CN108118037B

CN108118037B - Glucose oxidase mutant with improved heat resistance

Info

Publication number: CN108118037B
Application number: CN201611064282.7A
Authority: CN
Inventors: 吴秀秀; 邵弨
Original assignee: Qingdao Vland Biotech Group Co Ltd
Current assignee: Qingdao Vland Biotech Group Co Ltd
Priority date: 2016-11-28
Filing date: 2016-11-28
Publication date: 2021-08-31
Anticipated expiration: 2036-11-28
Also published as: CN108118037A

Abstract

The invention relates to the technical field of gene modification, and particularly provides a glucose oxidase mutant with improved heat resistance. Compared with the wild type, the heat resistance of the glucose oxidase mutant is greatly improved, the residual enzyme activity after 10min treatment at 60 ℃ is improved by 11.3-66.9%, and the residual enzyme activity after 5min treatment at 65 ℃ is improved by 23.7-105.5%, so that the glucose oxidase mutant is beneficial to wide application of the glucose oxidase in feeds, and has wide market prospect.

Description

Glucose oxidase mutant with improved heat resistance

Technical Field

The invention belongs to the technical field of gene modification, and particularly relates to a glucose oxidase mutant with improved heat resistance.

Background

Glucose oxidase is an aerobic dehydrogenase, which specifically oxidizes β -D-glucose to produce gluconic acid and hydrogen peroxide. Glucose oxidase, which is usually combined with catalase as a redox system, oxidizes β -D-glucose in the presence of molecular oxygen to produce D-gluconolactone, while consuming oxygen to produce hydrogen peroxide. Catalase decomposes hydrogen peroxide to produce water and 1/2 oxygen, which in turn combines with gluconolactone to produce gluconic acid. Glucose oxidase exhibits strong specificity for β -D-glucopyranose, the hydroxyl group on the glucose molecule C1 is critical for the catalytic activity of the enzyme, and is 160 times higher when the hydroxyl group is in the β position than in the α position. Glucose oxidase has no activity on L-glucose and 2-O-methyl-D-glucose at all.

Because of the oxygen removal and oxidation resistance of the glucose oxidase, the glucose oxidase can be widely applied to the aspects of food, medicine, feed and the like. In the food industry, glucose oxidase has obvious effects on preventing beer from aging, keeping the original flavor of the product and prolonging the shelf life as a food preservative, and can also be used as a flour improver and a bread quality improver to improve the quality of the food. In the field of medicine, hospitals in China commonly adopt a glucose oxidase electrode method, a glucose oxidase-peroxidase coupling method and the like to detect the content of glucose in blood and serum. As a novel feed additive, the glucose oxidase can improve the intestinal environment of animals, regulate the digestion of feed and promote the growth of the animals.

Glucose oxidase is widely distributed in animals, plants and microorganisms, and is produced by mainly using aspergillus niger or penicillium industrially, but the problems of low enzyme activity, poor stability, impurity protein pollution, complicated separation and purification and the like often occur. Because a short high-temperature stage of 80-90 ℃ exists in the particle production process at present. The glucose oxidase from aspergillus niger has poor thermal stability, and the residual enzyme activity of the aqueous solution is lower than 40 percent after the aqueous solution is kept for 5 minutes at 65 ℃, so that the application of the enzyme in pellet feed is limited. At present, the method of spraying glucose oxidase liquid on the feed after feed granulation is adopted not only increases the equipment investment, but also cannot ensure the stability of the enzyme preparation and the distribution uniformity of the enzyme preparation in the feed. Therefore, the improvement of the thermal stability of the glucose oxidase has important practical significance on the current glucose oxidase for the feed.

Disclosure of Invention

The invention aims to provide a glucose oxidase mutant which has obviously improved heat resistance and is beneficial to wide application in the field of feed.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a glucose oxidase mutant, which has any one of amino acid sequences shown in (I), (II) or (III):

(I) a sequence having at least 95% homology with the amino acid sequence of glucose oxidase SEQ ID NO: 1;

(II) an amino acid sequence which has at least one immune epitope of the glucose oxidase described in the (I) and is obtained by modifying, substituting, deleting or adding one or more amino acids in the amino acid sequence of the glucose oxidase;

(III) an amino acid sequence encoded by a nucleotide sequence shown by SEQ ID NO:2 or a complementary sequence thereof or a sequence that differs from the nucleotide sequence shown by SEQ ID NO:2 or a complementary sequence thereof due to degeneracy of the genetic code;

in other embodiments of the invention, the substitution is a substitution of 1 amino acid.

