CN110885801A - Glucose oxidase M5GOD and coding gene and application thereof - Google Patents

Glucose oxidase M5GOD and coding gene and application thereof Download PDF

Info

Publication number
CN110885801A
CN110885801A CN201911168042.5A CN201911168042A CN110885801A CN 110885801 A CN110885801 A CN 110885801A CN 201911168042 A CN201911168042 A CN 201911168042A CN 110885801 A CN110885801 A CN 110885801A
Authority
CN
China
Prior art keywords
glucose oxidase
leu
ala
gly
asn
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201911168042.5A
Other languages
Chinese (zh)
Other versions
CN110885801B (en
Inventor
牟海津
刘哲民
苑明雪
郁东兴
郁万帅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shang Hao Technology Co Ltd
Ocean University of China
Original Assignee
Shang Hao Technology Co Ltd
Ocean University of China
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shang Hao Technology Co Ltd, Ocean University of China filed Critical Shang Hao Technology Co Ltd
Priority to CN201911168042.5A priority Critical patent/CN110885801B/en
Priority to PCT/CN2019/123895 priority patent/WO2021103123A1/en
Priority to AU2019385785A priority patent/AU2019385785B2/en
Publication of CN110885801A publication Critical patent/CN110885801A/en
Application granted granted Critical
Publication of CN110885801B publication Critical patent/CN110885801B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23B—PRESERVING, e.g. BY CANNING, MEAT, FISH, EGGS, FRUIT, VEGETABLES, EDIBLE SEEDS; CHEMICAL RIPENING OF FRUIT OR VEGETABLES; THE PRESERVED, RIPENED, OR CANNED PRODUCTS
    • A23B4/00—General methods for preserving meat, sausages, fish or fish products
    • A23B4/14—Preserving with chemicals not covered by groups A23B4/02 or A23B4/12
    • A23B4/18—Preserving with chemicals not covered by groups A23B4/02 or A23B4/12 in the form of liquids or solids
    • A23B4/20—Organic compounds; Microorganisms; Enzymes
    • A23B4/22—Microorganisms; Enzymes; Antibiotics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/03—Oxidoreductases acting on the CH-OH group of donors (1.1) with a oxygen as acceptor (1.1.3)
    • C12Y101/03004—Glucose oxidase (1.1.3.4)

Abstract

The invention discloses a glucose oxidase M5GOD and a coding gene and application thereof, and relates to the fields of genetic engineering and fermentation engineering. The amino acid sequence of the glucose oxidase provided by the invention is shown in SEQ ID NO.2, and the nucleotide sequence of the coding gene for coding the glucose oxidase is shown in SEQ ID NO. 4. Recombinant vector and recombinant strain containing the gene and application thereof. The glucose oxidase of the invention has good properties, the optimum pH value is 5.5, the optimum temperature is 30 ℃, and the glucose oxidase has good low-temperature adaptability. The glucose oxidase is used as a novel enzyme preparation, and can be widely applied to industries such as feed, food, medicine and the like.

Description

Glucose oxidase M5GOD and coding gene and application thereof
Technical Field
The invention relates to the technical field of genetic engineering and fermentation engineering, in particular to glucose oxidase M5GOD and a coding gene and application thereof.
Background
Glucose oxidase (EC 1.1.3.4, GOD) is an aerobic dehydrogenase, is mainly distributed in various animals, plants and microorganisms, takes molecular oxygen as an electron acceptor, specifically catalyzes and oxidizes β -D-Glucose into gluconic acid and generates hydrogen peroxide, and the Glucose oxidase has wide application in a plurality of fields such as chemistry, pharmacy, food, beverage, clinical diagnosis, biotechnology and the like, and comprises a Glucose biosensor for detecting diabetes, a food preservative and the like.
The glucose oxidase is used as one of natural biological preservatives, can consume oxygen to generate hydrogen peroxide, and has great potential application value. Xu et al (LWT 92(2018): 339-.
At present, the most main production strains of the glucose oxidase are aspergillus niger and penicillium, but the aspergillus niger and penicillium have low production yield, complicated purification process, lower enzyme activity in a low-temperature environment and poor effect in the aspect of aquatic product fresh-keeping application.
Therefore, the problem to be solved by those skilled in the art is how to provide a glucose oxidase, optimize its physicochemical properties, and provide a better production strain constructed by genetic engineering methods.
Disclosure of Invention
In view of the above, the invention provides a glucose oxidase M5GOD, and a coding gene and application thereof.
The novel glucose oxidase gene is obtained from the penicillium, and the encoded glucose oxidase has high activity and stability in the acidic and neutral ranges and better low-temperature-adapting performance, so that the characteristics mean that the novel glucose oxidase gene has more application value in the aspect of aquatic product preservation.
In order to achieve the purpose, the invention adopts the following technical scheme:
a glucose oxidase M5GOD has an amino acid sequence shown in SEQ ID NO. 2.
Wherein, SEQ ID NO. 1:
MKSIILASALASLAAAQGFTPAEQIDVQASLISDPNKVAGQTFDYIIAGGGLTGLTVAAKLSENPNITVLVIEKGFYESNNGPIIENPNDYGLIFGSSVDQNYLTVPMAINNRTLEVKSGKGLGGSTLINGDSWTGPDKVQIDSWETVLGNTGWNYDALKGYMKEAELARYPTASQIAAGIYFNETCHGFNGTVNAGPRDDGTPYSPLMKALMNTTSAKGVPTQLDFLCGRPRGVSMIYNNLLPDQTRADAAREWLLPNYKRPNLSILTGQVVGKVLFTQTATGPKATGVNFGTNKAINFNVLAKHEVLLAAGSAISPLILEHSGIGLKSVLDQFNITQLVELPVGLNMQDQTTTTVRARAKASSAGQGQAVYFANFTEVFGDYSARATDLLNTKLSQWANETVARGGFNNATALLIQYENYRNWLLNEDVAYVELFLDTNGKMNFDLWDLIPFTRGSTHIAHADPYLQSFSNNPMFLLNELDLLGQAAGSMLAREIQNSGELANYFDGEDIPGANLLPYNATLDGWVGYVKQNFRANWHAVGTCSMMSRELGGVVDPTAKVYGTQGLRVIDGSIPPTQVSSHVMTVFYGMALKIADAVLADYKP。
the full-length 605 amino acids of the enzyme, the first 16 amino acids of the N end are a signal peptide sequence 'MKSIILASALASLAAA', SEQID NO. 5.
Thus, the mature glucose oxidase M5GOD has a theoretical molecular weight of 63.860KDa and an amino acid sequence as shown in seq id No. 2:
QGFTPAEQIDVQASLISDPNKVAGQTFDYIIAGGGLTGLTVAAKLSENPNITVLVIEKGFYESNNGPIIENPNDYGLIFGSSVDQNYLTVPMAINNRTLEVKSGKGLGGSTLINGDSWTGPDKVQIDSWETVLGNTGWNYDALKGYMKEAELARYPTASQIAAGIYFNETCHGFNGTVNAGPRDDGTPYSPLMKALMNTTSAKGVPTQLDFLCGRPRGVSMIYNNLLPDQTRADAAREWLLPNYKRPNLSILTGQVVGKVLFTQTATGPKATGVNFGTNKAINFNVLAKHEVLLAAGSAISPLILEHSGIGLKSVLDQFNITQLVELPVGLNMQDQTTTTVRARAKASSAGQGQAVYFANFTEVFGDYSARATDLLNTKLSQWANETVARGGFNNATALLIQYENYRNWLLNEDVAYVELFLDTNGKMNFDLWDLIPFTRGSTHIAHADPYLQSFSNNPMFLLNELDLLGQAAGSMLAREIQNSGELANYFDGEDIPGANLLPYNATLDGWVGYVKQNFRANWHAVGTCSMMSRELGGVVDPTAKVYGTQGLRVIDGSIPPTQVSSHVMTVFYGMALKIADAVLADYKP。
the glucose oxidase has a wide pH action range, can maintain more than 50% of enzyme activity within a pH value of 3-7, and has an optimal pH value of 5.5. The optimal action temperature of the enzyme is 30 ℃.
Further: a glucose oxidase gene encodes the glucose oxidase gene, and the nucleotide sequence of the gene is shown in SEQ ID No. 4.
Wherein, SEQ ID NO. 3:
ATGAAGTCCATCATTCTTGCCTCTGCCCTCGCCTCTCTAGCTGCAGCCCAGGGCTTCACTCCAGCCGAGCAGATTGATGTCCAGGCCAGCCTGATCTCCGACCCTAACAAGGTCGCCGGCCAGACATTCGACTACATCATCGCTGGAGGTGGTCTGACAGGTCTTACCGTTGCGGCCAAGCTGTCTGAGAACCCTAACATCACCGTCCTTGTCATCGAAAAGGGCTTCTACGAGTCCAATAATGGGCCCATCATCGAAAACCCCAACGACTATGGCTTGATCTTCGGTAGCTCTGTTGACCAAAACTACCTCACCGTTCCCATGGCCATCAACAACCGTACCCTGGAAGTCAAGTCTGGCAAGGGTCTCGGTGGTTCCACGTTGATTAACGGTGACTCCTGGACCGGTCCCGACAAGGTCCAGATTGACTCCTGGGAGACTGTCTTGGGAAATACCGGTTGGAACTATGACGCCCTCAAGGGGTACATGAAGGAAGCCGAGCTTGCTCGTTACCCAACCGCCAGTCAGATTGCCGCCGGTATCTACTTCAACGAAACCTGCCATGGATTCAACGGCACCGTTAACGCCGGACCCCGTGATGATGGTACCCCTTACTCTCCCCTTATGAAAGCCCTCATGAACACCACCTCTGCCAAGGGTGTTCCCACTCAGCTTGACTTCCTCTGCGGTCGCCCTCGTGGTGTCTCCATGATCTACAACAACTTGCTGCCTGACCAGACCCGTGCGGATGCTGCTCGCGAGTGGCTTCTTCCCAACTATAAGCGCCCCAACTTGAGCATTCTTACCGGCCAGGTTGTTGGAAAGGTTCTCTTCACTCAAACCGCGACTGGCCCCAAGGCTACTGGTGTTAATTTTGGCACCAACAAGGCCATCAATTTCAACGTCTTGGCCAAGCACGAGGTCCTTTTGGCTGCTGGCTCTGCCATCTCGCCCCTAATCCTCGAGCACTCTGGTATTGGTCTAAAGTCTGTCCTCGACCAGTTCAATATCACCCAGCTCGTCGAGCTTCCCGTCGGTCTCAATATGCAGGACCAGACCACCACCACTGTCCGCGCCCGAGCCAAGGCGTCTTCTGCTGGTCAGGGCCAGGCCGTCTACTTTGCCAACTTCACTGAGGTCTTTGGTGACTACTCCGCTCGAGCTACCGATTTACTCAACACCAAGCTCTCCCAGTGGGCCAACGAGACTGTTGCACGCGGAGGCTTCAACAACGCCACCGCTCTCTTAATCCAGTATGAGAACTACCGTAACTGGCTCCTGAACGAGGACGTTGCCTATGTCGAGCTTTTCCTCGACACCAACGGAAAGATGAACTTTGACTTGTGGGATCTCATCCCCTTCACGCGCGGCTCTACGCACATAGCACACGCCGACCCTTATCTGCAGTCCTTCTCCAACAATCCCATGTTCCTGTTGAACGAGCTTGACCTTCTTGGCCAGGCTGCTGGCTCGATGCTGGCTCGTGAGATCCAGAACTCGGGTGAGCTGGCCAACTACTTTGACGGCGAGGATATCCCCGGGGCAAATCTCTTGCCCTACAACGCTACCCTCGATGGCTGGGTTGGATATGTCAAGCAGAACTTTCGTGCCAACTGGCACGCTGTCGGGACTTGTTCTATGATGTCCCGGGAGCTTGGTGGTGTTGTTGATCCTACGGCCAAGGTCTACGGTACCCAGGGTCTTCGTGTCATTGATGGTTCTATTCCACCCACCCAGGTGTCATCTCACGTTATGACCGTTTTCTACGGTATGGCTTTGAAGATTGCCGATGCTGTTCTGGCTGACTACAAGCCC。
the invention separates and clones the glucose oxidase gene M5GOD by a PCR method, and the analysis result of the cDNA complete sequence shows that the total length of the glucose oxidase gene is 1815bp, wherein, the base sequence of the signal peptide is as follows: "ATGAAGTCCATCATTCTTGCCTCTGCCCTCGCCTCTCTAGCTGCAGCC" according to SEQ ID NO.6, wherein the nucleotide sequence has TAA as a stop codon. Therefore, the total length of the nucleotide sequence for coding the mature glucose oxidase protein is 1767bp, and is shown as SEQ ID NO. 4:
CAGGGCTTCACTCCAGCCGAGCAGATTGATGTCCAGGCCAGCCTGATCTCCGACCCTAACAAGGTCGCCGGCCAGACATTCGACTACATCATCGCTGGAGGTGGTCTGACAGGTCTTACCGTTGCGGCCAAGCTGTCTGAGAACCCTAACATCACCGTCCTTGTCATCGAAAAGGGCTTCTACGAGTCCAATAATGGGCCCATCATCGAAAACCCCAACGACTATGGCTTGATCTTCGGTAGCTCTGTTGACCAAAACTACCTCACCGTTCCCATGGCCATCAACAACCGTACCCTGGAAGTCAAGTCTGGCAAGGGTCTCGGTGGTTCCACGTTGATTAACGGTGACTCCTGGACCGGTCCCGACAAGGTCCAGATTGACTCCTGGGAGACTGTCTTGGGAAATACCGGTTGGAACTATGACGCCCTCAAGGGGTACATGAAGGAAGCCGAGCTTGCTCGTTACCCAACCGCCAGTCAGATTGCCGCCGGTATCTACTTCAACGAAACCTGCCATGGATTCAACGGCACCGTTAACGCCGGACCCCGTGATGATGGTACCCCTTACTCTCCCCTTATGAAAGCCCTCATGAACACCACCTCTGCCAAGGGTGTTCCCACTCAGCTTGACTTCCTCTGCGGTCGCCCTCGTGGTGTCTCCATGATCTACAACAACTTGCTGCCTGACCAGACCCGTGCGGATGCTGCTCGCGAGTGGCTTCTTCCCAACTATAAGCGCCCCAACTTGAGCATTCTTACCGGCCAGGTTGTTGGAAAGGTTCTCTTCACTCAAACCGCGACTGGCCCCAAGGCTACTGGTGTTAATTTTGGCACCAACAAGGCCATCAATTTCAACGTCTTGGCCAAGCACGAGGTCCTTTTGGCTGCTGGCTCTGCCATCTCGCCCCTAATCCTCGAGCACTCTGGTATTGGTCTAAAGTCTGTCCTCGACCAGTTCAATATCACCCAGCTCGTCGAGCTTCCCGTCGGTCTCAATATGCAGGACCAGACCACCACCACTGTCCGCGCCCGAGCCAAGGCGTCTTCTGCTGGTCAGGGCCAGGCCGTCTACTTTGCCAACTTCACTGAGGTCTTTGGTGACTACTCCGCTCGAGCTACCGATTTACTCAACACCAAGCTCTCCCAGTGGGCCAACGAGACTGTTGCACGCGGAGGCTTCAACAACGCCACCGCTCTCTTAATCCAGTATGAGAACTACCGTAACTGGCTCCTGAACGAGGACGTTGCCTATGTCGAGCTTTTCCTCGACACCAACGGAAAGATGAACTTTGACTTGTGGGATCTCATCCCCTTCACGCGCGGCTCTACGCACATAGCACACGCCGACCCTTATCTGCAGTCCTTCTCCAACAATCCCATGTTCCTGTTGAACGAGCTTGACCTTCTTGGCCAGGCTGCTGGCTCGATGCTGGCTCGTGAGATCCAGAACTCGGGTGAGCTGGCCAACTACTTTGACGGCGAGGATATCCCCGGGGCAAATCTCTTGCCCTACAACGCTACCCTCGATGGCTGGGTTGGATATGTCAAGCAGAACTTTCGTGCCAACTGGCACGCTGTCGGGACTTGTTCTATGATGTCCCGGGAGCTTGGTGGTGTTGTTGATCCTACGGCCAAGGTCTACGGTACCCAGGGTCTTCGTGTCATTGATGGTTCTATTCCACCCACCCAGGTGTCATCTCACGTTATGACCGTTTTCTACGGTATGGCTTTGAAGATTGCCGATGCTGTTCTGGCTGACTACAAGCCC。
BLAST alignment is carried out on a glucose oxidase M5GOD gene sequence and an deduced amino acid sequence in NCBI, and the identity of the gene and the glucose oxidase amino acid sequence derived from penicillium is 74%. Indicating that M5GOD is a novel glucose oxidase.
Further, a recombinant vector comprising the gene encoding glucose oxidase described above.
Preferably: the recombinant vector is pPIC ZaA-M5 GOD.
The glucose oxidase gene of the invention is inserted between proper restriction enzyme cutting sites of an expression vector, so that the nucleotide sequence of the glucose oxidase gene is operably connected with an expression regulation sequence. As a most preferred embodiment of the present invention, it is preferred that the recombinant yeast expression plasmid pPIC ZaA-M5GOD is obtained by inserting a glucose oxidase gene between EcoR1 and Not1 restriction sites on the plasmid pPIC ZaA so that the nucleotide sequence is located downstream of and under the control of the promoter.
Further: a recombinant strain comprising the gene encoding glucose oxidase or the recombinant vector.
Preferably: the recombinant strain is Pichia pastoris X33/M5 GOD.
Preferably, the host cell is a pichia cell, and the recombinant yeast expression plasmid is transformed into the pichia cell (pichia pastoris) to obtain the recombinant strain X33/M5 GOD.
Further: the application of the glucose oxidase M5GOD in food preservation.
Further: the gene, the recombinant vector or the recombinant strain can be applied to the industrial production of glucose oxidase.
Further: a method of making glucose oxidase M5GOD comprising the steps of:
1) transforming host cells by using the recombinant vector to obtain a recombinant strain;
2) culturing the recombinant strain, inducing the expression of glucose oxidase, and collecting supernatant;
3) and recovering and purifying the supernatant to obtain the glucose oxidase M5 GOD.
The invention clones a new glucose oxidase gene from penicillium, the glucose oxidase coded by the gene has higher enzyme activity under acidic and neutral conditions, and the glucose oxidase has better low-temperature-adapting performance.
Compared with the prior art, the technical effect is to provide the glucose oxidase suitable for low temperature, the gene for coding the glucose oxidase, the recombinant vector containing the glucose oxidase, the recombinant strain containing the glucose oxidase gene, the method for preparing the glucose oxidase and the application of the glucose oxidase.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.
FIG. 1 is a schematic diagram of the optimum pH value of recombinant glucose oxidase.
FIG. 2 is a schematic of pH stability of recombinant glucose oxidase.
FIG. 3 is a schematic diagram of the optimal reaction temperature of recombinant glucose oxidase.
FIG. 4 is a schematic thermal stability of recombinant glucose oxidase.
FIG. 5 is a schematic representation of the volatile basic nitrogen content of recombinant glucose oxidase for use in preservation applications.
FIG. 6 is a graphical representation of the total number of colonies for recombinant glucose oxidation for use in preservation applications.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The embodiment of the invention discloses a glucose oxidase M5GOD and a coding gene and application thereof.
Experimental materials and reagents:
strains and vectors:
coli DH5a, Pichia pastoris X33, vector pPIC ZaA were purchased from Invitrogen.
Enzymes and other biochemical reagents:
restriction enzymes and ligases were purchased from companies; the others are all domestic biochemical reagents.
Culture medium:
seed medium (/ L): NaNO32g，K2HPO41g，KCl 0.5g，MgSO40.01g and 30g of cane sugar;
coli culture medium LB: 1% peptone, 0.5% yeast extract, 1% NaCl, ph 7.0;
yeast medium YPD: 2% tryptone, 1% yeast powder and 2% glucose;
BMGY medium: 1% yeast extract, 2% peptone, 1.34% YNB, 0.00004% Biotin, 1% glycerol (V/V);
BMMY medium: the components were identical to BMGY, pH4.0, except that 0.5% methanol was used instead of glycerol.
Description of the drawings: the molecular biological experiments, which are not specifically described in the following examples, were performed by referring to the specific methods listed in molecular cloning, a manual, third edition, J. SammBruke, or according to the kit and product instructions.
Example 1
Cloning of glucose oxidase coding gene M5GOD in penicillium
Extracting penicillium genome DNA:
culturing Penicillium by seed culture medium for 5 days, filtering with sterile filter paper, grinding for 5min, adding 2ml extractive solution, placing the grinding solution in centrifuge tube, and extracting with genome extraction kit.
Primers F1 and R1 were designed and synthesized according to the glucose oxidase gene sequence:
F1：5'-AGAGAGGCTGAAGCTGAATTCCAGGGCTTCACTCCAGCCG-3'，SEQ ID NO.7；
according to the principle of designing a recombined and connected primer, the designed primer sequence is a fusion primer, and the sequence of 'AGAGAGGCTGAAGCTGAATTC' at the front end is the gene sequence of the pPIC ZaA vector at the connection position of the pPIC ZaA vector and the target gene at the enzyme cutting site of EcoR 1.
R1：5'-TGTTCTAGAAAGCTGGCGGCCGCTTAGGGCTTGTAGTCAGCCAGAA-3'，SEQ ID NO.8。
Wherein the "TGTTCTAGAAAGCTGGCGGCCGC" sequence at the front end is the gene sequence of the pPIC ZaA vector at the junction of the pPIC ZaA vector and the target gene at the Not1 cleavage site.
Amplification was performed using the total DNA of Penicillium as template. The PCR reaction parameters are as follows: pre-denaturation at 94 ℃ for 5min, then denaturation at 94 ℃ for 30sec, annealing at 56 ℃ for 30sec, extension at 72 ℃ for 2min, and heat preservation at 72 ℃ for 10min after 30 cycles. The fragment was recovered, ligated with vector pPIC ZaA, transformed and sequenced by Biotech Co., Ltd, Borneo, Beijing.
Example 2
Construction of glucose oxidase engineering strain
(1) Construction of expression vector and expression in Pichia pastoris
Carrying out double enzyme digestion (EcoR 1 and Not 1) on the expression vector pPIC ZaA, simultaneously carrying out double enzyme digestion (EcoR 1 and Not 1) on M5GOD encoding glucose oxidase, cutting out a gene segment encoding mature glucose oxidase, connecting the gene segment with the expression vector pPICZaA to construct a yeast expression vector pPIC ZaA-M5GOD, transferring the yeast expression vector pPIC ZaA-M5GOD into an escherichia coli competent cell DH5a, selecting a positive transformant for DNA sequencing, and using the transformant with a correct sequence for preparing a large amount of recombinant plasmids by sequencing. The plasmid vector DNA is expressed linearly by using a restriction enzyme Sac1, yeast X33 competent cells are transformed by electric shock, the transformed cells are coated on a YPD plate and cultured at 30 ℃ for 2-3 days, and transformants growing on the plate are selected for further expression experiments, wherein the specific operation refers to a Pichia pastoris expression operation manual.
Recombinant expression comprising a signal peptide sequence was constructed in the same manner, specifically:
primers F2 and R1 were designed and synthesized according to the glucose oxidase gene sequence:
F2：5'-AGAGAGGCTGAAGCTGAATTCATGAAGTCCATCATTCTTGCCTC-3'，SEQ ID NO.9；
R1：5'-TGTTCTAGAAAGCTGGCGGCCGCTTAGGGCTTGTAGTCAGCCAGAA-3'，SEQ ID NO.8。
amplification was performed using the total DNA of Penicillium as template. The PCR reaction parameters are as follows: pre-denaturation at 94 ℃ for 5min, then denaturation at 94 ℃ for 30sec, annealing at 56 ℃ for 30sec, extension at 72 ℃ for 2min, and heat preservation at 72 ℃ for 10min after 30 cycles. The fragment was recovered, ligated with vector pPIC ZaA, transformed and sequenced by Biotech Co., Ltd, Borneo, Beijing.
(2) Screening of transformants having high glucose oxidase Activity
A single colony was picked from the plate with the transformant by using a sterilized toothpick, and spotted on the plate first according to the number, and the plate was cultured in an incubator at 30 ℃ for 2 days until the colony grew out. Selecting transformants from the plate according to the number, inoculating the transformants into 3ml of BMGY culture medium, carrying out shake culture at 30 ℃ for 48h, centrifugally collecting thalli, adding 1ml of BMMY induction culture medium containing 1% methanol, continuing the 30 ℃ induction culture, sampling after 48h, detecting the enzyme activity of the supernatant of each strain, and screening out the transformants with high glucose oxidase activity.
Example 3
Fermentation of recombinant glucose oxidase in pichia pastoris
(1) Mass expression of recombinant glucose oxidase in shake flask
Inoculating the screened transformant with higher enzyme activity into 300ml of BMGY liquid medium, carrying out shake culture at 30 ℃ and 200rpm for 48h, and carrying out thallus enrichment; centrifuging at 4000 Xg for 5min, gently discarding supernatant, transferring the thallus into 100ml BMMY liquid culture medium containing 1% methanol, and performing induction culture at 30 deg.C and 200rpm for 72 h. During the induction culture period, methanol solution is supplemented every 24h to keep the final concentration of methanol at about 1%, and the supernatant is collected by centrifugation at 10000 Xg for 10 min. And (3) measuring the activity of the glucose oxidase, wherein the expression quantity of the recombinant glucose oxidase is 15U/ml.
(2) Purification of recombinant glucose oxidase
Collecting the supernatant of the recombinant glucose oxidase expressed by the shake flask, desalting and concentrating by using a 10kDa membrane package, and purifying by anion exchange column chromatography. So as to obtain the electrophoretically pure collection liquid as a sample for expressing the research of enzymology properties. And (3) determining the protein content of the purified enzyme solution by using a Coomassie brilliant blue method, and calculating to obtain the specific activity of the enzyme protein.
Example 4
Partial characterization of recombinant glucose oxidase
(1) Optimum pH and pH stability of glucose oxidase M5GOD
Purified samples of glucose oxidase of example 3 were assayed for enzyme activity at different pH values to determine their optimum pH. Preparing buffers for different pH values: glycine-hydrochloric acid buffer solution of pH 1.0-3.0; acetic acid-sodium acetate series buffer solution with pH4.0-6.0, Tris-hydrochloric acid series buffer solution with pH7.0-9.0, and purified glucose oxidase in different buffer systems.
Enzyme activity detection method of recombinant glucose oxidase
The enzyme activity of the glucose oxidase is measured by adopting a 4-aminoantipyrine spectrophotometry. Under the aerobic condition, hydrogen peroxide generated by catalytic glucose dehydrogenation, colorless reduced 4-aminoantipyrine and phenol generate red quinoneimine under the action of horseradish peroxidase, and the red quinoneimine has the maximum light absorption at 500 nm. Directly diluting the crude enzyme solution with buffer solutionTo about 10U/ml. 4 150X 15 tubes were taken, 2ml buffer, 0.3ml glucose, 0.4ml phenol, 0.1ml 4-aminoantipyrine, 0.1ml horseradish peroxidase were added, and preheated at 30 ℃ for 5 min. 0.1ml of distilled water was added to one tube and zeroed as a blank. The water bath was placed next to the spectrophotometer for ease of handling, 0.1ml of sample solution was added to the sample tube at which time the timing was started, and after vortex mixing the samples were immediately colorimeted using a 1cm cuvette at a wavelength of 500 nm. Absorbance value at 30sec is A0After reacting for 1min again, reading the absorbance value A1To give Δ A500＝A1-A0。
The enzyme activity calculation formula is as follows:
the enzyme activity X1(U/mL or U/g) in the sample was calculated according to the following formula:
X1＝ΔA500×f×B×1000/(887×t×A×d)＝33.82×ΔA500×f
in the formula:
f- -dilution of the enzyme solution
B- -volume of reaction solution (3ml)
1000- -extinction coefficient Unit conversion factor
887-extinction coefficient (L mol)-1·cm-1)
t- -reaction time (min), i.e. the time difference between the readings A1 and A0, is 1 min.
A- -addition of sample volume (0.1ml)
d- -thickness of the cuvette (cm)
The enzyme activity unit is defined as the enzyme amount which can oxidize β -D-glucose of 1umol per minute to generate D-gluconic acid and hydrogen peroxide under the conditions of pH6.0 and 30 ℃, and is defined as 1 enzyme activity unit (IU).
The results of the pH optima determined at 30 ℃ (see FIG. 1).
The pH value is 5.5, and the enzyme activity can be maintained at more than 60% within the pH value range of 4.0-7.0.
The enzyme solution was treated at 25 ℃ for 2h in buffers of different pH values, and the enzyme activity was measured at the optimum pH to investigate the pH stability of the enzyme. The analysis result shows that (see figure 2) the pH value is basically stable between 2.0 and 5.0, and the enzyme activity of more than 80 percent can be maintained. The enzyme activity can be kept about 60% after pH6.0 and 7.0 and treatment, which shows that the enzyme has better pH stability.
