaag a 21

<210> 11

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ggaatcatac cctatttcat tgatg 25

Claims

1. A recombinant vector, wherein the recombinant vector comprises: a binding site complementary to the RNA sequence shown in SEQ ID NO. 8.

2. The recombinant vector according to claim 1, wherein the sequence of the binding site is GGAATCATACCCctaTTTCATTGATG.

3. The recombinant vector according to claim 1, wherein the recombinant vector comprises a DNA sequence as set forth in SEQ ID No. 5.

4. The recombinant vector according to claim 1, wherein the original vector is a plant binary expression vector.

5. The recombinant vector according to claim 1, wherein the original vector is pCAMBIA-1300 or pBI121.

6. A method for producing the recombinant vector according to any one of claims 1 to 3, which comprises:

(1) Amplifying a DNA fragment comprising a binding site complementary to the RNA sequence shown in SEQ ID No. 8;

(2) The DNA fragment is inserted into the original vector by recombination reaction.

7. The method of manufacturing according to claim 6, comprising:

(a) Amplifying a DNA fragment comprising the sequence shown in SEQ ID NO. 5;

(b) Inserting said DNA fragment into said original vector by recombination reaction.

8. A method of increasing turnip mosaic virus resistance and/or yield in a vegetable crop, the method comprising inhibiting the function of miR1885a in the vegetable crop.

9. The method according to claim 8, wherein the function of miR1885a inhibition is to degrade miR1885a and/or to inhibit modulation of the target by miR1885 a.

10. The method according to claim 9, comprising transforming the recombinant vector of any one of claims 1 to 5 into the vegetable crop.

11. The method according to any one of claims 8 to 10, wherein the vegetable crop is rape, cabbage or cauliflower.