In other embodiments of the invention, the substitution comprises a substitution at any one of amino acids 194, 200, 202, 219, 251, 254, 255, 258, 275, 276, 281, 290, 294, 303, 304, 305, 313, 338, 339, 349, 358, 360, 362, 372, 385 of the glucose oxidase having the amino acid sequence of SEQ ID NO. 1.

In other embodiments of the invention, the substitution comprises changing the amino acid at position 194 from R to L.

In other embodiments of the invention, the substitution comprises changing the amino acid at position 200 from K to a, or D, or E.

In other embodiments of the invention, the substitution comprises changing amino acid 202 from F to P.

In other embodiments of the invention, the substitution comprises changing amino acid 219 from E to P.

In other embodiments of the invention, the substitution comprises a change of amino acid 251 from V to I.

In other embodiments of the invention, the substitution comprises changing amino acid 254 from S to D, or K, or Y.

In other embodiments of the invention, the substitution comprises changing amino acid 255 from Q to F, or K.

In other embodiments of the invention, the substitution comprises a change of amino acid 258 from T to D, or E, or K.

In other embodiments of the invention, the substitution comprises changing amino acid 275 from H to F, or Y.

In other embodiments of the invention, the substitution comprises changing amino acid 276 from N to E, or K, or T, or Y.

In other embodiments of the invention, the substitution comprises changing the amino acid at position 281 from H to K, or R.

In other embodiments of the invention, the substitution comprises changing amino acid 290 from a to L.

In other embodiments of the invention, the substitution comprises a change from T to L at amino acid 294.

In other embodiments of the invention, the substitution comprises a change of amino acid 303 from M to D.

In other embodiments of the invention, the substitution comprises changing amino acid position 304 from K to P.

In other embodiments of the invention, the substitution comprises changing the amino acid at position 305 from S to D, or P, or R.

In other embodiments of the invention, the substitution comprises changing amino acid 313 from D to P.

In other embodiments of the invention, the substitution comprises a change from S to P at amino acid position 338.

In other embodiments of the invention, the substitution comprises changing amino acid 339 from a to D.

In other embodiments of the invention, the substitution comprises changing the amino acid 349 to Y.

In other embodiments of the invention, the substitution comprises changing amino acid 358 from D to P.

In other embodiments of the invention, the substitution comprises a change of amino acid 360 from S to A.

In other embodiments of the invention, the substitution comprises changing amino acid 362 from K to F, or L.

In other embodiments of the invention, the substitution comprises changing amino acid 372 from E to P.

In other embodiments of the invention, the substitution comprises changing amino acid 385 from H to D, or L.

The invention also provides application of the glucose oxidase mutant in feed.

The invention also provides a recombinant expression vector with the DNA molecule.

The invention also provides a host cell comprising the recombinant expression vector.

In some embodiments of the invention, the host cell is pichia pastoris.

The heat resistance of the glucose oxidase single-point mutant provided by the invention is generally higher than that of a wild type, the residual enzyme activity is improved by 11.3-66.9% after the glucose oxidase single-point mutant is treated at 60 ℃ for 10min, and the residual enzyme activity is improved by 23.7-105.5% after the glucose oxidase single-point mutant is treated at 65 ℃ for 5 min. Therefore, the heat resistance of the glucose oxidase is greatly improved due to the single-point mutation, and the single-point mutation is more suitable for being used as a feed additive than a wild type, is beneficial to wide application of the glucose oxidase in feed, and has wide market prospect.

The specific implementation mode is as follows:

the present invention uses conventional techniques and methods used IN the fields of genetic engineering and MOLECULAR BIOLOGY, such as the methods described IN MOLECULAR CLONING, A LABORATORY MANUAL,3nd Ed. (Sambrook,2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can adopt other conventional methods, experimental schemes and reagents in the field on the basis of the technical scheme described in the invention, and the invention is not limited to the specific embodiment of the invention.

In the present invention, A, R, D, C, Q, E, H, I, G, N, L, K, M, F, P, S, T, W, Y, V are abbreviations for alanine Ala, arginine Arg, aspartic acid Asp, cysteine Cys, glutamine Gln, glutamic acid Glu, histidine His, isoleucine Ile, glycine Gly, asparagine Asn, leucine Leu, lysine Lys, methionine Met, phenylalanine Phe, proline Pro, serine Ser, threonine Thr, tryptophan Trp, tyrosine Tyr, valine Val, respectively.

The experimental materials and reagents used in the specific examples of the present invention are as follows:

strain and carrier: coli DH5 α, Pichia pastoris GS115, vector pPIC9K, Amp, G418 were purchased from Invitrogen.

Enzyme and kit: PCR enzyme and ligase were purchased from Takara, restriction enzyme was purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomais Biotech.

The formula of the culture medium is as follows:

coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, ph 7.0);

LB-AMP medium: adding 100 mu g/mL ampicillin into LB culture medium;

yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

yeastScreening medium (MD medium): 2% glucose, 2% agarose, 1.34% YNB, 4X 10^-5Biotin;

BMGY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH6.0), 1.34% YNB, 4X 10^-5Biotin, 1% glycerol;

BMMY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH6.0), 1.34% YNB, 4X 10^-5Biotin, 0.5% methanol.

The present invention will be described in detail with reference to examples.

Example 1 obtaining of Heat-resistant Single-Point mutants of glucose oxidase

1.1 amplification of glucose oxidase Gene

PCR amplification was performed using Aspergillus niger (Aspergillus niger) genome as a template, and the PCR primers GOD-F1 and GOD-R1 were as follows:

GOD-F1：GGTATTGAGGCATCTTTGTTGAC

GOD-R1：TTATTGCATAGAAGCGTAATC

PCR products were recovered from the gel, ligated with pEASY-T vector, transformed into E.coli DH5 α, and the correct transformants were picked for sequencing. The sequencing result shows that the nucleotide sequence of the amplified gene fragment is SEQ ID NO:2, the encoded amino acid sequence is SEQ ID NO: 1. by NCBI BLAST alignment, SEQ ID NO:1 has a sequence similarity of up to 100% with glucose oxidase from aspergillus niger, thereby determining that the gene obtained by PCR is a glucose oxidase gene, which is named as GOD.

1.2 amplification and Synthesis of glucose oxidase mutant Gene

In order to improve the heat resistance of the glucose oxidase GOD, the applicant screens a large number of mutations of the enzyme by an directed evolution technology, and designs PCR primers GOD-F2 and GOD-R2 as follows:

GOD-F2：GGCGAATTCGGTATTGAGGCATCTTTGTTGAC (restriction enzyme EcoRI recognition site underlined)

GOD-R2：ATAGCGGCCGCTTATTGCATAGAAGCGTAATC (recognition site for restriction endonuclease Not I underlined)

Using GOD gene as a template, carrying out PCR amplification by using the primer through a GeneMorph II random mutation PCR kit (Stratagene), recovering PCR products by using glue, carrying out enzyme digestion treatment on EcoRI and Not I, connecting the obtained product with a pET21a carrier subjected to the same enzyme digestion, transforming the obtained product into escherichia coli BL21(DE3), coating the escherichia coli BL21(DE3) into an LB + Amp plate, carrying out inverted culture at 37 ℃, after transformants appear, picking the transformants to a 96-well plate one by using toothpicks, adding 150ul LB + Amp culture medium containing 0.1mM IPTG into each well, carrying out culture at 220rpm at 37 ℃ for about 6 hours, centrifuging, abandoning supernatant, carrying out resuspension on thalli by using a buffer solution, and repeatedly freezing and thawing and breaking the walls to obtain the escherichia coli cell lysate containing the glucose oxidase.

And respectively taking out 10 mu L of lysate to two new 96-well plates, treating one of the two 96-well plates at 70 ℃ for 5min, adding 40 mu L of substrate into the two 96-well plates, reacting at 30 ℃ for 30min, determining the generated reducing sugar by using a DNS method, and calculating the relative enzyme activity of the enzyme solution subjected to high-temperature treatment compared with the enzyme solution not subjected to high-temperature treatment. The experimental result shows that some mutations have no influence on the heat resistance of the glucose oxidase GOD, and some mutations even make the heat resistance or the enzyme activity of the GOD worse; in addition, some mutations can improve the temperature tolerance of the glucose oxidase, but the enzymatic properties of the glucose oxidase are obviously changed after the mutation, and the mutations do not meet the requirements. Finally, the applicant screens mutation sites which can significantly improve the heat resistance of the glucose oxidase GOD and cannot influence the enzyme activity and the original enzymological properties: R194L, K200A/D/E, F202P, E219P, V251I, S254D/K/Y, Q255F/K, T258D/E/K, H275F/Y, N276E/K/T/Y, H281K/R, A290L, T294L, M303D, K304P, S305D/P/R, D313P, S338P, A339D, F349Y, D358P, S360A, K362F/L, E372P and H385D/L.

The mutants were PCR amplified with primers GOD-F2 and GOD-R2, respectively, and EcoRI and Not I sites were introduced at both ends of the primers. The PCR reaction conditions are as follows: denaturation at 94 deg.C for 5 min; then denaturation at 94 ℃ for 30s, renaturation at 56 ℃ for 30s, extension at 72 ℃ for 1min, and heat preservation at 72 ℃ for 10min after 30 cycles. Agarose gel electrophoresis results show that the amplified mutant genes are all fragments with the size of about 1800 bp.

The gene fragment of the wild glucose oxidase GOD was amplified by the same PCR method as described above.

1.3 construction of Pichia engineering Strain

And connecting the glucose oxidase mutant gene obtained by cloning with an expression vector pPIC9K through EcoRI and NotI sites to construct an expression vector.

The expression vector is linearized by Sal I, the linearized fragment of the expression vector is transformed into pichia pastoris GS115 by an electroporation method, pichia pastoris recombinant strains are obtained by screening on MD plates respectively, and then multi-copy transformants are screened on YPD plates containing geneticin with different concentrations respectively.

Transferring the selected transformant containing the single-point mutant into a BMGY culture medium, and carrying out shaking culture at 30 ℃ and 250rpm for 1 d; then transferring the strain into a BMMY culture medium, and carrying out shaking culture at 30 ℃ and 250 rpm; adding 0.5% methanol every day to induce expression for 4 d; centrifuging to remove thalli to obtain fermentation supernatant containing glucose oxidase mutant; it was analyzed by SDS-PAGE electrophoretic detection. The results show that the size of the glucose oxidase mutant in the fermentation supernatant is about 64kDa, which is the same as the theoretical molecular weight.

The pichia pastoris engineering bacteria for recombinant expression of wild glucose oxidase are constructed by the same method. Shake flask horizontal fermentation, 30 deg.C, 250rpm shake culture; adding 0.5% methanol every day to induce expression for 4 d; and centrifuging to remove thalli to obtain fermentation supernatant containing wild type glucose oxidase GOD.

(1) Definition of the enzyme Activity Unit of glucose oxidase

The amount of enzyme required to oxidize 1. mu. mol of beta-D-glucose to D-gluconic acid and hydrogen peroxide per minute at 30 ℃ at pH6.0 is defined as 1 enzyme activity unit (IU).

(2) Enzyme activity measuring method

The crude enzyme solution was directly diluted with buffer to about 10U/mL. 4 150X 15 tubes were taken, 2ml buffer, 0.3ml glucose, 0.4ml phenol, 0.1ml 4-aminoantipyrine, 0.1ml horseradish peroxidase were added, and preheated at 30 ℃ for 5 min. 0.1ml of distilled water was added to one tube and zeroed as a blank. The water bath was placed next to the spectrophotometer for ease of handling, 0.1ml of sample solution was added to the sample tube at which time the timing was started, and after vortex mixing the samples were immediately colorimeted using a 1cm cuvette at a wavelength of 500 nm. The absorbance value was a0 at 0.5min and after 1min of further reaction, a1 was read to give a Δ a500 ═ a1-a 0.

The enzyme activity calculation formula is as follows:

the enzyme activity X1(U/mL or U/g) in the sample was calculated according to the following formula:

X1＝ΔA500×f×B×1000/(887×t×A×d)＝33.82×ΔA500×f

in the formula:

f- -dilution of the enzyme solution

B- -volume of reaction solution (3ml)

1000- -extinction coefficient Unit conversion factor

887- -extinction coefficient (L. mol-1. cm-1)

t- -reaction time (min), i.e. the time difference between the readings A1 and A0, is 1 min.

A- -addition of sample volume (0.1ml)

d- -thickness of the cuvette (cm)

(3) Results of enzyme Activity measurement

The enzyme activity of the fermentation supernatant is measured according to the method, and the result shows that: the enzyme activity of the Pichia pastoris fermentation supernatant for recombinant expression of the wild glucose oxidase is 105U/mL, and the enzyme activity of the Pichia pastoris fermentation supernatant for recombinant expression of the glucose oxidase mutant is about 102-154U/mL.

1.4 fermentation validation

The fermentation of the constructed pichia pastoris engineering bacteria is respectively carried out on a 10-liter fermentation tank, and the formula of a culture medium used for fermentation is as follows: 1.1g/L of calcium sulfate, 5.5g/L of potassium dihydrogen phosphate, 55g/L of ammonium dihydrogen phosphate, 20.3g/L of potassium sulfate, 16.4g/L of magnesium sulfate, 1.65g/L of potassium hydroxide and 0.05% of defoaming agent.

The fermentation process comprises the following steps: the pH value is 5.0, the temperature is 30 ℃, the stirring speed is 300rpm, the ventilation quantity is 1.0-1.5(v/v), and the dissolved oxygen is controlled to be more than 20%.

The whole fermentation process is divided into three stages: the first stage is a thallus culture stage, seeds are inoculated according to the proportion of 7 percent, and the mixture is cultured for 24 to 26 hours at the temperature of 30 ℃ with the mark of complete glucose supplementation; the second stage is a starvation stage, when the glucose is supplemented, no carbon source is added, when the dissolved oxygen rises to more than 80%, the stage is ended, and the period is about 30-60 min; the third stage is an induction expression stage, methanol is fed for induction, dissolved oxygen is kept to be more than 20%, and the culture time is between 150 and 180 hours. After the fermentation is finished, the fermentation liquor is processed by a plate and frame filter to obtain a crude enzyme liquid.

The enzyme activity detection method of the glucose oxidase in the 1.3 of the embodiment 1 is adopted to detect the enzyme activity of the crude enzyme liquid, and the result shows that the final fermentation enzyme activity of the pichia pastoris for recombinant expression of the wild glucose oxidase is 3050U/ml, and the final fermentation enzyme activity of the pichia pastoris for recombinant expression of the glucose oxidase mutant reaches 3030-3590U/ml.

1.5 determination of enzymatic Properties of glucose oxidase

1. Optimum pH for action

Glucose oxidase activity determination was performed on the crude fermentation enzyme solution 1.4 in example 1 at 30 ℃ using disodium hydrogen phosphate-citric acid buffer solutions with pH values of 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, respectively, and the relative enzyme activities were calculated with the highest enzyme activity being 100%, and the results showed that the optimum action pH values of the wild-type glucose oxidase GOD and the mutant were both 6.0, and the relative enzyme activity levels under different pH conditions were not greatly different.

2. Analysis of thermal stability

Diluting the crude enzyme solution with acetic acid-sodium acetate buffer solution with pH of 6.0, treating at 60 deg.C for 10min, treating at 65 deg.C for 5min, respectively measuring enzyme activity, and calculating residual enzyme activity with enzyme activity of untreated sample as 100%. The results are shown in the following table.

As can be seen from the data in the table, compared with the wild type, the heat resistance of the 41 single-point mutants provided by the invention is obviously improved, the residual enzyme activity is improved by 11.3-66.9% after the treatment for 10min at 60 ℃, and the residual enzyme activity is improved by 23.7-105.5% after the treatment for 5min at 65 ℃. Therefore, the heat resistance of the glucose oxidase is greatly improved due to the single-point mutation, and the single-point mutation is more suitable for being used as a feed additive than a wild type, is beneficial to wide application of the glucose oxidase in feeds, and has wide market prospect.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

SEQUENCE LISTING

<110> Islands blue biological group Co Ltd

<120> glucose oxidase mutant with improved heat resistance

<130>

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 581

<212> PRT

<213> 1

<400> 1

Gly Ile Glu Ala Ser Leu Leu Thr Asp Pro Lys Asp Val Ser Gly Arg

1 5 10 15

Thr Val Asp Tyr Ile Ile Ala Gly Gly Gly Leu Thr Gly Leu Thr Thr

20 25 30

Ala Ala Arg Leu Thr Glu Asn Pro Asn Ile Ser Val Leu Val Ile Glu

35 40 45

Ser Gly Ser Tyr Glu Ser Asp Arg Gly Pro Ile Ile Glu Asp Leu Asn

50 55 60

Ala Tyr Gly Asp Ile Phe Gly Ser Ser Val Asp His Ala Tyr Glu Thr

65 70 75 80

Val Glu Leu Ala Thr Asn Asn Gln Thr Ala Leu Ile Arg Ser Gly Asn

85 90 95

Gly Leu Gly Gly Ser Thr Leu Val Asn Gly Gly Thr Trp Thr Arg Pro

100 105 110

His Lys Ala Gln Val Asp Ser Trp Glu Thr Val Phe Gly Asn Glu Gly

115 120 125

Trp Asn Trp Asp Asn Val Ala Ala Tyr Ser Leu Gln Ala Glu Arg Ala

130 135 140

Arg Ala Pro Asn Ala Lys Gln Ile Ala Ala Gly His Tyr Phe Asn Ala

145 150 155 160

Ser Cys His Gly Val Asn Gly Thr Val His Ala Gly Pro Arg Asp Thr

165 170 175

Gly Asp Asp Tyr Ser Pro Ile Val Lys Ala Leu Met Ser Ala Val Glu

180 185 190

Asp Arg Gly Val Pro Thr Lys Lys Asp Phe Gly Cys Gly Asp Pro His

195 200 205

Gly Val Ser Met Phe Pro Asn Thr Leu His Glu Asp Gln Val Arg Ser

210 215 220

Asp Ala Ala Arg Glu Trp Leu Leu Pro Asn Tyr Gln Arg Pro Asn Leu

225 230 235 240

Gln Val Leu Thr Gly Gln Tyr Val Gly Lys Val Leu Leu Ser Gln Asn

245 250 255

Gly Thr Thr Pro Arg Ala Val Gly Val Glu Phe Gly Thr His Lys Gly

260 265 270

Asn Thr His Asn Val Tyr Ala Lys His Glu Val Leu Leu Ala Ala Gly

275 280 285

Ser Ala Val Ser Pro Thr Ile Leu Glu Tyr Ser Gly Ile Gly Met Lys

290 295 300

Ser Ile Leu Glu Pro Leu Gly Ile Asp Thr Val Val Asp Leu Pro Val

305 310 315 320

Gly Leu Asn Leu Gln Asp Gln Thr Thr Ala Thr Val Arg Ser Arg Ile

325 330 335

Thr Ser Ala Gly Ala Gly Gln Gly Gln Ala Ala Trp Phe Ala Thr Phe

340 345 350

Asn Glu Thr Phe Gly Asp Tyr Ser Glu Lys Ala His Glu Leu Leu Asn

355 360 365

Thr Lys Leu Glu Gln Trp Ala Glu Glu Ala Val Ala Arg Gly Gly Phe

370 375 380

His Asn Thr Thr Ala Leu Leu Ile Gln Tyr Glu Asn Tyr Arg Asp Trp

385 390 395 400

Ile Val Asn His Asn Val Ala Tyr Ser Glu Leu Phe Leu Asp Thr Ala

405 410 415

Gly Val Ala Ser Phe Asp Val Trp Asp Leu Leu Pro Phe Thr Arg Gly

420 425 430

Tyr Val His Ile Leu Asp Lys Asp Pro Tyr Leu His His Phe Ala Tyr

435 440 445

Asp Pro Gln Tyr Phe Leu Asn Glu Leu Asp Leu Leu Gly Gln Ala Ala

450 455 460

Ala Thr Gln Leu Ala Arg Asn Ile Ser Asn Ser Gly Ala Met Gln Thr

465 470 475 480

Tyr Phe Ala Gly Glu Thr Ile Pro Gly Asp Asn Leu Ala Tyr Asp Ala

485 490 495

Asp Leu Ser Ala Trp Thr Glu Tyr Ile Pro Tyr His Phe Arg Pro Asn

500 505 510

Tyr His Gly Val Gly Thr Cys Ser Met Met Pro Lys Glu Met Gly Gly

515 520 525

Val Val Asp Asn Ala Ala Arg Val Tyr Gly Val Gln Gly Leu Arg Val

530 535 540

Ile Asp Gly Ser Ile Pro Pro Thr Gln Met Ser Ser His Val Met Thr

545 550 555 560

Val Phe Tyr Ala Met Ala Leu Lys Ile Ser Asp Ala Ile Leu Glu Asp

565 570 575

Tyr Ala Ser Met Gln

580

<210> 2

<211> 1746

<212> DNA

<213> 2

<400> 2

ggtattgagg catctttgtt gacagaccct aaggatgttt ctggaagaac cgttgactac 60

attattgctg gtggtggttt gaccggattg accactgccg caagattgac tgaaaatcca 120

aacatctctg ttttggtcat cgagtctggt tcttacgaat ctgacagagg acctattatc 180

gaagacttga acgcttacgg tgatattttc ggatcttctg ttgatcatgc ctacgagaca 240

gttgagttgg ctactaacaa tcagactgct ttgattaggt ctggaaatgg tttgggtgga 300

tctactttgg ttaatggagg tacttggact agaccacata aggctcaggt tgattcttgg 360

gaaactgttt ttggtaacga aggttggaac tgggataacg ttgcagctta ctctttgcaa 420

gcagaaagag ctagggctcc aaacgctaag caaattgctg ctggtcatta ctttaacgct 480

tcttgtcacg gtgttaacgg aactgtccac gccggaccta gagacactgg agatgattac 540

tctccaattg tcaaggcatt gatgtctgct gttgaagata gaggagtccc aaccaagaag 600

gatttcggtt gtggtgatcc acatggtgtt tctatgttcc caaatacatt gcacgaagat 660

caagttaggt ctgacgctgc tagagaatgg ttgttgccaa attatcaaag accaaacttg 720

caggtcttga ctggtcagta cgtcggtaag gttttgttgt ctcaaaacgg tactactcca 780

agagctgtcg gtgtcgagtt cggtactcat aagggtaata ctcacaacgt ttacgctaag 840

catgaagttt tgttggctgc tggttctgct gtttctccaa ccatcttgga gtattctgga 900

attggtatga agtctatttt ggaaccattg ggtattgata ctgtcgttga tttgccagtt 960

ggtttgaact tgcaggatca gactacagcc actgtcagat ccagaattac ttctgctggt 1020

gctggtcaag gtcaggctgc atggtttgct acttttaacg aaacttttgg tgattactct 1080

gaaaaggctc atgaattgtt gaacactaag ttggaacaat gggctgaaga agctgttgct 1140

agaggtggtt ttcataatac tactgctttg ttgattcaat acgaaaacta cagagactgg 1200

attgttaacc ataacgttgc ctattctgag ttgtttttgg acaccgctgg tgttgcttct 1260

tttgatgttt gggatttgtt gccatttaca agaggttacg ttcacatttt ggataaagat 1320

ccatacttgc atcactttgc atacgatcca caatactttt tgaacgaatt ggacttgttg 1380

ggtcaagctg ctgctactca attggctaga aacatttcta actctggtgc aatgcaaact 1440

tactttgccg gtgaaactat cccaggagat aacttggctt acgatgctga tttgtctgct 1500

tggactgaat acattccata ccatttcaga ccaaactacc acggtgtcgg tacttgttct 1560

atgatgccaa aggaaatggg aggtgttgtc gataacgctg caagagtcta cggagttcaa 1620

ggtttgagag ttattgatgg ttctattcca ccaactcaaa tgtcttctca tgttatgact 1680

gttttttacg ctatggcttt gaagatttct gatgctatct tggaagatta cgcttctatg 1740

caataa 1746

Claims

1.1, wherein the substitution comprises any one of R194L, K200A, K200D, K200E, F202P, E219P, V251I, S254D, S254K, S254Y, Q255F, Q255K, T258D, T258E, T258K, H275F, H275Y, N276E, N276E, N276E, H281E, H281E, A290E, T294E, M303E, K304E, S305E, S305E, S305E, D313E, S338E, A339E, F349E, D358, S E, S36385E, K362, K E, E372, H E and H E.

2. A DNA molecule encoding the glucose oxidase mutant of claim 1.

3. A recombinant expression vector carrying the DNA molecule of claim 2.

4. A host cell comprising the recombinant expression vector of claim 3.

5. Use of the glucose oxidase mutant according to claim 1 in the preparation of feed.