(2) Optimum temperature and thermal stability of glucose oxidase M5GOD
And (3) measuring the enzyme activity of the purified glucose oxidase sample at different temperatures of 5-70 ℃ under the condition that the pH value is 6.0. The analysis experiment result shows that the optimum reaction temperature of the enzyme is 30 ℃, and the enzyme still has more than 60 percent of enzyme activity between 20 ℃ and 50 ℃ (see figure 3).
The thermal stability is determined by treating glucose oxidase sample at different temperatures of 40 deg.C, 45 deg.C, 50 deg.C, and 55 deg.C for 5min, and determining enzyme activity at 30 deg.C. The thermostability experiment shows (see figure 4) that the glucose oxidase has substantially lost its enzymatic activity after treatment at 55 ℃.
Example 5
Preservation application experiment of recombinant glucose oxidase
Step 1, selecting fresh and live grass carps to die, removing heads, tails, internal organs, bones, scales and peels, and cleaning with sterile water;
and 2, cutting the fish meat by using a cutter subjected to boiling sterilization, wherein the cut fish meat is almost uniform in length, width and thickness and is randomly divided into 4 groups.
Step 3, soaking the clean fish meat in the mixed solution of glucose oxidase and glucose prepared in the embodiment 3 for a period of time; the enzyme activity of the glucose oxidase solution is 1U/ml, the glucose content is 4%, the ratio of the fish to the antistaling agent is 1: 1(kg/L), and the soaking time is 10 min.
Step 4, taking out the silk and draining the silk at room temperature;
and 5, subpackaging the mixture into polyethylene sterile fresh-keeping bags, and refrigerating and storing at 4 ℃.
Example 7
The recombinant glucose oxidase of the invention has the following influence on the quality of grass carp in the cold storage and fresh keeping of the grass carp:
the grass carp is preserved according to the example 6, and the colony count and the volatile basic nitrogen content are measured after 0, 2, 4, 6, 8 and 10d are taken out, and the results (see fig. 5 and 6) show that the colony count and the volatile basic nitrogen content of the grass carp treated by the glucose oxidase of the present invention are obviously lower than those of the blank control group in the cold storage time. And the preservation effect is evaluated in a sensory manner. The results are shown in Table 1.
TABLE 1
Figure BDA0002287984210000121
Figure BDA0002287984210000131
In conclusion, the glucose oxidase has high catalytic efficiency under the low-temperature condition, and can be effectively used for low-temperature preservation of aquatic products. When the method is applied to aquatic product preservation, the aquatic product can be deoxidized in the subsequent preservation process by soaking in the low-temperature glucose oxidase solution to generate H2O2Inhibit the reproduction of microorganisms, effectively inhibit deterioration, and maintain the elasticity of tissues. The low-temperature glucose oxidase has potential application value in aquatic product preservation.
The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other.
The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Sequence listing
<110> China oceanic university
Shanghao science & technology Limited
<120> glucose oxidase M5GOD and coding gene and application thereof
<160>9
<170>SIPOSequenceListing 1.0
<210>1
<211>605
<212>PRT
<213> glucose oxidase M5GOD (Penicillium)
<400>1
Met Lys Ser Ile Ile Leu Ala Ser Ala Leu Ala Ser Leu Ala Ala Ala
1 5 10 15
Gln Gly Phe Thr Pro Ala Glu Gln Ile Asp Val Gln Ala Ser Leu Ile
20 25 30
Ser Asp Pro Asn Lys Val Ala Gly Gln Thr Phe Asp Tyr Ile Ile Ala
35 40 45
Gly Gly Gly Leu Thr Gly Leu Thr Val Ala Ala Lys Leu Ser Glu Asn
50 55 60
Pro Asn Ile Thr Val Leu Val Ile Glu Lys Gly Phe Tyr Glu Ser Asn
65 70 75 80
Asn Gly Pro Ile Ile Glu Asn Pro Asn Asp Tyr Gly Leu Ile Phe Gly
85 90 95
Ser Ser Val Asp Gln Asn Tyr Leu Thr Val Pro Met Ala Ile Asn Asn
100 105 110
Arg Thr Leu Glu Val Lys Ser Gly Lys Gly Leu Gly Gly Ser Thr Leu
115 120 125
Ile Asn Gly Asp Ser Trp Thr Gly Pro Asp Lys Val Gln Ile Asp Ser
130 135 140
Trp Glu Thr Val Leu Gly Asn Thr Gly Trp Asn Tyr Asp Ala Leu Lys
145 150 155 160
Gly Tyr Met Lys Glu Ala Glu Leu Ala Arg Tyr Pro Thr Ala Ser Gln
165 170 175
Ile Ala Ala Gly Ile Tyr Phe Asn Glu Thr Cys His Gly Phe Asn Gly
180 185 190
Thr Val Asn Ala Gly Pro Arg Asp Asp Gly Thr Pro Tyr Ser Pro Leu
195 200 205
Met Lys Ala Leu Met Asn Thr Thr Ser Ala Lys Gly Val Pro Thr Gln
210 215 220
Leu Asp Phe Leu Cys Gly Arg Pro Arg Gly Val Ser Met Ile Tyr Asn
225 230 235 240
Asn Leu Leu Pro Asp Gln Thr Arg Ala Asp Ala Ala Arg Glu Trp Leu
245 250 255
Leu Pro Asn Tyr Lys Arg Pro Asn Leu Ser Ile Leu Thr Gly Gln Val
260 265 270
Val Gly Lys Val Leu Phe Thr Gln Thr Ala Thr Gly Pro Lys Ala Thr
275 280 285
Gly Val Asn Phe Gly Thr Asn Lys Ala Ile Asn Phe Asn Val Leu Ala
290 295 300
Lys His Glu Val Leu Leu Ala Ala Gly Ser Ala Ile Ser Pro Leu Ile
305 310 315 320
Leu Glu His Ser Gly Ile Gly Leu Lys Ser Val Leu Asp Gln Phe Asn
325 330 335
Ile Thr Gln Leu Val Glu Leu Pro Val Gly Leu Asn Met Gln Asp Gln
340 345 350
Thr Thr Thr Thr Val Arg Ala Arg Ala Lys Ala Ser Ser Ala Gly Gln
355 360 365
Gly Gln Ala Val Tyr Phe Ala Asn Phe Thr Glu Val Phe Gly Asp Tyr
370 375 380
Ser Ala Arg Ala Thr Asp Leu Leu Asn Thr Lys Leu Ser Gln Trp Ala
385 390 395 400
Asn Glu Thr Val Ala Arg Gly Gly Phe Asn Asn Ala Thr Ala Leu Leu
405 410 415
Ile Gln Tyr Glu Asn Tyr Arg Asn Trp Leu Leu Asn Glu Asp Val Ala
420 425 430
Tyr Val Glu Leu Phe Leu Asp Thr Asn Gly Lys Met Asn Phe Asp Leu
435 440 445
Trp Asp Leu Ile Pro Phe Thr Arg Gly Ser Thr His Ile Ala His Ala
450 455 460
Asp Pro Tyr Leu Gln Ser Phe Ser Asn Asn Pro Met Phe Leu Leu Asn
465 470 475 480
Glu Leu Asp Leu Leu Gly Gln Ala Ala Gly Ser Met Leu Ala Arg Glu
485 490 495
Ile Gln Asn Ser Gly Glu Leu Ala Asn Tyr Phe Asp Gly Glu Asp Ile
500 505 510
Pro Gly Ala Asn Leu Leu Pro Tyr Asn Ala Thr Leu Asp Gly Trp Val
515 520 525
Gly Tyr Val Lys Gln Asn Phe Arg Ala Asn Trp His Ala Val Gly Thr
530 535 540
Cys Ser Met Met Ser Arg Glu Leu Gly Gly Val Val Asp Pro Thr Ala
545 550 555 560
Lys Val Tyr Gly Thr Gln Gly Leu Arg Val Ile Asp Gly Ser Ile Pro
565 570 575
Pro Thr Gln Val Ser Ser His Val Met Thr Val Phe Tyr Gly Met Ala
580 585 590
Leu Lys Ile Ala Asp Ala Val Leu Ala Asp Tyr Lys Pro
595 600 605
<210>2
<211>589
<212>PRT
<213> glucose oxidase M5GOD (Penicillium)
<400>2
Gln Gly Phe Thr Pro Ala Glu Gln Ile Asp Val Gln Ala Ser Leu Ile
1 5 10 15
Ser Asp Pro Asn Lys Val Ala Gly Gln Thr Phe Asp Tyr Ile Ile Ala
20 25 30
Gly Gly Gly Leu Thr Gly Leu Thr Val Ala Ala Lys Leu Ser Glu Asn
35 40 45
Pro Asn Ile Thr Val Leu Val Ile Glu Lys Gly Phe Tyr Glu Ser Asn
50 55 60
Asn Gly Pro Ile Ile Glu Asn Pro Asn Asp Tyr Gly Leu Ile Phe Gly
65 70 75 80
Ser Ser Val Asp Gln Asn Tyr Leu Thr Val Pro Met Ala Ile Asn Asn
85 90 95
Arg Thr Leu Glu Val Lys Ser Gly Lys Gly Leu Gly Gly Ser Thr Leu
100 105 110
Ile Asn Gly Asp Ser Trp Thr Gly Pro Asp Lys Val Gln Ile Asp Ser
115 120 125
Trp Glu Thr Val Leu Gly Asn Thr Gly Trp Asn Tyr Asp Ala Leu Lys
130 135 140
Gly Tyr Met Lys Glu Ala Glu Leu Ala Arg Tyr Pro Thr Ala Ser Gln
145 150 155 160
Ile Ala Ala Gly Ile Tyr Phe Asn Glu Thr Cys His Gly Phe Asn Gly
165 170 175
Thr Val Asn Ala Gly Pro Arg Asp Asp Gly Thr Pro Tyr Ser Pro Leu
180 185 190
Met Lys Ala Leu Met Asn Thr Thr Ser Ala Lys Gly Val Pro Thr Gln
195 200 205
Leu Asp Phe Leu Cys Gly Arg Pro Arg Gly Val Ser Met Ile Tyr Asn
210 215 220
Asn Leu Leu Pro Asp Gln Thr Arg Ala Asp Ala Ala Arg Glu Trp Leu
225 230 235 240
Leu Pro Asn Tyr Lys Arg Pro Asn Leu Ser Ile Leu Thr Gly Gln Val
245 250 255
Val Gly Lys Val Leu Phe Thr Gln Thr Ala Thr Gly Pro Lys Ala Thr
260 265 270
Gly Val Asn Phe Gly Thr Asn Lys Ala Ile Asn Phe Asn Val Leu Ala
275 280 285
Lys His Glu Val Leu Leu Ala Ala Gly Ser Ala Ile Ser Pro Leu Ile
290 295 300
Leu Glu His Ser Gly Ile Gly Leu Lys Ser Val Leu Asp Gln Phe Asn
305 310 315 320
Ile Thr Gln Leu Val Glu Leu Pro Val Gly Leu Asn Met Gln Asp Gln
325 330 335
Thr Thr Thr Thr Val Arg Ala Arg Ala Lys Ala Ser Ser Ala Gly Gln
340 345 350
Gly Gln Ala Val Tyr Phe Ala Asn Phe Thr Glu Val Phe Gly Asp Tyr
355 360 365
Ser Ala Arg Ala Thr Asp Leu Leu Asn Thr Lys Leu Ser Gln Trp Ala
370 375 380
Asn Glu Thr Val Ala Arg Gly Gly Phe Asn Asn Ala Thr Ala Leu Leu
385 390 395 400
Ile Gln Tyr Glu Asn Tyr Arg Asn Trp Leu Leu Asn Glu Asp Val Ala
405 410 415
Tyr Val Glu Leu Phe Leu Asp Thr Asn Gly Lys Met Asn Phe Asp Leu
420 425 430
Trp Asp Leu Ile Pro Phe Thr Arg Gly Ser Thr His Ile Ala His Ala
435 440 445
Asp Pro Tyr Leu Gln Ser Phe Ser Asn Asn Pro Met Phe Leu Leu Asn
450 455 460
Glu Leu Asp Leu Leu Gly Gln Ala Ala Gly Ser Met Leu Ala Arg Glu
465 470 475 480
Ile Gln Asn Ser Gly Glu Leu Ala Asn Tyr Phe Asp Gly Glu Asp Ile
485 490 495
Pro Gly Ala Asn Leu Leu Pro Tyr Asn Ala Thr Leu Asp Gly Trp Val
500 505 510
Gly Tyr Val Lys Gln Asn Phe Arg Ala Asn Trp His Ala Val Gly Thr
515 520 525
Cys Ser Met Met Ser Arg Glu Leu Gly Gly Val Val Asp Pro Thr Ala
530 535 540
Lys Val Tyr Gly Thr Gln Gly Leu Arg Val Ile Asp Gly Ser Ile Pro
545 550 555 560
Pro Thr Gln Val Ser Ser His Val Met Thr Val Phe Tyr Gly Met Ala
565 570 575
Leu Lys Ile Ala Asp Ala Val Leu Ala Asp Tyr Lys Pro
580 585
<210>3
<211>1815
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
atgaagtcca tcattcttgc ctctgccctc gcctctctag ctgcagccca gggcttcact 60
ccagccgagc agattgatgt ccaggccagc ctgatctccg accctaacaa ggtcgccggc 120
cagacattcg actacatcat cgctggaggt ggtctgacag gtcttaccgt tgcggccaag 180
ctgtctgaga accctaacat caccgtcctt gtcatcgaaa agggcttcta cgagtccaat 240
aatgggccca tcatcgaaaa ccccaacgac tatggcttga tcttcggtag ctctgttgac 300
caaaactacc tcaccgttcc catggccatc aacaaccgta ccctggaagt caagtctggc 360
aagggtctcg gtggttccac gttgattaac ggtgactcct ggaccggtcc cgacaaggtc 420
cagattgact cctgggagac tgtcttggga aataccggtt ggaactatga cgccctcaag 480
gggtacatga aggaagccga gcttgctcgt tacccaaccg ccagtcagat tgccgccggt 540
atctacttca acgaaacctg ccatggattc aacggcaccg ttaacgccgg accccgtgat 600
gatggtaccc cttactctcc ccttatgaaa gccctcatga acaccacctc tgccaagggt 660
gttcccactc agcttgactt cctctgcggt cgccctcgtg gtgtctccat gatctacaac 720
aacttgctgc ctgaccagac ccgtgcggat gctgctcgcg agtggcttct tcccaactat 780
aagcgcccca acttgagcat tcttaccggc caggttgttg gaaaggttct cttcactcaa 840
accgcgactg gccccaaggc tactggtgtt aattttggca ccaacaaggc catcaatttc 900
aacgtcttgg ccaagcacga ggtccttttg gctgctggct ctgccatctc gcccctaatc 960
ctcgagcact ctggtattgg tctaaagtct gtcctcgacc agttcaatat cacccagctc 1020
gtcgagcttc ccgtcggtct caatatgcag gaccagacca ccaccactgt ccgcgcccga 1080
gccaaggcgt cttctgctgg tcagggccag gccgtctact ttgccaactt cactgaggtc 1140
tttggtgact actccgctcg agctaccgat ttactcaaca ccaagctctc ccagtgggcc 1200
aacgagactg ttgcacgcgg aggcttcaac aacgccaccg ctctcttaat ccagtatgag 1260
aactaccgta actggctcct gaacgaggac gttgcctatg tcgagctttt cctcgacacc 1320
aacggaaaga tgaactttga cttgtgggat ctcatcccct tcacgcgcgg ctctacgcac 1380
atagcacacg ccgaccctta tctgcagtcc ttctccaaca atcccatgtt cctgttgaac 1440
gagcttgacc ttcttggcca ggctgctggc tcgatgctgg ctcgtgagat ccagaactcg 1500
ggtgagctgg ccaactactt tgacggcgag gatatccccg gggcaaatct cttgccctac 1560
aacgctaccc tcgatggctg ggttggatat gtcaagcaga actttcgtgc caactggcac 1620
gctgtcggga cttgttctat gatgtcccgg gagcttggtg gtgttgttga tcctacggcc 1680
aaggtctacg gtacccaggg tcttcgtgtc attgatggtt ctattccacc cacccaggtg 1740
tcatctcacg ttatgaccgt tttctacggt atggctttga agattgccga tgctgttctg 1800
gctgactaca agccc 1815
<210>4
<211>1767
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
cagggcttca ctccagccga gcagattgat gtccaggcca gcctgatctc cgaccctaac 60
aaggtcgccg gccagacatt cgactacatc atcgctggag gtggtctgac aggtcttacc 120
gttgcggcca agctgtctga gaaccctaac atcaccgtcc ttgtcatcga aaagggcttc 180
tacgagtcca ataatgggcc catcatcgaa aaccccaacg actatggctt gatcttcggt 240
agctctgttg accaaaacta cctcaccgtt cccatggcca tcaacaaccg taccctggaa 300
gtcaagtctg gcaagggtct cggtggttcc acgttgatta acggtgactc ctggaccggt 360
cccgacaagg tccagattga ctcctgggag actgtcttgg gaaataccgg ttggaactat 420
gacgccctca aggggtacat gaaggaagcc gagcttgctc gttacccaac cgccagtcag 480
attgccgccg gtatctactt caacgaaacc tgccatggat tcaacggcac cgttaacgcc 540
ggaccccgtg atgatggtac cccttactct ccccttatga aagccctcat gaacaccacc 600
tctgccaagg gtgttcccac tcagcttgac ttcctctgcg gtcgccctcg tggtgtctcc 660
atgatctaca acaacttgct gcctgaccag acccgtgcgg atgctgctcg cgagtggctt 720
cttcccaact ataagcgccc caacttgagc attcttaccg gccaggttgt tggaaaggtt 780
ctcttcactc aaaccgcgac tggccccaag gctactggtg ttaattttgg caccaacaag 840
gccatcaatt tcaacgtctt ggccaagcac gaggtccttt tggctgctgg ctctgccatc 900
tcgcccctaa tcctcgagca ctctggtatt ggtctaaagt ctgtcctcga ccagttcaat 960
atcacccagc tcgtcgagct tcccgtcggt ctcaatatgc aggaccagac caccaccact 1020
gtccgcgccc gagccaaggc gtcttctgct ggtcagggcc aggccgtcta ctttgccaac 1080
ttcactgagg tctttggtga ctactccgct cgagctaccg atttactcaa caccaagctc 1140
tcccagtggg ccaacgagac tgttgcacgc ggaggcttca acaacgccac cgctctctta 1200
atccagtatg agaactaccg taactggctc ctgaacgagg acgttgccta tgtcgagctt 1260
ttcctcgaca ccaacggaaa gatgaacttt gacttgtggg atctcatccc cttcacgcgc 1320
ggctctacgc acatagcaca cgccgaccct tatctgcagt ccttctccaa caatcccatg 1380
ttcctgttga acgagcttga ccttcttggc caggctgctg gctcgatgct ggctcgtgag 1440
atccagaact cgggtgagct ggccaactac tttgacggcg aggatatccc cggggcaaat 1500
ctcttgccct acaacgctac cctcgatggc tgggttggat atgtcaagca gaactttcgt 1560
gccaactggc acgctgtcgg gacttgttct atgatgtccc gggagcttgg tggtgttgtt 1620
gatcctacgg ccaaggtcta cggtacccag ggtcttcgtg tcattgatgg ttctattcca 1680
cccacccagg tgtcatctca cgttatgacc gttttctacg gtatggcttt gaagattgcc 1740
gatgctgttc tggctgacta caagccc 1767
<210>5
<211>16
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>5
Met Lys Ser Ile Ile Leu Ala Ser Ala Leu Ala Ser Leu Ala Ala Ala
1 5 10 15
<210>6
<211>48
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
atgaagtcca tcattcttgc ctctgccctc gcctctctag ctgcagcc 48
<210>7
<211>40
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
agagaggctg aagctgaatt ccagggcttc actccagccg 40
<210>8
<211>46
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
tgttctagaa agctggcggc cgcttagggc ttgtagtcag ccagaa 46
<210>9
<211>44
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
agagaggctg aagctgaatt catgaagtcc atcattcttg cctc 44

Claims (10)

1. The glucose oxidase M5GOD is characterized in that the amino acid sequence is shown as SEQ ID NO. 2.
2. A gene encoding the glucose oxidase of claim 1, wherein the nucleotide sequence of the gene is shown in SEQ ID No. 4.
3. A recombinant vector comprising the gene encoding glucose oxidase of claim 2.
4. The recombinant vector according to claim 3, wherein the recombinant vector is pPIC ZaA-M5 GOD.
5. The recombinant vector according to claim 4, wherein the recombinant vector pPIC ZaA-M5GOD is prepared by inserting a gene of glucose oxidase between restriction sites EcoR1 and Not1 on the plasmid pPIC ZaA, and allowing the nucleotide sequence to be located downstream of and under the control of a promoter to obtain the recombinant yeast expression plasmid pPIC ZaA-M5 GOD.
6. A recombinant strain comprising the gene encoding glucose oxidase of claim 2 or the recombinant vector of claim 3 or 4.
7. The recombinant strain of claim 6, wherein the recombinant strain is Pichia pastoris X33/M5 GOD: transforming pichia pastoris cells by recombinant yeast expression plasmid pPIC ZaA-M5 GOD.
8. Use of the glucose oxidase M5GOD according to claim 1 for food preservation.
9. Use of the gene of claim 2, the recombinant vector of claim 3 or 4, or the recombinant strain of claim 5 or 6 for the industrial production of glucose oxidase.
10. The method of producing glucose oxidase M5GOD according to claim 1, comprising the steps of:
1) transforming a host cell with the recombinant vector of claim 3 or 4 to obtain a recombinant strain;
2) culturing the recombinant strain, inducing the expression of glucose oxidase, and collecting supernatant;
3) recovering and purifying the supernatant to obtain glucose oxidase M5 GOD.
CN201911168042.5A 2019-11-25 2019-11-25 Glucose oxidase M5GOD and coding gene and application thereof Active CN110885801B (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CN201911168042.5A CN110885801B (en) 2019-11-25 2019-11-25 Glucose oxidase M5GOD and coding gene and application thereof
PCT/CN2019/123895 WO2021103123A1 (en) 2019-11-25 2019-12-09 Glucose oxidase m5god, coding gene thereof and application thereof
AU2019385785A AU2019385785B2 (en) 2019-11-25 2019-12-09 Glucose oxidase M5GOD and coding genes and applications thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911168042.5A CN110885801B (en) 2019-11-25 2019-11-25 Glucose oxidase M5GOD and coding gene and application thereof

Publications (2)

Publication Number Publication Date
CN110885801A true CN110885801A (en) 2020-03-17
CN110885801B CN110885801B (en) 2021-04-30

Family

ID=69748720

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911168042.5A Active CN110885801B (en) 2019-11-25 2019-11-25 Glucose oxidase M5GOD and coding gene and application thereof

Country Status (3)

Country Link
CN (1) CN110885801B (en)
AU (1) AU2019385785B2 (en)
WO (1) WO2021103123A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103275942A (en) * 2013-04-03 2013-09-04 北京挑战生物技术有限公司 Glucose oxidase GODJ4A, and gene and application thereof
CN108220262A (en) * 2018-02-26 2018-06-29 大连大学 A kind of marine low temperature glucose oxidase and its application in seafood freshing
CN109652390A (en) * 2019-02-25 2019-04-19 大连大学 A kind of marine low temperature glucose oxidase and its application

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101481680B (en) * 2009-01-19 2011-06-22 崔增学 Production method of glucose oxidase
CN103981158A (en) * 2009-12-05 2014-08-13 天野酶株式会社 Mutant enzyme and application thereof
CN101955953A (en) * 2010-09-09 2011-01-26 中国农业科学院生物技术研究所 Glucose oxidase mutant gene, expression and application thereof
FR2979918B1 (en) * 2011-09-08 2013-12-27 Centre Nat Rech Scient AMAGASAKIENSE PENICILLIUM GLUCOSE OXIDASE MUTANTS
CN103981159B (en) * 2014-06-05 2016-04-13 青岛蔚蓝生物集团有限公司 A kind of glucose oxidase enzyme mutant and application thereof
CN104711274B (en) * 2015-03-17 2019-01-29 中国科学院微生物研究所 A kind of preparation method and applications recombinating penicillium amagasakiense glucose oxidase
CN105420252A (en) * 2015-12-07 2016-03-23 河北省微生物研究所 Glucose oxidase gene GOD, protein coded by GOD, pichia pastoris transformed by GOD and preparation method of pichia pastoris

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103275942A (en) * 2013-04-03 2013-09-04 北京挑战生物技术有限公司 Glucose oxidase GODJ4A, and gene and application thereof
CN108220262A (en) * 2018-02-26 2018-06-29 大连大学 A kind of marine low temperature glucose oxidase and its application in seafood freshing
CN109652390A (en) * 2019-02-25 2019-04-19 大连大学 A kind of marine low temperature glucose oxidase and its application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
FILL ET AL: "Glucose oxidase [Penicillium brasilianum]，OOQ88750.1", 《GENBANK》 *
VRIES ET AL: "Glucose oxidase [Penicillium subrubescens]，OKO89536.1", 《GENBANK》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023225459A2 (en) 2022-05-14 2023-11-23 Novozymes A/S Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections

Also Published As

Publication number Publication date
AU2019385785A1 (en) 2021-06-10
CN110885801B (en) 2021-04-30
AU2019385785B2 (en) 2022-11-03
WO2021103123A1 (en) 2021-06-03

Similar Documents

Publication Publication Date Title
CN112813052B (en) Exo-inulase mutant MutDP121ET6 with improved low-temperature activity
CN112831485B (en) Low-temperature activity improved exoinulase mutant MutDR121EH9
CN112646793B (en) Inulase mutant MutS120D with improved low-temperature adaptability and salt adaptability and application thereof
CN112725305B (en) Thermohaline-sensitive inulase mutant MutY119D and preparation method thereof
CN112725306B (en) Inulase mutant MutY119T with changed thermal salinity and application thereof
CN112708607B (en) Inulase mutant MutS120R with changed thermal adaptability and application thereof
CN112725304B (en) Low-temperature inulase exonuclease mutant MutAP122EK5 and application thereof
CN112725310B (en) Thermolabile low-temperature exoinulase mutant MutG360 delta 9
CN112980813B (en) Low-temperature modified exoinulase mutant MutS117G
CN112852782B (en) Low-temperature adaptive improved low Wen Waiqie inulase mutant MutDL121EK5 and application thereof
CN112646794A (en) Exoinulase mutant MutY119V with improved low-temperature activity
CN112725307B (en) Low-temperature inulase exonuclease mutant MutG169 delta 4 with reduced heat resistance and application thereof
CN112813054A (en) Inulase mutant MutS117N with changed low-temperature salt tolerance and application thereof
CN112646792A (en) Low-temperature inulase exonuclease mutant MutA122 delta 5 with reduced thermal stability and application
CN112813053A (en) Inulase mutant MutY119H and preparation method thereof
CN112813050B (en) Exo-inulinase mutant MutP126Q with reduced thermostability
CN108118037B (en) Glucose oxidase mutant with improved heat resistance
EP3978602A1 (en) Thermostable glucose oxidase
CN114480445B (en) Preparation and application of human superoxide dismutase hSOD1 mutant
CN108118036B (en) Novel glucose oxidase mutant
CN110885801B (en) Glucose oxidase M5GOD and coding gene and application thereof
CN112143717B (en) Glucose oxidase mutant with improved specific activity
CN109423483B (en) Glucose oxidase mutant
JP6991423B2 (en) Glucose oxidase CnGODA and its genes and their use
CN109207446B (en) Glucose oxidase mutant

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant