CN1098931C - Application of glucose oxidase gen to breeding disease-resistant transfer-gen - Google Patents
Application of glucose oxidase gen to breeding disease-resistant transfer-gen Download PDFInfo
- Publication number
- CN1098931C CN1098931C CN99100393A CN99100393A CN1098931C CN 1098931 C CN1098931 C CN 1098931C CN 99100393 A CN99100393 A CN 99100393A CN 99100393 A CN99100393 A CN 99100393A CN 1098931 C CN1098931 C CN 1098931C
- Authority
- CN
- China
- Prior art keywords
- plant
- expression vector
- sequence
- recombinant expression
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to a DNA sequence for coding glucose oxidase (GO) and the application thereof for breeding disease-resisting transgenic plants. The DNA sequence comprises a plant expression vector containing a GODNA sequence, a plant cell converted by the expression vector, a transgenic plant and a descendant thereof, wherein the transgenic plant is produced with a conversion cell and has high resistance for pathogenic bacteria, and the transgenic plant and the descendant thereof comprise plant seeds and integration plants or partial or organization organs of plant bodies. The DNA sequence for coding glucose oxidase (GO) is also suitable for other various biological expression systems in production industries and medical glucose oxidase except for the production of the disease-resisting transgenic plants, for example, the DNA sequence for coding glucose oxidase (GO) is suitable for but is not only limited to expression systems of plants, insects, enzyme mother or bacteria.
Description
The dna sequence dna and the application in cultivating disease-resistant transgenic plant thereof of glucose oxidase (GO) gene the present invention relates to encode, comprise the plant expression vector that contains the GO dna sequence dna, by expression vector plant transformed cell, and, comprise the part or the histoorgan of plant seed, whole plant or plant materials by transgenic plant and offspring thereof that pathogenic bacteria is showed high resistance that transformant produces.
Bacterium and fungi are the The main pathogenic fungi that harms the crops.Though at present some disease has been found the effectively preventing method, the disease of most of serious harm farm crop has not still been had effective prophylactico-therapeutic measures.Cultivating disease-resistant variety is the essential measure of controlling plant diseases.But because the pathogenic bacteria variation is rapidly, can be for the antigen scarcity of utilizing, the effect of conventional breeding has been subjected to considerable restraint.Along with the fast development of molecular biology, plant pathology and genetic engineering technique, the disease resistance that the utilization genetic engineering means improves plant is that breeding for disease resistance has been opened up a brand-new route.
Plant causes being infected the quick death of position tissue after receiving the signal of pathogen (Elicitor), (Hypersensitive response HR), makes pathogen lose nutrition supply, and pathogen is limited in the minimum extent to be called allergy.Host plant starts the defence system of self, reinforces cell walls as synthetic cellulose, xylogen and structural protein, oxidation (the Hahlbrock ﹠amp of synthetic plant protecting chemical and antibacterial protein and phenolic compound; Scheel, Annu.Rev.Plant Physiol.Plant Mol.Biol.40:347-369,1989), defence expression of gene (Bowles, Annu.Rev.Biochem.59:873-907,1990; Dixon ﹠amp; Harrison, Adv.Genet.28:165-234,1990), be subjected to the supersensitivity death (Keen of infected cell, Plant Mol.Biol.19:109-122,1992) and final inducible system acquired resistance (Chen et al., Science 162:1883-1886,1993).(active oxygen species, synthesizing fast AOS) was relevant for early activity oxygen class during all these reactions were all done mutually with plant-cause of disease.The AOS that produces in oxidation increases sharply (Oxidative burst) process is as superoxide ion (O
2 -), hydroxy radical qiao (OH
*), hydrogen peroxide (H
2O
2), not only have the effect of direct killing pathogenic bacteria, and the defence system that excites plant is had vital role.
Because GO is given in the effect of carbohydrate certain characteristic, as 100 ℃ do not precipitate, slow precipitation, good water solubility, the hypersaline environment precipitation etc. down of stable in the 0.75%SDS solution, 5% trichoroacetic acid(TCA).
GO has a wide range of applications aspect food fresh keeping, and the glucose of the GO of adding 0.1U/ml and 0.3mg/ml can suppress the breeding of fluorescent pseudomonas in the milk (Pseudomonasfluorescens) in the milk.In developing countries such as Sri Lanka, Pakistan, Kenya extensive application is arranged at present.In addition, in addition GO is added the report of toothpaste to prevent to decay tooth.
H
2O
2Direct kill pathogenic bacteria (Peng ﹠amp; Kuc, Phytopathol.82:696-699,1992), also can be by intrusion (Bradley et al., Cell 70:21-30,1992 of the proteic oxidation cross-linked prevention germ of inducing cell wall construction; Brisson etal., Plant Cell 6:1703-1712,1994) and synthetic by activating Whitfield's ointment with the induced defense expression of gene, make plant produce systemic acquired resistance (Leon et al., PlantPhysiol.108:1673-1678,1995; Chen et al., Science162:1883-1886,1993).With suspension cell test, H
2O
2Can activate synthetic (Apostol et al., Plant Physiol.90:109-116,1989 of plant protecting chemical; Davis et al., Phytochem.32:607-611,1993; Degousee et al., Plant Physiol.104:945-952,1994).In recent research, also find the H that oxidation increases sharply and produces in incompatible plant-cause of disease is done mutually
2O
2Not only can be used as regional signal and cause necrocytosis, but also can be used as diffusion signal lead around defence gene such as glutathione s-transferase expression of gene (Levine et al., Cell 79:583-593,1994) in the infected cell.The oxidation of glucose oxidase enzyme catalysis β-D-glucose generates gluconic acid and produces H
2O
2, in several bacteriums and fungi, detected the existence of GO at present, but in plant and animal, do not found yet.
The objective of the invention is to make up plant expression vector and change plant over to, to strengthen the disease resistance of plant by from the aspergillus niger genome, cloning glucose oxidase gene.
The present invention has cloned the aspergillus niger glucose oxidase gene, has the nucleotide sequence shown in the SEQ ID NO:1.The coded proteinic aminoacid sequence of this nucleotide sequence is shown in SEQ IDNO:2.
The present invention relates to the encode nucleotide sequence shown in SEQ ID NO:1 of glucose oxidase or its part and the sequence of functional equivalent thereof.
According to nucleotide sequence of the present invention, its coding has the aminoacid sequence of the glucose oxidase shown in SEQ ID NO:2 or the protein of its part and other functional equivalent.
The invention still further relates to the recombinant expression vector that is suitable in vegetable cell, expressing aforesaid nucleotide sequence.
According to the above-described recombinant expression vector of the present invention, the glucose oxidase gene expression cassette that wherein comprises comprises:
A) 5 ' end non-coding region;
B) aforesaid nucleotide sequence;
C) 3 ' end non-coding region.
According to recombinant expression vector of the present invention, wherein a) said 5 ' end non-coding region by two enhancer sequence, a promoter sequence, one is derived from the translation enhancement sequences of plant virus capsid protein plasmagene and the sequence composition of a coding ribophorin; B) said 3 ' end non-coding region comprises a multi-joint termination codon subsequence, and a mRNA cutting sequence and a mRNA cut post-treatment sequence and polyadenylic acid sequence.
The invention still further relates to any transgenic plant that contain aforesaid nucleotide sequence.
According to transgenic plant of the present invention, be antimycotic and transgenic plant Micobial Disease.
According to transgenic plant of the present invention, transgenic plant wherein can be whole plant or part, seed and the offsprings thereof of any monocotyledons or dicotyledons.
According to transgenic plant of the present invention, wherein said plant comprises by transgenic plant as parent hybridization or plant that transformation produced.
The application of the sequence of nucleotide sequence of the present invention and functional equivalent thereof in the various biological expression system of manufacture and medical glucose oxidase, one of them preferred embodiment is at the expression in escherichia coli glucose oxidase gene.
According to above-mentioned application of the present invention, biological expression system wherein can be plant, insect, yeast or bacterium.
Brief Description Of Drawings
Fig. 1 is structure schema and the collection of illustrative plates of pBIGO.
Fig. 2 is that the Southern hybridization of transgene tobacco detects figure, and wherein, 1 is λ DNA/EcoR I+Hind III, and 2,3,4,5,6,7 are respectively transgenic tobacco plant Kh1, Kh2, and Kh4, Kh5, Kh6, Kh7,8 is CK.
Fig. 3 is that the PCR of transgene cotton detects figure, and wherein, pcr amplification goes out the band of a treaty 1.8kb, illustrates that the GO gene integration advances in the cotton gene group; Wherein, 1 is transgenosis individual plant Xh-12, and 2 is λ DNA/EcoR I+Hind III, and 3 is CK, non-transgenic check variety Xinjiang 822.
Fig. 4 is that the disease resistance of transgene cotton is identified figure.
The present invention is described in detail below in conjunction with accompanying drawing.
For make foreign gene in vegetable cell transcribe with translation skill on obtain to efficiently express, must be connected with suitable expression regulation element at the foreign gene flank.Therefore, the present invention has designed to efficiently expressing the untranslated part and the polyadenylic acid sequence of the required promotor of above-mentioned glucose oxidase gene, enhanser, terminator, transcription product and be convenient in suitable substratum screening by the selectable marker gene of transformant etc. in recipient plant.
According to a preferred embodiment of the invention, in the constructed expression vector of the present invention, said 5 ' end non-coding region by two enhancer sequence, promoter sequence, one be derived from the translation enhancement sequences of plant virus capsid protein plasmagene and foreign gene in vegetable cell in the translation process favorable short nucleotide sequence form.
The translation enhancement sequences of using in integrative gene expression vector of the present invention that is derived from plant virus capsid protein plasmagene coding region is the Ω sequence.This sequence enrichment AAC sequence constitutes rrna and rRNA binding site (Richards et al., Eur.J.Biochem.84:513-519,1987) in the translation process of protein synthesis.Wherein promotion foreign gene short nucleotide sequence of translation process in vegetable cell of using of the present invention is Kozak sequence (Kozak et al., NucleicAcids Research 12:857-872,1984 of people's description such as Kozak; Cell 44:283-292,1986).
Be suitable for being connected, and in vegetable cell, start this DNA sequences encoding and transcribe the promotor of beginning and comprise composing type, induction type, tissue or organ specificity or etap specificity promoter with GO gene of the present invention.For example, they comprise but are not only limited to cauliflower mosaic virus (CaMV) 35S or 19S promotor, mannopine synthetic enzyme (MAS) promotor, rouge alkali synthetase and octopine synthase promoter, the maize alcohol dehydrogenase promotor, and diphosphoribulose carboxylase/oxydase small subunit promotor, hinder and to induce or germ evoked promoter, tissue or organ or development-specific expression promoter etc.Wherein, the present invention preferably has the CaMV 35S promoter that doubles enhancer element.This promotor complete sequence is shown in SEQ ID NO:3.In addition, a lot of Plant diseasess are vascular bundle diseases, by the promotor of adjunction vascular-specific expression, can improve the anti-microbial effect of exogenous genes products.
According to a preferred embodiment of the invention, in the constructed high-efficiency plant expression vector of the present invention, said 3 ' end non-coding region comprises a multi-joint termination codon subsequence, and a mRNA cutting sequence and a mRNA cut post-treatment sequence and polyadenylic acid sequence.
In addition, be applicable to GO high-efficiency plant expression vector of the present invention also comprise be derived from cauliflower mosaic virus or, the terminator of Nopaline (Nos) gene and other similar terminators.In one embodiment of the invention, we have used the terminator of Nos gene.
Can use method as known in the art with the fusion gene construct that is suitable in vegetable cell expressing GO provided by the invention be connected to any can the carrier of self-replacation in bacterial cell or vegetable cell on.Such carrier for example comprises and is derived from colibacillary plasmid vector pUC18, pUC19.Especially plant expression vector pBI101, pBI121 and pBI131 system (Jefferson, et al., EMBO J.16:3901,1987) or the like.In a series of preferred embodiments of the present invention, the carrier that carries above-mentioned GO gene construct is pBlueScriptKS, pBI121 etc., and the latter is particularly suitable for the instrument plasmid vector as the preparation plant expression vector.
As previously mentioned, in order correctly to select and to identify by the plant transformed cell, above-mentioned recombinant expression vector of the present invention also contains selectable marker gene.The both sides of employed selectable marker gene can have adjusting sequence separately, to impel their expression in plant.The selective marker that is suitable for is known in the art.Foreign gene and other genes of coding selective marker can be contained in the same expression vector, perhaps are contained in when transforming in the simultaneously applied different carrier.The preferred selectable marker gene of the present invention is neomycin phosphotransferase (NPT II) gene, and together is contained in the same recombinant expression vector, thereby has guaranteed the reliability selected by transformant or plant.
Therefore, concluding the plant expression vector that is suitable for expression GO gene in vegetable cell provided by the invention comprises:
1) GO expression casette;
A) 5 ' end non-coding region;
B) nucleotide sequence shown in SEQ ID NO:1 of coding GO;
C) 3 ' end non-coding region.
2) derive from the carrier part of pBI121:
A) neomycin phosphotransferase gene (npt II) expression cassette;
B) initial replicon and the functional structures such as T-DNA left and right sides border sequence relevant with Plant Transformation.
According to a preferred embodiment of the invention, said 5 ' end non-coding region and 3 ' end non-coding region has foregoing composed component and function thereof respectively.For example, the promotor that has the enhancer element that doubles of 5 ' end, Ω sequence and Kozak sequence; The multi-joint terminator sequence of 3 ' end correctly cuts and job sequence the polyadenylic acid signal sequence.
Can pass through the DNA recombinant technology by the resulting nucleotide sequence that meets SEQ ID NO:1 of the present invention, be connected in the expression vector described above, and make it to change over to and be incorporated in the Plant Genome.And the expression of GO gene in target plant can be given this plant disease is had stronger resistance.
Be noted that expression vector described above is a preferred embodiment of the present invention, it does not limit the present invention.Every application constructed any expression vector of GO gene described in the invention includes within the present invention.Comprise following implementation:, make up the expression vector of multivalent genetic and change plant over to other one or more gene recombination;
1. with other one or more gene fusion, construction of expression vector also changes plant over to;
2. collaborative mutually with other one or more genes, make up plant expression vector respectively, import same kind of plant acceptor simultaneously or step by step.
For in vegetable cell, express the external source disease-resistant gene in the particularly whole strain plant, to give whole strain plant and seed thereof and offspring, must use carrying in the recombinant expression vector conversion of GO gene of the present invention or transduce appropriate host cell or the plant materials that appropriate means will prepare as stated above with resistance against diseases.
With recombinant vectors importing host plant or its intracellular many methods of carrying foreign gene all is well known to those skilled in the art.These methods are including but not limited to agriculture bacillus mediated conversion method (Agrobacterium-mediatedtransformation) 1); 2) physics method is as particle bombardment (Particle Bombardment or Particle gun or Gene gun), electric shocking method (Electroporation), microinjection (Microinjection), supersonic method (Ultrasonic), laser microbeam method (Lasermicrowave), silicon carbide fiber mediated method (Silicon carbide fiber), electrophoretic method (Electrophoretic transfection) etc.; 3) chemical method is as PEG mediated method, liposome mediated-method etc.; 4) germplasm system conversion method is as pollen-mediated method, pollen tube passage method (ovary injection), infusion method etc.; 5) with conversion methods that virus vector was mediated such as cauliflower mosaic virus (CaMV), geminivirus infection (Geminiviruses) or RNA viruses etc.
It is a kind of that to make us the interested method that imports foreign gene on whole plant especially be that the improved plant ovary injection used of the inventor is (referring to CN 95119563.8,1995; Zhou et al., Enzymol.Method.101:433-481,1983).
According to a preferred embodiment of the invention, we select cotton as GO gene transformation recipient plant.Cotton is as a kind of cash crop, and we consider its raw material mainly as textile industry, thereby the security of transgenic plant is good; The cotton due to illness harmful financial loss that causes in every year of secondly, worldwide extensively being planted is very huge.
Thereby, the dna sequence dna of GO the present invention relates to encode, plant expression vector efficiently, method with said expression vector transformed plant cells, tissue and whole strain plant, and the consequent transgenic plant that Plant diseases is had resistivity, the particularly transgene cotton that yellow, blight are had resistivity.
Another aspect, the invention provides acquisition has resistance to pathogenic bacteria, especially yellow, wilt is had the method for the plant of resistance, and this method comprises:
1). make up the plant expression vector that comprises the GO gene;
2). with any feasible method the plant expression vector that obtains in the step 1) is imported in the vegetable cell, and obtains pathogenic bacteria is had the transgenic plant and the offspring thereof of resistance capacity thus, comprise the whole strain of any plant, partly, organ or tissue and seed.
What should particularly point out here is that though be that example is described the present invention in detail in the following embodiments with the transgene cotton, this means that never GO gene of the present invention and recombinant expression vector thereof only are applicable to conversion and produce the transgene cotton with resistance against diseases.Therefore, GO gene and expression vector thereof that all uses are described in the invention, import in any plant or its tissue or the cell with any method well known by persons skilled in the art, and the plant with resistance against diseases, seed and the offspring that obtain therefrom and part organ, tissue or the cell of plant materials, include within the present invention.
Except that producing disease-resistant transgenic plant, the present invention also is applicable to other various biological expression systems of manufacture and medical glucose oxidase, for example but be not limited only to plant, insect, yeast or bacterial expression system.Be at the expression in escherichia coli glucose oxidase gene in a preferred embodiment of the invention, obtaining its expression product, and prepare corresponding antibody, be used for detecting the transgenic plant expression of gene with commercially available glucose oxidase immune rabbit.
EXAMPLE Example 1: the preparation of the proteinic structure gene of coding GO
1.1GO the clone of gene
According to the dna sequence dna of aspergillus niger GO gene, design PCR primer carries out pcr amplification.
The PCR primer:
GO-1：5’CT
CATGCAGACTCTCCTTGTG 3’
Pst I
GO-2：5’CA
TTATCACTGCATGGAAGCATAA 3’
Xho I
Amplification condition be 94 ℃ 1 minute, 50 ℃ 1 minute, 72 ℃ 1.5 minutes.Circulate 35 times.Because there are a Pst I site and an ECoR I site in GO gene inside, the PCR product is at first through EcoR I/Xho I double digestion rear electrophoresis, and the EX fragment cloning of recovery 950bp obtains pEX to the EcoR I/Xho I site of pBlueScriptKS; The PE fragment that reclaims 870bp is cut rear clone through Pst I enzyme again and is obtained pPE to the EcoR I/Pst I site of pBlueScript KS.The EX fragment cloning is promptly obtained whole GO gene, called after pGO to the EcoR I/XhoI site of pPE.Together with initiator codon ATG and terminator codon TGA totally 1818 base pairs (sequence such as SEQ ID No:1).Its coded GO protein sequence is shown in SEQ ID NO:2.
1.2 to cloning the GO Gene Sequence Analysis among the pGO
The preparation of (1) sex change template:, prepare pGO plasmid DNA to be measured with extracting the plasmid DNA method in a small amount.Get 1.5～2 μ g DNA (about 2～5 μ l) and add water to cumulative volume 32 μ l, add 8 μ l 2M NaOH then, mixing gently, room temperature sex change 10 minutes adds 4 μ lH then
2O, 7 μ l 3M NaAc (pH4.8), 120 μ l dehydrated alcohols, centrifugal 8 minutes of 12000rpm, with the precipitation that 70% ethanol is washed 2 gained, vacuum is drained, and is dissolved in the 10 μ l water, puts stand-by on ice.
(2) annealing: add 2 μ l annealing buffer in the template DNA after sex change, 2 μ l sequencing primers, mixing gently, instantaneous centrifugal back moves to 37 ℃ rapidly and continued incubations 10 minutes in 65 ℃ of incubations annealing 5 minutes, places more than 5 minutes in room temperature then.
(3) labeled reactant: inhale earlier 2 μ l enzymes dilution buffer, then to wherein adding 0.5 μ lT
7Sequenase places on ice, adds LabelMix 3 μ l in the template after annealing, the primer mixture then, α-
32 P dATP 1 μ l; T after the dilution
7Sequenase 2 μ l inhale gently in pipe and beat mixing, instantaneous centrifugal getting rid of, room temperature reaction 5 minutes.
(4) chain extension termination reaction: on 4 centrifuge tubes, put on A, C, G, T respectively, and add the corresponding chain termination liquid of 2.5 μ l (Mix short) respectively and be incubated 1 minute at least at 37 ℃, pipetting 4.5 μ l reactants from (3) in the mark reaction solution respectively joins in A, C, four pipes of G, T, the rearmounted 37 ℃ of reactions of mixing 5 minutes, each added 5 μ l stop buffers, in 37 ℃ of insulations 2 minutes.
(5) preparation of sequencing gel: the sequenator of using Bio-rad company.
(6) measure 50ml 6% order-checking acrylamide gel stock solution (6%Sequencing gel:1.5g methylene diacrylamide, 28.5g acrylamide, 240g urea, 50ml 10 * TBE adds water and is settled to 500ml), add 500 μ l, 10% Ammonium Persulfate 98.5,50 μ l TEMED, mixing slowly is injected in the clean order-checking panel assembly, insertion point sample comb, polymerized at room temperature is more than 45 minutes.
(7) install electrophoresis apparatus, added 1 * TBE electrophoretic buffer (10 * TBE:108gTris, 9.3g Na
2EDTA.2H
2O, 55g boric acid is used H
2O is dissolved in 1000ml (pH8.3) surely).With 80 ℃ of sex change of sample 2 minutes, place on ice last sample electrophoresis.If necessary, when bromjophenol blue arrives the plate bottom, carry out sample on the secondary, continue electrophoresis to the secondary the sample bromjophenol blue to the plate bottom.
(8) stop electrophoresis, following glue, compressing tablet ,-70 ℃ of radioautograph are spent the night, and punching is read.
(9) result proves that having the GO gene that conforms to design in this plasmid inserts fragment.The escherichia coli expression of embodiment 2:GO
(1) picking list colony inoculation is in LB liquid nutrient medium (being added with Amp 100mg/L), and in 37 ℃, wherein first-selected transgenic plant and products thereof shaking culture is spent the night.
(2) get the 50ml overnight culture and be inoculated in 5ml LB liquid nutrient medium (being added with Amp100mg/L), in 37 ℃ of shaking culture 2 hours.
(3) add IPTG (isopropylthiogalactoside) to final concentration be 1mmol/L, induce.
(4) 1ml is taken out through the inductive culture in 1,3,5 hour after inducing respectively, at room temperature with 12000 * g centrifugal 1 minute rapidly, abandons supernatant.
(5) each precipitation is resuspended in 1 * sds gel sample loading buffer of 100 μ l, the sample of all collections is stored in 0 ℃, in order to application of sample on gel.
1 * sds gel sample loading buffer:
50mmol/L TrisCl
100mmol/L dithiothreitol (DTT) (DTT)
2%SDS (electrophoresis level)
1% tetrabromophenol sulfonphthalein
10% glycerine
(6) 1 * sds gel sample loading buffer that does not contain dithiothreitol (DTT) can be stored in room temperature.It is frozen standby in-20 ℃ that dithiothreitol (DTT) can be made into the 1mol/L stock solution.
(7) melt sample, 100 ℃ of heating 3 minutes, in room temperature with 12000 * g centrifugal 1 minute, every kind of suspension was got 15 μ l application of samples on the sds page of proper concn, with the bacterial suspension that only contains blank carrier in contrast.
(8) identify institute's inductive albumen with coomassie brilliant blue staining or with the Western blotting.
Embodiment 3:GO Antibody Preparation
(1) takes by weighing 5mg glucose oxidase (Boehringer Mannheim), add the dissolving of 1ml stroke-physiological saline solution.
(2) add 1ml Freund's complete adjuvant (Sigma), beat with the syringe suction and make it thorough emulsification several times.Subcutaneous multi-point injection immunization experiment rabbit.
(3) 2 week back immunity for the second time, the 5mg glucose oxidase adds the 1ml Freund's incomplete adjuvant after adding the dissolving of 1ml stroke-physiological saline solution.Thoroughly intramuscular injection after the emulsification.
(4) respectively at carrying out third and fourth time immunity after 2 weeks and 4 weeks, the 5mg glucose oxidase adds the injection of 1ml stroke-physiological saline solution dissolving posterior vein.
(5) vein haemospasia 1ml, centrifugal 20 minutes of 4000rpm.Get serum and carry out antigen-antibody in conjunction with test.The structure of embodiment 4:GO gene plant expression vector
4.1GO the structure of expression casette
As previously mentioned, comprise following gene expression regulation element in the constructed GO expression casette of present embodiment: 35S promoter, the enhanser that doubles, Ω sequence and the Kozak sequence of 5 ' end, the multi-joint terminator sequence of 3 ' end, cutting sequence, NOS terminator.Utilize plasmid pT Ω 4A, behind Pst I and Xho I double digestion, reclaim the 3.5kb fragment, be connected to the carrier that is reclaimed after the GO gene among the pGO is downcut with Pst I and Xho I and get on, obtain recombinant plasmid pTGO as carrier.
4.2GO the structure of gene plant expression vector
With the GO expression casette of the 5.3kb among the Hind III/EcoR I cutting-out pTGO, be cloned on the Hind III/EcoR I site among the plant expression vector pBI121, obtain recombinant plasmid pBIGO.Here it is constructed GO plant expression vector.Its plasmid map and building process are as shown in Figure 1.Importing and the evaluation of embodiment 5:GO plant expression vector in the model plant tobacco
5.1 the preparation of LBA4404 competent cell
The single colony inoculation of picking LBA4404 in 5ml YEB (containing Streptomycin sulphate 100 μ g/ml), 28 ℃, the 250rpm overnight incubation.Draw the 2ml bacterium colony and add in the 50ml YEB substratum, continue to be cultured to OD
600Value is about 0.6.Bacterium liquid is gone in the aseptic centrifuge tube, ice bath 30 minutes, centrifugal 5 minutes of 5000rpm is with the CaCl of 2ml 20mM
2Resuspended thalline is sub-packed in the aseptic little centrifuge tube by every pipe 200 μ l.
5.2 recombinant plasmid changes the LBA4404 cell over to
In 200 μ l LBA4404 competent cells, add 2 μ g recombinant plasmid pBIGODNA respectively, put ice bath 5 minutes, went to then in the liquid nitrogen freezing 8 minutes, incubation after 5 minutes in 37 ℃ of water-baths rapidly, add 800 μ l YEB substratum, 28 ℃ of pre-cultivations 4～5 hours of 250rpm are coated with the YEB solid plate that kantlex is contained in the shop then, cultivate 24～48 hours for 28 ℃.The Agrobacterium bacterium colony that grows has corresponding conversion plasmid.
5.3 the genetic transformation of tobacco
(1) preparation of Agrobacterium: 28 ℃ of cultivations respectively of spending the night have the Agrobacterium 50ml of plant expression vector, and centrifugal 5 minutes of 5000rpm collects bacterial sediment, with liquid MS (Murashige﹠amp; Skoog, 1962) nutrient solution washs once, uses MS resuspended to OD600=0.2～0.4 again.
(2) contaminate: get tobacco aseptic seedling blade, be cut into the about 0.5 centimetre dice of the length of side by knife, in the Agrobacterium suspension, soaked 5～10 minutes, blot with sterilization filter paper then.
(3) cultivate altogether: the leaf piece is placed in not in the common culture medium of added with antibiotic (MS+IAA0.5mg/L+6-BA 2mg/L) (top pad two layers of filter paper) cultivated altogether 3 days in 25 ℃ of lucifuges.
(4) select to cultivate: with the blade subculture to selecting in the substratum (MS+IAA 0.5mg/L+6-BA 2mg/L+Kan 100mg/L+Carb 500mg/L) in illumination box (illumination 12 hours, dark 12 hours) to be cultured to the appearance of resistant buds.
(5) acquisition of resistance seedling: callus is transferred to root media (MS+Kan100mg/L+Carb 500mg/L), every two all succeeding transfer culture once, plants at last in the little polypots.
5.4 the Southern of transgene tobacco identifies
Get 1～3 gram fresh tobacco blade, add equivalent Al
2O
3Use liquid nitrogen grinding, powder is placed the 50ml centrifuge tube, add 20ml DNA extraction damping fluid (100mM Tris.HCl pH8.0,500mMNaCl, 10mM beta-mercaptoethanol, 50mM EDTA pH8.0), thermal agitation 1 minute, add 4ml 10%SDS, mixing heated 10～20 minutes in 65 ℃ gently, emerald green to color, add ice-cold 5M KAc 4ml, placed on ice 30 minutes, then centrifugal 15 minutes of 4 ℃, 12000rpm, get supernatant, behind 0.6 times of isopropanol precipitating, to handle with RNase, purifying is standby.
(1) DNA of plants is cut with Pst I enzyme spends the night, carry out electrophoresis and take a picture by 0.8% sepharose.
(2) glue is placed shallow bid add 200ml sex change liquid (0.5M NaOH, 1.5M NaCl) vibration 45 minutes.
(3) discard sex change liquid, with the distilled water rinsing for several times, add neutralizer (1M Tris, pH7.4,1.5M NaCl) 200ml, vibrate 30 minutes, the neutralizer that more renews then, in the continuation with 15 minutes.
(4) cut the nitrocellulose filter (NC film) of corresponding size, in distilled water evenly drenched after, the NC film soaked does among 10 * SSC (20 * SSC: every 1000ml contains NaCl 175.3g, Trisodium Citrate 88.2g pH7.0), placed 20 minutes.
(5) use the commentaries on classics film instrument of Bio-rad company to change film 1 hour.
(6) remove blob of viscose, film was washed 5 minutes with 6 * SSC in the good well of mark position, and uv irradiating is 5 minutes then, with fixed dna.2 * SSC washes film, and room temperature is air-dry.
(7) the NC film is involved in the hybridization bottle, adds 20ml prehybridization solution (6 * SSC, 5 * Denhardt, 0.5%SDS, 200 μ g/ml milt DNA), make the film homogeneous immersion not have bubble, place 68 ℃ of prehybridizations of dna molecule hybridize instrument to spend the night then.
(8) mark of probe: adopt Promega company random primer test kit mark.Get an amount of dna fragmentation to be marked, 95～100 ℃ of sex change placed rapidly on ice in 2 minutes, and are new one
In the Eppendrof pipe, add successively:
5×labeling buffer 10μl
DCTP, dGTP, dTTP, mixture 2 μ l
Sex change template 25ng
BSA 2μl
α-
32P-dATP 5μl
Add H
2O is to cumulative volume 50 μ l
(9) mixing gently, room temperature reaction 60 minutes.95 ℃ of sex change placed on ice in 2 minutes.Add 2 μ l 0.5M EDTA.
(10) in the bag that prehybridization finishes, add sex change probe 30～50 μ l, seal again and continue at 68 ℃ of hybridization 8～10 hours.
(11) take out Hybond membrane and washed film 30 minutes, washed 15 minutes, use 0.1 * SSC, 0.5%SDS to wash 30 minutes～a few hours of film, the film washing liquid that the centre more renews again in 42 ℃ with 2 * SSC, 0.1%SDS with 2 * SSC, 0.5%SDS.
(12) 1 * SSC washed film 2 minutes, inhaled the pearl of anhydrating with thieving paper, wrapped film with preservative film, compressing tablet in the darkroom.
(13)-70 develop a film behind ℃ radioautograph 3-6h.
The result shows, the Southern results of hybridization of transgene tobacco positive (Fig. 2).Embodiment 6: the preparation pollen tube passage method transforms plant and uses expression of plants
Carrier pBIGO ultrapurity plasmid DNA
6.1 large quantity extracting plasmid pBIGO
(1) the order bacterium colony has in the corresponding antibiotic liquid LB substratum in 20ml, and 37 ℃, shaking culture is spent the night under the 250rpm condition.
(2) bacterium liquid is changed in the 4000ml liquid LB substratum, continue to cultivate 8～12 hours;
(3) 5000rpm is centrifugal 5 minutes, collects thalline;
(4) with STE 100ml suspension washing thalline, merge each pipe in 2 500ml centrifuge tubes, the centrifugal again supernatant that goes;
(5) add 80ml Solution I (50mM sucrose to every pipe respectively, 10mM EDTA, 25mM Tris-HCl pH8.0), thalline suspension back is added new SolutionII (the 0.2M NaOH for preparing of 160ml, 1%SDS), mixing was placed 10 minutes for several times on ice gently, and (every 100ml contains 5M KAc 60ml to add the Solution III of 120ml precooling again, glacial acetic acid 11.5ml, distilled water 28.5ml), mixing was placed 30 minutes on ice gently;
(6) 8000rpm is centrifugal 15 minutes, collects supernatant, adds the Virahol of 0.6 times of volume, and room temperature was placed 10 minutes;
(7) 8000rpm is centrifugal 15 minutes, and 70% washing with alcohol once is dissolved among the 4ml TE (10mM Tris pH8.0,1mM EDTA pH8.0), adds RNase 8 μ l (10mg/ml) and handles 1 hour for 37 ℃;
(8) with phenol, chloroform extracting and purifying, be dissolved in behind the ethanol sedimentation among the 3ml TE.
6.2 ultracentrifugation is further purified the plasmid DNA (with Beckman company ultracentrifuge) of extraction
(1) add the 2.9ml dna solution in a 50ml centrifuge tube, (EB, 10mg/ml), mixing is stand-by for saturated cesium chloride solution of 6.6ml and 1ml ethidium bromide solution.
(2) if any many precipitations, then 8000rpm is centrifugal 5 minutes in going on foot on.
(3) above-mentioned mixed solution is changed in two 5.2ml ultracentrifugation pipes, with the Beckman ultracentrifuge specific equipment heat-sealing mouth of pipe.
(4) use vTi80 rotary head room temperature traditional vacuum 20 hours, 6,5000rpm.
(5) under the medium ultraviolet light of darkroom, bore a hole with syringe needle on centrifuge tube top earlier, use 5ml disposable syringe sucking-off plasmid bright band then.
(6) remove EB for several times with the water-saturated n-butanol extracting.
(7) with after three times of the TE dilutions, centrifugal with 4 ℃ of precipitations of two times of dehydrated alcohols, the dilution of dissolving back is stand-by.Embodiment 7: plant ovary injection (pollen tube passage method) converting cotton
Gene the efficiently expressing in plant of coding GO disease resistance protein, the transgenic plant that have high disease resistance for generation are the most key, but transforming plant, foreign gene whether can succeed, also be vital link.Before the present invention,, all there is adverse factors though the methods conversion plants such as agrobacterium-mediated transformation, particle bombardment, PEG method, electrization that utilize that this area scientific and technical personnel know have many successful examples.Not only be subjected to high etc. the restriction of laboratory condition and expensive instrument and expense as above-mentioned method, the more important thing is that aforesaid method all has a disadvantageous general character, that is exactly the restriction that is subjected to the plant gene type.On producing, bringing into play the good plant kind of important effect at present, because genotypic difference can not or be difficult to take place or embryo's generation approach regeneration plant by organ.In this case, the present invention is by plant ovary injection technique or title pollen tube passage method, the transgene cotton that has successfully obtained to have high resistance against diseases.The advantage that ovary injection foreign gene transforms plant is: 1) be suitable for all genotype; 2) method is simple, effectively; 3) be not subjected to the restriction of laboratory condition, plant and instrument, and expense is low; 4) speed is fast, can obtain transgenic plant seed and offspring in 1 year.
In the present embodiment, the time of ovary injection foreign gene is to bloom in cotton to pollinate between back about 10-24 hour.Before in megarchidium duct sealing, with microsyringe with the foreign gene injection of solution in ovary, foreign gene can be diffused into or be extruded in the blastular of firm after fertilization in the process of megarchidium duct sealing gradually by the hole of bead and megarchidium duct.In zygote splitted process, foreign gene is integrated in fertilized egg cell's the genome, thereby finishes the process that foreign gene imports and integrates.
Cotton is normal cross pollinated plant, and for keeping the relative purity of kind (being), in the noon before that day of blooming, the flower bud that will bloom at second day is tight with cableties, makes flower distinguish and can not open, so that its self-pollination.Bloomed back about about 10 hours, and after pollen tube enters blastular about 6 o'clock of evening of promptly blooming the same day, can carry out the injection of foreign gene.Before the injection flower distinguished to peel off together with stamen and expose young bell, erase the vertical style of young bell, the microsyringe of foreign gene solution will be drawn, vertically insert 2/3 place of young bell size along axis, again microsyringe is upwards mentioned 1/3 place, stay the injection space of young approximately bell 1/3, slowly the external source injection of solution in the injection device is arrived and inject in the space.After this, exogenous DNA solution will be along the hole of bead and megarchidium duct to fertilization blastular internal diffusion, or because the integration that is extruded realization gene in the fertilization blastular is into being sealed in the megarchidium duct gradually.The foreign gene solution of general injection is 10 μ l, and the DNA total amount is about 0.25～0.5 μ g.After the foreign gene injection, in order to prevent and to reduce coming off of young bell, improve into the bell rate, smear the Plant hormones regulators,gibberellins of 40ppm with writing brush or be clipped between young bell handle base portion and the stem (branch) at young bell handle base portion with the cotton balls that is soaked with 40ppm Plant hormones regulators,gibberellins, the branch Xiang Duan that will inject the young bell place of foreign gene simultaneously removes, to keep the abundant nutrition of young bell, help into the growth of seed in bell and the bell.
Offspring to the results seed carries out disease-resistant and Molecular Detection, obtains disease-resistant cotton plant.Embodiment 8: molecular Biological Detection of the disease-resistant cotton of transgenosis and disease resistance test
The transgenic cotton plant that is obtained PCR detection and disease resistance evaluation have been carried out respectively.Confirmed that the GO gene has imported in the cotton and expression.
Accompanying drawing 3 provides the photo of disease-resistant cotton plant PCR detected result.Pcr amplification goes out the special band of a 1.8kb, has proved that the GO gene successfully is transferred in the cotton gene group.In identify in the sick garden in anti-Huang, blight greenhouse and the field of transgenic cotton, obtained the individual plant that disease resistance obviously improves, see Fig. 4.As shown in Figure 4, behind the transgene cotton insemination and emergence, sneak into nutrition pot soil with withered No. 7 microspecies in the ratio of 3% (w/w) and inoculate.Again with the Huang Beijing fungus strain inoculation of withering, concrete grammar is with 1.2 * 10 all around
7The verticillium wilt pathogen liquid of cfu/ml, each nutrition pot adds 10ml, carries out big bacterium and measures withered, verticillium mixing evaluation.The result shows that the anti-Huang of transgene cotton, blight ability are apparently higher than the contrast cotton.
Sequence table
(1) information of SEQ ID NO:1:
(I) sequence signature:
(A) title: GO gene
(B) length: 1818 base pairs
(C) type: Nucleotide
(D) chain: strand
(E) topological framework: linearity
(II) molecule type: the nucleotide sequence of coding glucose oxidase gene
(III) suppose: non-
(IV) antisense: non-
( V ) ：SEQ ID NO：1ATGCAGACTCTCCTTGTGAGCTCGCTTGTGGTCTCCCTCGCTGCGGCCCTGCCACACTAC 60ATCAGGAGCAATGGCATTGAAGCCAGCCTCCTGACTGATCCCAAGGATGTCTCCGGCCGC 120ACGGTCGACTACATCATCGCTGGTGGAGGTCTGACTGGACTCACCACCGCTGCTCGTCTG 180ACGGAGAACCCCAACATCAGTGTGCTCGTCATCGAAAGTGGCTCCTACGAGTCGGACAGA 240GGTCCTATCATTGAGGACCTGAACGCCTACGGCGACATCTTTGGCAGCAGTGTAGACCAC 300GCCTACGAGACCGTGGAGCTCGCTACCAACAATCAAACCGCGCTGATCCGCTCCGGAAAT 360GGTCTCGGTGGCTCTACTCTAGTGAATGGTGGCACCTGGACTCGCCCCCACAAGGCACAG 420GTTGACTCTTGGGAGACTGTCTTTGGAAATGAGGGCTGGAACTGGGACAATGTGGCCGCC 480TACTCCCTCCAGGCTGAGCGTGCTCGCGCACCAAATGCCAAACAGATCGCTGCTGGCCAC 540TACTTCAACGCATCCTGCCATGGTGTTAATGGTACTGTCCATGCCGGACCCCGCGACACC 600GGCGATGACTATTCTCCCATCGTCAAGGCTCTCATGAGCGCTGTCGAAGACCGGGGCGTT 660CCCACCAAGAAAGACTTCGGATGCGGTGACCCCCATGGTGTGTCCATGTTCCCCAACACC 720TTGCACGAAGACCAAGTGCGCTCCGATGCCGCTCGCGAATGGCTACTTCCCAACTACCAA 780CGTCCCAACCTGCAAGTCCTGACCGGACAGTATGTTGGTAAGGTGCTCCTTAGCCAGAAC 840GGCACCACCCCTCGTGCCGTTGGCGTGGAATTCGGCACCCACAAGGGCAACACCCACAAC 900GTTTACGCTAAGCACGAGGTCCTCCTGGCCGCGGGCTCCGCTGTCTCTCCCACAATCCTC 960GAATATTCCGGTATCGGAATGAAGTCCATCCTGGAGCCCCTTGGTATCGACACCGTCGTT 1020GACCTGCCCGTCGGCTTGAACCTGCAGGACCAGACCACCGCTACCGTCCGCTCCCGCATC 1080ACCTCTGCTGGTGCAGGACAGGGACAGGCCGCTTGGTTCGCCACCTTCAACGAGACCTTT 1140GGTGACTATTCCGAAAAGGCACACGAGCTGCTCAACACCAAGCTGGAGCAGTGGGCCGAA 1200GAGGCCGTCGCCCGTGGCGGATTCCACAACACCACCGCCTTGCTCATCCAGTACGAGAAC 1260TACCGCGACTGGATTGTCAACCACAACGTCGCGTACTCGGAACTCTTCCTCGACACTGCC 1320GGAGTAGCCAGCTTCGATGTGTGGGACCTTCTGCCCTTCACCCGAGGATACGTTCACATC 1380CTCGACAAGGACCCCTACCTTCACCACTTCGCCTACGACCCTCAGTACTTCCTCAACGAG 1440CTGGACCTGCTCGGTCAGGCTGCCGCTACTCAACTGGCCCGCAACATCTCCAACTCCGGT 1500GCCATGCAGACCTACTTCGCTGGGGAGACTATCCCCGGTGATAACCTCGCGTATGATGCC 1560GATTTGAGCGCCTGGACTGAGTACATCCCGTACCACTTCCGTCCTAACTACCATGGCGTG 1620GGTACTTGCTCCATGATGCCGAAGGAGATGGGCGGTGTTGTTGATAATGCTGCCCGTGTG 1680TATGGTGTGCAGGGACTGCGTGTCATTGATGGTTCTATTCCTCCTACGCAAATGTCGTCC 1740CATGTCATGACGGTGTTCTATGCCATGGCGCTAAAAATTTCGGATGCTATCTTGGAAGAT 1800TATGCTTCCATGCAGTGA 1818
(2) information of SEQ ID NO:2:
(I) sequence signature:
(A) title: GO
(B) length: 605 amino acid
(C) type: amino acid
(D) chain: strand
(E) topological framework: linearity
(II) molecule type: the aminoacid sequence of glucose oxidase
(III) suppose: non-
(IV) antisense: non-
( V ) ：SEQ ID NO：2Met Gln Thr Leu Leu Val Ser Ser Leu Val Val Ser Leu Ala Ala Ala Leu Pro His Tyr 20Ile Arg Ser Asn Gly Ile Glu Ala Ser Leu Leu Thr Asp Pro Lys Asp Val Ser Gly Arg 40Thr Val Asp Tyr Ile Ile Ala Gly Gly Gly Leu Thr Gly Leu Thr Thr Ala Ala Arg Leu 60Thr Glu Asn Pro Asn Ile Ser Val Leu Val Ile Glu Ser Gly Ser Tyr Glu Ser Asp Arg 80Gly Pro Ile Ile Glu Asp Leu Asn Ala Tyr Gly Asp Ile Phe Gly Ser Ser Val Asp His 100Ala Tyr Glu Thr Val Glu Leu Ala Thr Asn Asn Gln Thr Ala Leu Ile Arg Ser Gly Asn 120Gly Leu Gly Gly Ser Thr Leu Val Asn Gly Gly Thr Trp Thr Arg Pro His Lys Ala Gln 140Val Asp Ser Trp Glu Thr Val Phe Gly Asn Glu Gly Trp Asn Trp Asp Asn Val Ala Ala 160Tyr Ser Leu Gln Ala Glu Arg Ala Arg Ala Pro Asn Ala Lys Gln Ile Ala Ala Gly His 180Tyr Phe Asn Ala Ser Cys His Gly Val Asn Gly Thr Val His Ala Gly Pro Arg Asp Thr 200Gly Asp Asp Tyr Ser Pro Ile Val Lys Ala Leu Met Ser Ala Val Glu Asp Arg Gly Val 220Pro Thr Lys Lys Asp Phe Gly Cys Gly Asp Pro His Gly Val Ser Met Phe Pro Asn Thr 240Leu His Glu Asp Gln Val Arg Ser Asp Ala Ala Arg Glu Trp Leu Leu Pro Asn Tyr Gln 260Arg Pro Asn Leu Gln Val Leu Thr Gly Gln Tyr Val Gly Lys Val Leu Leu Ser Gln Asn 280Gly Thr Thr Pro Arg Ala Val Gly Val Glu Phe Gly Thr His Lys Gly Asn Thr His Asn 300Val Tyr Ala Lys His Glu Val Leu Leu Ala Ala Gly Ser Ala Val Ser Pro Thr Ile Leu 320Glu Tyr Ser Gly Ile Gly Met Lys Ser Ile Leu Glu Pro Leu Gly Ile Asp Thr Val Val 340Asp Leu Pro Val Gly Leu Asn Leu Gln Asp Gln Thr Thr Ala Thr Val Arg Ser Arg Ile 360Thr Ser Ala Gly Ala Gly Gln Gly Gln Ala Ala Trp Phe Ala Thr Phe Asn Glu Thr Phe 380Gly Asp Tyr Ser Glu Lys Ala His Glu Leu Leu Asn Thr Lys Leu Glu Gln Trp Ala Glu 400Glu Ala Val Ala Arg Gly Gly Phe His Asn Thr Thr Ala Leu Leu Ile Gln Tyr Glu Asn 420Tyr Arg Asp Trp Ile Val Asn His Asn Val Ala Tyr ser Glu Leu Phe Leu Asp Thr Ala 440Gly Val Ala Ser Phe Asp Val Trp Asp Leu Leu pro Phe Thr Arg Gly Tyr Val His Ile 460Leu Asp Lys Asp Pro Tyr Leu His His Phe Ala Tyr Asp Pro Gln Tyr Phe Leu Asn Glu 480Leu Asp Leu Leu Gly Gln Ala Ala Ala Thr Gln Leu Ala Arg Asn Ile Ser Asn Ser Gly 500Ala Met Gln Thr Tyr Phe Ala Gly Glu Thr Ile Pro Gly Asp Asn Leu Ala Tyr Asp Ala 520Asp Leu Ser Ala Trp Thr Glu Tyr Ile Pro Tyr His Phe Arg Pro Asn Tyr His Gly Val 540Gly Thr Cys Ser Met Met Pro Lys Glu Met Gly Gly Val Val Asp Asn Ala Ala Arg Val 560Tyr Gly Val Gln Gly Leu Arg Val Ile Asp Gly Ser Ile Pro pro Thr Gln Met Ser Ser 580His Val Met Thr Val Phe Tyr Ala Met Ala Leu Lys Ile Ser Asp Ala Ile Leu Glu Asp 600Tyr Ala Ser Met Gln
(3) information of SEQ ID NO:3:
(I) sequence signature:
(A) length: 802 base pairs
(B) type: Nucleotide
(C) chain: strand
(D) topological framework: linearity
(II) molecule type: exogenous gene expression box 5 ' end has the 35S promoter sequence DNA that doubles enhanser
(III) suppose: non-
(IV) antisense: non-
( V ) ：SEQ ID NO：3 CAAGCTTCAT ACAGAGCTCA ATGACAAGAA GAAAATCTTC GTCAACATGG TGGAGCTCTC 60b TTACGAACGA CACGATTGTC TACTCCAAAA ATATCAAAGA TACAGTCTCA GAAGACCAAA 120bGGGCAATTGA GACTTTTCAA CAAAGGGTAA TATCCGGAAA CCTCCTCGGA TTCCATTGCC 180bCAGCTATCTG TCACTTTATT GTGAAGATAG TGGAAAAGGA AGGTGGCTCC TTACAATGCC 240bATCATTGCGA TAAAGGAAAG GCCATCGTTG AAGATGCCTC TGCCGACAGT GGTCCCAAAG 300bATGGACCCCC ACCCACGAGG AGCATCGTGG AAAAAGAAGA CGTTCCAACC ACGTCTTCAA 360bAGCAAGTGGA TTGATGTGAT ACTCCAAAAA TATCAAAGAT ACAGTCTCAG AAGACCAAAG 420bGGCAATTGAG ACTTTTCAAC AAAGGGTAAT ATCCGGAAAC CTCCTCGGAT TCCATTGCCC 480bAGCTATCTGT CACTTTATTG TGAAGATAGT GGAAAAGGAA GGTGGCTCCT TACAATGCCA 540bTCATTGCGAT AAAGGAAAGG CCATCGTTGA AGATGCCTCT GCCGACAGTG GTCCCAAAGA 600bTGGACCCCCA CCCACGAGGA GCATCGTGGA AAAAGAAGAC GTTCCAACCA CGTCTTCAAA 660bGCAAGTGGAT TGATGTGATA TCTCCACTGA CGTAAGGGAT GACGCACAAT CCCACTATCC 720bTTCGCAAGAC CCTTCCTCTA TATAAGGAAG TTCATTTCAT TTGGAGAGGA CACGCTGAAA 780bTCACCTCTAG AGGATCCCCG GG 802b
Claims (11)
1. recombinant expression vector that is suitable in plant expressing glucose oxidase gene is characterized in that described recombinant expression vector from 5 ' to 3 ' comprises successively:
A) 5 ' and the end non-coding region, it is by two enhancer sequence, a promoter sequence, one is derived from the translation enhancement sequences of plant virus capsid protein plasmagene and the dna sequence dna of a ribosome bind site is formed;
B) sequence of the nucleotide sequence shown in SEQ ID NO:1;
C) 3 ' end non-coding region, it comprises a polyadenylic acid sequence.
2. recombinant expression vector according to claim 1, wherein said 3 ' end non-coding region further comprises a multi-joint termination codon subsequence, a mRNA cutting sequence and a mRNA cutting post-treatment sequence.
3. recombinant expression vector according to claim 1, wherein said enhancer sequence are the enhanser of CaMV 35S promoter.
4. according to the recombinant expression vector of claim 1, wherein said promotor is selected from cauliflower mosaic virus 35S promoter, 19S promotor, mannopine synthase promoter, rouge alkali synthetase and octopine synthase promoter, maize alcohol dehydrogenase promotor, ribulose diphosphate carboxylase acidifying enzyme/oxydase small subunit promotor, hinder and induce or the promotor of germ evoked promoter, tissue or organ or development-specific expression promoter, vascular-specific expression.
5. recombinant expression vector according to claim 3, wherein said promotor are the promotor of cauliflower mosaic virus 35S promoter or vascular-specific expression.
6. according to the recombinant expression vector of claim 1, wherein said translation enhancement sequences is the Ω sequence.
7. a method of producing disease-resistant plants is characterized in that each the described recombinant expression vector in the claim 1～6 is imported in the described plant to obtain plant transformed.
8. method according to claim 7 is characterized in that the method that the described recombinant expression vector of claim 1 imports in the described plant is comprised agriculture bacillus mediated conversion method, pollen tube passage method.
9. method according to claim 7, wherein said plant is selected from tobacco, cotton.
10. method according to claim 10, wherein said plant are cotton.
11. the application of the described recombinant expression vector of each in the claim 1～6 in the plant expression system of manufacture and medical glucose oxidase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN99100393A CN1098931C (en) | 1999-01-28 | 1999-01-28 | Application of glucose oxidase gen to breeding disease-resistant transfer-gen |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN99100393A CN1098931C (en) | 1999-01-28 | 1999-01-28 | Application of glucose oxidase gen to breeding disease-resistant transfer-gen |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1229139A CN1229139A (en) | 1999-09-22 |
| CN1098931C true CN1098931C (en) | 2003-01-15 |
Family
ID=5269985
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN99100393A Expired - Fee Related CN1098931C (en) | 1999-01-28 | 1999-01-28 | Application of glucose oxidase gen to breeding disease-resistant transfer-gen |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1098931C (en) |
Families Citing this family (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2508600B1 (en) * | 2009-12-05 | 2015-08-12 | Amano Enzyme Inc. | Mutant enzyme and application thereof |
| JP6427110B2 (en) * | 2013-01-28 | 2018-11-21 | エフ ホフマン−ラ ロッシュ アクチェン ゲゼルシャフト | A novel glucose oxidase from Aspergillus niger |
| CN104711273B (en) * | 2015-03-17 | 2018-01-26 | 中国科学院微生物研究所 | A kind of preparation method and applications of recombinant aspergillus niger glucose oxidase |
| CN108118037B (en) * | 2016-11-28 | 2021-08-31 | 青岛蔚蓝生物集团有限公司 | Glucose oxidase mutant with improved heat resistance |
| CN108118036B (en) * | 2016-11-28 | 2021-10-29 | 青岛蔚蓝生物集团有限公司 | Novel glucose oxidase mutant |
| CN108118038B (en) * | 2016-11-28 | 2021-08-31 | 青岛蔚蓝生物集团有限公司 | Glucose oxidase mutant |
| CN108251389A (en) * | 2017-08-18 | 2018-07-06 | 青岛蔚蓝生物集团有限公司 | The glucose oxidase mutant that a kind of heat resistance improves |
| CN109423483B (en) * | 2017-08-30 | 2021-10-29 | 青岛蔚蓝生物集团有限公司 | Glucose oxidase mutant |
| CN110511913B (en) * | 2018-05-22 | 2023-11-24 | 爱科来株式会社 | Mutant glucose oxidase and use thereof |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1111676A (en) * | 1994-01-28 | 1995-11-15 | 索尔维公司 | Expression system, integration vector and cell transformed by this integration vector |
| CN1136329A (en) * | 1993-11-24 | 1996-11-20 | 孟山都公司 | Method of controlling plant pathogens |
-
1999
- 1999-01-28 CN CN99100393A patent/CN1098931C/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1136329A (en) * | 1993-11-24 | 1996-11-20 | 孟山都公司 | Method of controlling plant pathogens |
| CN1111676A (en) * | 1994-01-28 | 1995-11-15 | 索尔维公司 | Expression system, integration vector and cell transformed by this integration vector |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1229139A (en) | 1999-09-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1134542C (en) | Transgenic plants expressing DNA constructs containing plurality of genes to impart virus resistance | |
| CN1155709C (en) | Whisker-mediated transformation of plant cell aggregates and plant tissues and regeneration of plants thereof | |
| CN1176577C (en) | Modified bacillus thuringiensis gene for lepidopteran control in plants | |
| CN1192243A (en) | DNA sequence of a gene of hydroxy-phenyl pyruvate dioxygenase and production of plants containing a gene of hydroxy-phenyl pyruvate dioxygenase and which are tolerant to certain herbicides | |
| CN1031252A (en) | Halogenated aromatic base nitrile degrading genes, its cell that uses and contain this gene | |
| CN1037913C (en) | Expressive carrier with coded insect-killing protein fusion gene, and transfer gene plant | |
| CN1098931C (en) | Application of glucose oxidase gen to breeding disease-resistant transfer-gen | |
| CN1347457A (en) | Plant transformation method | |
| CN1219885C (en) | Transgenic plants comprising counditionally lethal gene and its prodn. method | |
| CN1887903A (en) | Nitrate transport protein of diatom and its coding gene and application | |
| CN1291021C (en) | Use of boea crassifolia BcBCP1 gene for breeding drought-salt-tolerant plants | |
| CN1079779A (en) | New plant promoter | |
| CN1818065A (en) | Cotton GhZFP1 gene sequence, its clone and use | |
| CN1908011A (en) | Plant inverse-resistant zinc finger protein, coding gene and application thereof | |
| CN1083884C (en) | Two kinds of encoding insecticidal protein gene and bivalent fused expression carrier and their application | |
| CN1429904A (en) | Method for gene conversion of corn | |
| CN1379783A (en) | Methods for increasing plant cell proliferation by functionally inhibiting plant cyclin inhibitor gene | |
| CN1073623C (en) | Composite coded homoptera pest-resisting gene of galanthus agglutinin and its application | |
| CN100351269C (en) | Pseudomonas pseudoalcaligenes disinsection protein gene | |
| CN1125179C (en) | Breeding disease-resistance crop with two-kind anti-fungus gen coexpressed in cell or external cell | |
| CN1285872A (en) | Gene associated with disease resistance in plants | |
| CN100336904C (en) | Pathogen from rice, chemically inducible promoter and their use | |
| CN1768577A (en) | Method for breeding anti-blight banana | |
| CN1281750C (en) | Method for time delete of specific exogenous gene using induction site-specific recombination system | |
| CN101037697A (en) | Paddy hpfr gene expression, product and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C06 | Publication | ||
| PB01 | Publication | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C19 | Lapse of patent right due to non-payment of the annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |