CN109207446B - Glucose oxidase mutant - Google Patents

Abstract

The invention relates to the technical field of protein engineering, and particularly provides a glucose oxidase mutant. The glucose oxidase three-point mutant GOD-K provided by the invention has the advantages that the residual enzyme activity after being treated at 70 ℃ for 2.5min is 68.20%, the residual enzyme activity after being treated at 75 ℃ for 2.5min is 42.76%, the residual enzyme activity is respectively improved by 19.3% and 38.1% compared with the two-point mutant GOD11, unexpected effects are obtained, the glucose oxidase three-point mutant GOD-K is more suitable for application in industrial production, and therefore, the glucose oxidase three-point mutant GOD-K has wide market prospect.

Description

Glucose oxidase mutant

Technical Field

The invention relates to the technical field of protein engineering, in particular to a glucose oxidase mutant and application thereof.

Background

Glucose Oxidase (GOD), which is an enzyme capable of specifically catalyzing the formation of gluconic acid and hydrogen peroxide from beta-D-glucose in the presence of oxygen. Glucose oxidase is a homodimeric molecule containing 2 Flavin Adenine Dinucleotide (FAD) binding sites. Each monomer contains 2 distinct regions: one non-covalently but tightly bound to the portion FAD, primarily as an acoustic fold; the other binds to the substrate β -D-glucose, supporting 1 antiparallel β -sheet by 4 α -helices.

Glucose oxidase is widely distributed in animals, plants and microorganisms. However, the content of glucose oxidase in animal and plant tissues is limited, and microorganisms are widely used as a source for producing glucose oxidase due to the advantages of wide sources, short growth cycle and the like. However, the level of glucose oxidase produced by natural strains is not high, and the natural strains are difficult to be directly used for producing the glucose oxidase. On one hand, the high-yield strain of the glucose oxidase can be obtained by traditional methods such as strain mutagenesis, strain fermentation condition optimization and the like; on the other hand, a glucose oxidase high-yield strain is obtained by methods such as gene recombination, and the glucose oxidase is obtained by adopting recombinant engineering bacteria.

The glucose oxidase has a plurality of purposes in industrial production, can remove oxygen and keep fresh, remove glucose in food industry, and can be used for medical diagnosis, such as colorimetric blood glucose test paper and a blood glucose detector based on a biosensor after being refined. In the feed industry, as a feed additive, glucose oxidase can relieve intestinal mycotoxin poisoning and reduce the over-standard harm of feed mould; meanwhile, the glucose oxidase catalyzes glucose in animal intestinal tracts to generate gluconic acid, the gluconic acid can reduce the pH value of chyme in the stomach, effectively inhibit the reproduction of harmful bacteria, promote the growth of beneficial bacteria, activate the activity of pepsin, and facilitate the digestion and absorption of nutritional ingredients such as protein, vitamins, minerals and the like, thereby improving the feed conversion efficiency; the livestock and poultry feed added with the glucose oxidase can protect the integrity of intestinal epithelial cells and prevent pathogen invasion by removing free radicals generated by the animal in response to stress.

However, the short-term high temperature process in the feed processing process can cause the inactivation of glucose oxidase, which affects the application effect of glucose oxidase, and the temperature resistance of glucose oxidase is more and more concerned on the premise that the yield of glucose oxidase is ensured, so that the development of glucose oxidase with strong temperature resistance by genetic engineering means is urgent.

Disclosure of Invention

The invention aims to provide a glucose oxidase mutant which has obviously improved heat resistance and is beneficial to wide application in the field of feed.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides a glucose oxidase mutant, which has any one of amino acid sequences shown in (I), (II) or (III):

(I) a sequence having at least 95% homology with the amino acid sequence of glucose oxidase SEQ ID NO: 1;

(II) an amino acid sequence which has at least one immune epitope of the glucose oxidase described in the (I) and is obtained by modifying, substituting, deleting or adding one or more amino acids in the amino acid sequence of the glucose oxidase;

(III) an amino acid sequence encoded by a nucleotide sequence shown by SEQ ID NO:2 or a complementary sequence thereof or a sequence that differs from the nucleotide sequence shown by SEQ ID NO:2 or a complementary sequence thereof due to degeneracy of the genetic code;

in some embodiments of the invention, the substitution is a substitution of 2 or more amino acids.

In other embodiments of the invention, the substitution comprises a substitution of amino acids 65 and 416 of the glucose oxidase having the amino acid sequence of SEQ ID NO. 1.

In other embodiments of the invention, the substitution comprises changing amino acid 65 of the glucose oxidase having the amino acid sequence of SEQ ID NO. 1 from A to R and changing amino acid 416 from A to K.

In other embodiments of the invention, the amino acid sequence of the mutant is SEQ ID NO 3, and the nucleotide sequence of one of the genes encoding it is SEQ ID NO: 4.

in other embodiments of the invention, the substitution further comprises a substitution at amino acid 275.

In other embodiments of the invention, the substitution further comprises changing amino acid 275 from H to F.

In other embodiments of the invention, the amino acid sequence of the mutant is SEQ ID NO 5, and the nucleotide sequence of one of the genes encoding it is SEQ ID NO: 6.

the invention also provides a recombinant expression vector carrying the coding gene of the glucose oxidase mutant.

The invention also provides a host cell comprising the recombinant expression vector.

In some embodiments of the invention, the host cell is pichia pastoris.

The invention also provides application of the glucose oxidase mutant in feed.

The glucose oxidase two-point mutant GOD11(A65R and A416K) provided by the invention has the residual enzyme activity of 57.18% after being processed at 70 ℃ for 2.5min and the residual enzyme activity of 30.96% after being processed at 75 ℃ for 2.5 min; the three-point mutant GOD-K (A65R, H275F and A416K) provided by the invention has the residual enzyme activity of 68.20% after being treated at 70 ℃ for 2.5min and the residual enzyme activity of 42.76% after being treated at 75 ℃ for 2.5min, and is respectively improved by 19.3% and 38.1% compared with the glucose oxidase mutant GOD11, so that unexpected effects are obtained. The results show that the heat resistance of the enzyme is greatly improved by introducing the H275F mutation on the basis of the glucose oxidase mutant GOD11, and the enzyme is more suitable for application in industrial production, so that the enzyme has a wide market prospect.

Detailed Description

The present invention uses conventional techniques and methods used IN the fields of genetic engineering and MOLECULAR BIOLOGY, such as the methods described IN MOLECULAR CLONING, A LABORATORY MANUAL,3nd Ed. (Sambrook,2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can adopt other conventional methods, experimental schemes and reagents in the field on the basis of the technical scheme described in the invention, and the invention is not limited to the specific embodiment of the invention.

Wherein A, R, K, F, H are abbreviations for amino acids Ala, Arg, Lys, Phe, His, respectively.

The experimental materials and reagents used in the specific examples of the present invention are as follows:

strain and carrier: coli DH5 α, Pichia pastoris GS115, vector pPIC9K, Amp, G418 were purchased from Invitrogen.

Enzyme and kit: PCR enzyme and ligase were purchased from Takara, restriction enzyme was purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomais Biotech.

The formula of the culture medium is as follows:

coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, ph 7.0);

LB-AMP medium: adding 100 mu g/mL ampicillin into LB culture medium;

yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

yeast screening medium (MD medium): 2% glucose, 2% agarose, 1.34% YNB, 4X 10^-5Biotin;

BMGY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer(pH6.0)，1.34％YNB，4×10^-5Biotin, 1% glycerol;

BMMY medium: 2% peptone, 1% yeast extract, 100mM potassium phosphate buffer (pH6.0), 1.34% YNB, 4X 10^-5Biotin, 0.5% methanol.

The present invention will be described in detail with reference to examples.

Example 1 Synthesis of glucose oxidase mutant GOD11 Gene and obtaining of recombinant plasmid

In order to improve the heat resistance of glucose oxidase (amino acid sequence SEQ ID NO:1, and coding nucleotide sequence SEQ ID NO:2), applicants performed mutation at amino acid positions 65 and 416, where amino acid 65 was changed from A to R and amino acid 416 was changed from A to K.

The glucose oxidase mutant containing the 2 mutation sites is named as GOD11, the sequence of the mutant is optimally synthesized by Shanghai Jieli bioengineering limited company according to the password preference of pichia pastoris, the amino acid sequence of the mutant is SEQ ID NO. 3, the coding nucleotide sequence of the mutant is SEQ ID NO. 4, and two restriction enzyme cutting sites of EcoRI and NotI are respectively added at the two ends of the 5 'and 3' of the synthetic sequence.

EcoRI and NotI double enzyme digestion is carried out on the synthesized GOD11 gene sequence, the obtained GOD11 gene sequence is connected with a pPIC-9K carrier subjected to the same enzyme digestion at 16 ℃ overnight, escherichia coli DH5a is transformed, the obtained product is coated on an LB + Amp plate, inverted culture is carried out at 37 ℃, after a transformant appears, colony PCR (a reaction system: a single clone picked by a template, rTaqDNA polymerase 0.5ul, 10 xBuffer 2.0 muL, dNTPs (2.5mM)2.0 muL, a5 'AOX primer (10M): 0.5 muL, a 3' AOX primer 0.5 muL and ddH2O 14.5.5 muL, a reaction program: pre-denaturation at 95 ℃ for 5min, 30cycles at 94 ℃ for 30sec, at 55 ℃ for 30sec, 2min at 72 ℃ for 5 ℃ for 10min and a positive clone is verified, and a correct recombinant expression plasmid is obtained after sequencing verification, and is named as pPIC9K-GOD 11.

Example 2 screening of thermostable mutants

In order to further improve the heat resistance of the glucose oxidase mutant GOD11, the applicant screens a large number of mutations of the enzyme by an directed evolution technology, and designs PCR primers GOD-F1 and GOD-R1 as follows:

GOD-F1：GGCGAATTCGGTATTGAGGCATCTTTGTTGAC (restriction enzyme EcoRI recognition site underlined)

GOD-R1：ATAGCGGCCGCTTATTGCATAGAAGCGTAATC (recognition site for restriction endonuclease Not I underlined)

Using GOD11 gene as a template, carrying out PCR amplification by using the primers through a GeneMorph II random mutation PCR kit (Stratagene), carrying out gel recovery PCR products, carrying out enzyme digestion treatment on EcoRI and Not I, then connecting with pET21a vector subjected to the same enzyme digestion, transforming into escherichia coli BL21(DE3), coating on an LB + Amp plate, carrying out inversion culture at 37 ℃, after transformants appear, selecting to a 96-well plate one by one through toothpicks, adding 150ul LB + Amp culture medium containing 0.1mM IPTG into each well, carrying out culture at 220rpm at 37 ℃ for about 6h, centrifuging, abandoning supernatant, carrying out resuspension on thalli by using buffer solution, and repeatedly freezing and thawing for breaking walls to obtain escherichia coli cell lysate containing glucose oxidase.

And respectively taking out 10 mu L of lysate to two new 96-well plates, treating one of the two 96-well plates at 70 ℃ for 5min, adding 40 mu L of substrate into the two 96-well plates, reacting at 30 ℃ for 30min, determining the generated reducing sugar by using a DNS method, and calculating the relative enzyme activity of the enzyme solution subjected to high-temperature treatment compared with the enzyme solution not subjected to high-temperature treatment. The experimental result shows that some mutations have no influence on the heat resistance of the glucose oxidase GOD11, and some mutations even make the heat resistance or the enzyme activity of the glucose oxidase GOD11 worse; in addition, some mutations can improve the temperature tolerance of the glucose oxidase GOD11, but the enzymatic properties of the mutant are obviously changed, and the mutations do not meet the requirements. Finally, the applicant screens mutation sites which can remarkably improve the heat resistance of the glucose oxidase GOD11 and cannot influence the enzyme activity and the original enzymology property: H275F.

The glucose oxidase mutant gene containing H275F site mutation is named as GOD-K, and the coded glucose oxidase GOD-K amino acid sequence and nucleotide sequence are shown in SEQ ID NO:5 and SEQ ID NO: and 6.

A recombinant expression plasmid carrying the glucose oxidase mutant gene GOD-K was further obtained by the method described in example 1 and named pPIC 9K-GOD-K.

Example 3 construction of Pichia engineering Strain

The expression plasmids pPIC9K-GOD-11 and pPIC9K-GOD-K are respectively linearized by Sal I, the linearized fragments of the expression plasmids are transformed into Pichia pastoris GS115 by an electroporation method, Pichia pastoris recombinant strains GS115/pPIC9K-GOD-11 and GS115/pPIC9K-GOD-K are respectively obtained by screening on an MD culture medium, and then transformants with multiple copies are respectively screened on YPD culture media containing different concentrations of geneticin.

The transformants of the screened mutant are named as Pichia pastoris GOD-11(Pichia pastoris GOD-11) and Pichia pastoris GOD-K (Pichia pastoris GOD-K) respectively, and are transferred into a BMGY culture medium and are subjected to shaking culture at 30 ℃ and 250rpm for 1 d; then transferring the strain into a BMMY culture medium, and carrying out shaking culture at 30 ℃ and 250 rpm; adding 0.5% methanol every day to induce expression for 4 d; centrifuging to remove thalli, and respectively obtaining fermentation supernatant containing glucose oxidase mutants GOD11 and GOD-K; it was analyzed by SDS-PAGE electrophoretic detection. The results show that the glucose oxidase mutants GOD11 and GOD-K in the fermentation supernatant have a molecular weight of approximately 64kDa, which is the same as the theoretical molecular weight.

(1) Definition of the enzyme Activity Unit of glucose oxidase

The amount of enzyme required to oxidize 1. mu. mol of beta-D-glucose to D-gluconic acid and hydrogen peroxide per minute at 30 ℃ at pH6.0 is defined as 1 enzyme activity unit (IU).

(2) Enzyme activity measuring method

The crude enzyme solution was directly diluted with buffer to about 10U/mL. 4 150X 15 tubes were taken, 2ml buffer, 0.3ml glucose, 0.4ml phenol, 0.1ml 4-aminoantipyrine, 0.1ml horseradish peroxidase were added, and preheated at 30 ℃ for 5 min. 0.1ml of distilled water was added to one tube and zeroed as a blank. The water bath was placed next to the spectrophotometer for ease of handling, 0.1ml of sample solution was added to the sample tube at which time the timing was started, and after vortex mixing the samples were immediately colorimeted using a 1cm cuvette at a wavelength of 500 nm. The absorbance value was a0 at 0.5min and after 1min of further reaction, a1 was read to give a Δ a500 ═ a1-a 0.

The enzyme activity calculation formula is as follows:

the enzyme activity X1(U/mL or U/g) in the sample was calculated according to the following formula:

X1＝ΔA500×f×B×1000/(887×t×A×d)＝33.82×ΔA500×f

in the formula:

f- -dilution of the enzyme solution

B- -volume of reaction solution (3ml)

1000- -extinction coefficient Unit conversion factor

887- -extinction coefficient (L. mol-1. cm-1)

t- -reaction time (min), i.e. the time difference between the readings A1 and A0, is 1 min.

A- -addition of sample volume (0.1ml)

d- -thickness of the cuvette (cm)

(3) Results of enzyme Activity measurement

The enzyme activity of the fermentation supernatant is measured according to the method, and the result shows that: enzyme activities of fermentation supernatants of pichia pastoris GOD-11 and pichia pastoris GOD-K of the recombinant expression glucose oxidase mutant reach 101U/mL and 90U/mL respectively.

Example 4 fermentation validation

Fermentation of pichia pastoris GOD-11 and pichia pastoris GOD-K is respectively carried out on a 10-liter fermentation tank, and the formula of a culture medium used for fermentation is as follows: 1.1g/L of calcium sulfate, 5.5g/L of potassium dihydrogen phosphate, 55g/L of ammonium dihydrogen phosphate, 20.3g/L of potassium sulfate, 16.4g/L of magnesium sulfate, 1.65g/L of potassium hydroxide and 0.05% of defoaming agent.

The fermentation process comprises the following steps: the pH value is 5.0, the temperature is 30 ℃, the stirring speed is 300rpm, the ventilation quantity is 1.0-1.5(v/v), and the dissolved oxygen is controlled to be more than 20%.

The whole fermentation process is divided into three stages: the first stage is a thallus culture stage, seeds are inoculated according to the proportion of 7 percent, and the mixture is cultured for 24 to 26 hours at the temperature of 30 ℃ with the mark of complete glucose supplementation; the second stage is a starvation stage, when the glucose is supplemented, no carbon source is added, when the dissolved oxygen rises to more than 80%, the stage is ended, and the period is about 30-60 min; the third stage is an induction expression stage, methanol is fed for induction, dissolved oxygen is kept to be more than 20%, and the culture time is between 150 and 180 hours. After the fermentation is finished, the fermentation liquor is processed by a plate and frame filter to obtain a crude enzyme liquid.

The enzyme activity detection method of glucose oxidase described in example 3 is adopted to detect the enzyme activity of the crude enzyme solution, and the results show that the enzyme activities of the fermented crude enzyme solutions of pichia pastoris GOD-11 and pichia pastoris GOD-K for recombinant expression of glucose oxidase mutants respectively reach 3211U/ml and 2990U/ml.

Example 5 enzymatic Properties of glucose oxidase mutants

1. Optimum pH for action

Glucose oxidase activity determination is carried out on the crude fermentation enzyme liquid of example 4 at 30 ℃ by adopting disodium hydrogen phosphate-citric acid buffer solutions with pH values of 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5 and 8.0 respectively, the highest enzyme activity is 100%, and the relative enzyme activity is calculated, so that the results show that the optimal action pH values of glucose oxidase mutants GOD11 and GOD-K are both 6.0, and the relative enzyme activity levels under different pH conditions are not greatly different.

2. Optimum reaction temperature

The crude enzyme solution described in example 4 was subjected to glucose oxidase enzyme activity measurement under conditions of 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃, 75 ℃ and pH 5.0, respectively, and the relative enzyme activities were calculated with the highest enzyme activity being 100%, and the results showed that the optimum action temperatures of the glucose oxidase mutants GOD11 and GOD-K were both 35 ℃.

3. Analysis of thermal stability

Diluting the crude enzyme solution with acetic acid-sodium acetate buffer solution with pH of 6.0, treating at 70 deg.C for 2.5min and at 75 deg.C for 2.5min, respectively, and measuring enzyme activity, and calculating residual enzyme activity with enzyme activity of untreated sample as 100%.

The results show that: the glucose oxidase two-point mutant GOD11(A65R and A416K) provided by the invention has the residual enzyme activity of 57.18% after being processed at 70 ℃ for 2.5min and the residual enzyme activity of 30.96% after being processed at 75 ℃ for 2.5 min; the three-point mutant GOD-K (A65R, H275F and A416K) provided by the invention has the residual enzyme activity of 68.20% after being treated at 70 ℃ for 2.5min and 42.76% after being treated at 75 ℃ for 2.5min, which are respectively increased by 19.3% and 38.1% compared with the glucose oxidase mutant GOD11, the heat resistance is obviously improved, and unexpected effects are obtained.

The results show that the heat resistance of the enzyme is greatly improved by introducing the H275F mutation on the basis of the glucose oxidase mutant GOD11, and the enzyme is more suitable for application in industrial production, so that the enzyme has a wide market prospect.

SEQUENCE LISTING

<110> Islands blue biological group Co Ltd

<120> glucose oxidase mutant

<130>

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 581

<212> PRT

<213> 1

<400> 1

Gly Ile Glu Ala Ser Leu Leu Thr Asp Pro Lys Asp Val Ser Gly Arg

1 5 10 15

Thr Val Asp Tyr Ile Ile Ala Gly Gly Gly Leu Thr Gly Leu Thr Thr

20 25 30

Ala Ala Arg Leu Thr Glu Asn Pro Asn Ile Ser Val Leu Val Ile Glu

35 40 45

Ser Gly Ser Tyr Glu Ser Asp Arg Gly Pro Ile Ile Glu Asp Leu Asn

50 55 60

Ala Tyr Gly Asp Ile Phe Gly Ser Ser Val Asp His Ala Tyr Glu Thr

65 70 75 80

Val Glu Leu Ala Thr Asn Asn Gln Thr Ala Leu Ile Arg Ser Gly Asn

85 90 95

Gly Leu Gly Gly Ser Thr Leu Val Asn Gly Gly Thr Trp Thr Arg Pro

100 105 110

His Lys Ala Gln Val Asp Ser Trp Glu Thr Val Phe Gly Asn Glu Gly

115 120 125

Trp Asn Trp Asp Asn Val Ala Ala Tyr Ser Leu Gln Ala Glu Arg Ala

130 135 140

Arg Ala Pro Asn Ala Lys Gln Ile Ala Ala Gly His Tyr Phe Asn Ala

145 150 155 160

Ser Cys His Gly Val Asn Gly Thr Val His Ala Gly Pro Arg Asp Thr

165 170 175

Gly Asp Asp Tyr Ser Pro Ile Val Lys Ala Leu Met Ser Ala Val Glu

180 185 190

Asp Arg Gly Val Pro Thr Lys Lys Asp Phe Gly Cys Gly Asp Pro His

195 200 205

Gly Val Ser Met Phe Pro Asn Thr Leu His Glu Asp Gln Val Arg Ser

210 215 220

Asp Ala Ala Arg Glu Trp Leu Leu Pro Asn Tyr Gln Arg Pro Asn Leu

225 230 235 240

Gln Val Leu Thr Gly Gln Tyr Val Gly Lys Val Leu Leu Ser Gln Asn

245 250 255

Gly Thr Thr Pro Arg Ala Val Gly Val Glu Phe Gly Thr His Lys Gly

260 265 270

Asn Thr His Asn Val Tyr Ala Lys His Glu Val Leu Leu Ala Ala Gly

275 280 285

Ser Ala Val Ser Pro Thr Ile Leu Glu Tyr Ser Gly Ile Gly Met Lys

290 295 300

Ser Ile Leu Glu Pro Leu Gly Ile Asp Thr Val Val Asp Leu Pro Val

305 310 315 320

Gly Leu Asn Leu Gln Asp Gln Thr Thr Ala Thr Val Arg Ser Arg Ile

325 330 335

Thr Ser Ala Gly Ala Gly Gln Gly Gln Ala Ala Trp Phe Ala Thr Phe

340 345 350

Asn Glu Thr Phe Gly Asp Tyr Ser Glu Lys Ala His Glu Leu Leu Asn

355 360 365

Thr Lys Leu Glu Gln Trp Ala Glu Glu Ala Val Ala Arg Gly Gly Phe

370 375 380

His Asn Thr Thr Ala Leu Leu Ile Gln Tyr Glu Asn Tyr Arg Asp Trp

385 390 395 400

Ile Val Asn His Asn Val Ala Tyr Ser Glu Leu Phe Leu Asp Thr Ala

405 410 415

Gly Val Ala Ser Phe Asp Val Trp Asp Leu Leu Pro Phe Thr Arg Gly

420 425 430

Tyr Val His Ile Leu Asp Lys Asp Pro Tyr Leu His His Phe Ala Tyr

435 440 445

Asp Pro Gln Tyr Phe Leu Asn Glu Leu Asp Leu Leu Gly Gln Ala Ala

450 455 460

Ala Thr Gln Leu Ala Arg Asn Ile Ser Asn Ser Gly Ala Met Gln Thr

465 470 475 480

Tyr Phe Ala Gly Glu Thr Ile Pro Gly Asp Asn Leu Ala Tyr Asp Ala

485 490 495

Asp Leu Ser Ala Trp Thr Glu Tyr Ile Pro Tyr His Phe Arg Pro Asn

500 505 510

Tyr His Gly Val Gly Thr Cys Ser Met Met Pro Lys Glu Met Gly Gly

515 520 525

Val Val Asp Asn Ala Ala Arg Val Tyr Gly Val Gln Gly Leu Arg Val

530 535 540

Ile Asp Gly Ser Ile Pro Pro Thr Gln Met Ser Ser His Val Met Thr

545 550 555 560

Val Phe Tyr Ala Met Ala Leu Lys Ile Ser Asp Ala Ile Leu Glu Asp

565 570 575

Tyr Ala Ser Met Gln

580

<210> 2

<211> 1746

<212> DNA

<213> 2

<400> 2

ggtattgagg catctttgtt gacagaccct aaggatgttt ctggaagaac cgttgactac 60

attattgctg gtggtggttt gaccggattg accactgccg caagattgac tgaaaatcca 120

aacatctctg ttttggtcat cgagtctggt tcttacgaat ctgacagagg acctattatc 180

gaagacttga acgcttacgg tgatattttc ggatcttctg ttgatcatgc ctacgagaca 240

gttgagttgg ctactaacaa tcagactgct ttgattaggt ctggaaatgg tttgggtgga 300

tctactttgg ttaatggagg tacttggact agaccacata aggctcaggt tgattcttgg 360

gaaactgttt ttggtaacga aggttggaac tgggataacg ttgcagctta ctctttgcaa 420

gcagaaagag ctagggctcc aaacgctaag caaattgctg ctggtcatta ctttaacgct 480

tcttgtcacg gtgttaacgg aactgtccac gccggaccta gagacactgg agatgattac 540

tctccaattg tcaaggcatt gatgtctgct gttgaagata gaggagtccc aaccaagaag 600

gatttcggtt gtggtgatcc acatggtgtt tctatgttcc caaatacatt gcacgaagat 660

caagttaggt ctgacgctgc tagagaatgg ttgttgccaa attatcaaag accaaacttg 720

caggtcttga ctggtcagta cgtcggtaag gttttgttgt ctcaaaacgg tactactcca 780

agagctgtcg gtgtcgagtt cggtactcat aagggtaata ctcacaacgt ttacgctaag 840

catgaagttt tgttggctgc tggttctgct gtttctccaa ccatcttgga gtattctgga 900

attggtatga agtctatttt ggaaccattg ggtattgata ctgtcgttga tttgccagtt 960

ggtttgaact tgcaggatca gactacagcc actgtcagat ccagaattac ttctgctggt 1020

gctggtcaag gtcaggctgc atggtttgct acttttaacg aaacttttgg tgattactct 1080

gaaaaggctc atgaattgtt gaacactaag ttggaacaat gggctgaaga agctgttgct 1140

agaggtggtt ttcataatac tactgctttg ttgattcaat acgaaaacta cagagactgg 1200

attgttaacc ataacgttgc ctattctgag ttgtttttgg acaccgctgg tgttgcttct 1260

tttgatgttt gggatttgtt gccatttaca agaggttacg ttcacatttt ggataaagat 1320

ccatacttgc atcactttgc atacgatcca caatactttt tgaacgaatt ggacttgttg 1380

ggtcaagctg ctgctactca attggctaga aacatttcta actctggtgc aatgcaaact 1440

tactttgccg gtgaaactat cccaggagat aacttggctt acgatgctga tttgtctgct 1500

tggactgaat acattccata ccatttcaga ccaaactacc acggtgtcgg tacttgttct 1560

atgatgccaa aggaaatggg aggtgttgtc gataacgctg caagagtcta cggagttcaa 1620

ggtttgagag ttattgatgg ttctattcca ccaactcaaa tgtcttctca tgttatgact 1680

gttttttacg ctatggcttt gaagatttct gatgctatct tggaagatta cgcttctatg 1740

caataa 1746

<210> 3

<211> 581

<212> PRT

<213> 3

<400> 3

Gly Ile Glu Ala Ser Leu Leu Thr Asp Pro Lys Asp Val Ser Gly Arg

1 5 10 15

Thr Val Asp Tyr Ile Ile Ala Gly Gly Gly Leu Thr Gly Leu Thr Thr

20 25 30

Ala Ala Arg Leu Thr Glu Asn Pro Asn Ile Ser Val Leu Val Ile Glu

35 40 45

Ser Gly Ser Tyr Glu Ser Asp Arg Gly Pro Ile Ile Glu Asp Leu Asn

50 55 60

Arg Tyr Gly Asp Ile Phe Gly Ser Ser Val Asp His Ala Tyr Glu Thr

65 70 75 80

Val Glu Leu Ala Thr Asn Asn Gln Thr Ala Leu Ile Arg Ser Gly Asn

85 90 95

Gly Leu Gly Gly Ser Thr Leu Val Asn Gly Gly Thr Trp Thr Arg Pro

100 105 110

His Lys Ala Gln Val Asp Ser Trp Glu Thr Val Phe Gly Asn Glu Gly

115 120 125

Trp Asn Trp Asp Asn Val Ala Ala Tyr Ser Leu Gln Ala Glu Arg Ala

130 135 140

Arg Ala Pro Asn Ala Lys Gln Ile Ala Ala Gly His Tyr Phe Asn Ala

145 150 155 160

Ser Cys His Gly Val Asn Gly Thr Val His Ala Gly Pro Arg Asp Thr

165 170 175

Gly Asp Asp Tyr Ser Pro Ile Val Lys Ala Leu Met Ser Ala Val Glu

180 185 190

Asp Arg Gly Val Pro Thr Lys Lys Asp Phe Gly Cys Gly Asp Pro His

195 200 205

Gly Val Ser Met Phe Pro Asn Thr Leu His Glu Asp Gln Val Arg Ser

210 215 220

Asp Ala Ala Arg Glu Trp Leu Leu Pro Asn Tyr Gln Arg Pro Asn Leu

225 230 235 240

Gln Val Leu Thr Gly Gln Tyr Val Gly Lys Val Leu Leu Ser Gln Asn

245 250 255

Gly Thr Thr Pro Arg Ala Val Gly Val Glu Phe Gly Thr His Lys Gly

260 265 270

Asn Thr His Asn Val Tyr Ala Lys His Glu Val Leu Leu Ala Ala Gly

275 280 285

Ser Ala Val Ser Pro Thr Ile Leu Glu Tyr Ser Gly Ile Gly Met Lys

290 295 300

Ser Ile Leu Glu Pro Leu Gly Ile Asp Thr Val Val Asp Leu Pro Val

305 310 315 320

Gly Leu Asn Leu Gln Asp Gln Thr Thr Ala Thr Val Arg Ser Arg Ile

325 330 335

Thr Ser Ala Gly Ala Gly Gln Gly Gln Ala Ala Trp Phe Ala Thr Phe

340 345 350

Asn Glu Thr Phe Gly Asp Tyr Ser Glu Lys Ala His Glu Leu Leu Asn

355 360 365

Thr Lys Leu Glu Gln Trp Ala Glu Glu Ala Val Ala Arg Gly Gly Phe

370 375 380

His Asn Thr Thr Ala Leu Leu Ile Gln Tyr Glu Asn Tyr Arg Asp Trp

385 390 395 400

Ile Val Asn His Asn Val Ala Tyr Ser Glu Leu Phe Leu Asp Thr Lys

405 410 415

Gly Val Ala Ser Phe Asp Val Trp Asp Leu Leu Pro Phe Thr Arg Gly

420 425 430

Tyr Val His Ile Leu Asp Lys Asp Pro Tyr Leu His His Phe Ala Tyr

435 440 445

Asp Pro Gln Tyr Phe Leu Asn Glu Leu Asp Leu Leu Gly Gln Ala Ala

450 455 460

Ala Thr Gln Leu Ala Arg Asn Ile Ser Asn Ser Gly Ala Met Gln Thr

465 470 475 480

Tyr Phe Ala Gly Glu Thr Ile Pro Gly Asp Asn Leu Ala Tyr Asp Ala

485 490 495

Asp Leu Ser Ala Trp Thr Glu Tyr Ile Pro Tyr His Phe Arg Pro Asn

500 505 510

Tyr His Gly Val Gly Thr Cys Ser Met Met Pro Lys Glu Met Gly Gly

515 520 525

Val Val Asp Asn Ala Ala Arg Val Tyr Gly Val Gln Gly Leu Arg Val

530 535 540

Ile Asp Gly Ser Ile Pro Pro Thr Gln Met Ser Ser His Val Met Thr

545 550 555 560

Val Phe Tyr Ala Met Ala Leu Lys Ile Ser Asp Ala Ile Leu Glu Asp

565 570 575

Tyr Ala Ser Met Gln

580

<210> 4

<211> 1746

<212> DNA

<213> 4

<400> 4

ggtattgagg catctttgtt gacagaccct aaggatgttt ctggaagaac cgttgactac 60

attattgctg gtggtggttt gaccggattg accactgccg caagattgac tgaaaatcca 120

aacatctctg ttttggtcat cgagtctggt tcttacgaat ctgacagagg acctattatc 180

gaagacttga acagatacgg tgatattttc ggatcttctg ttgatcatgc ctacgagaca 240

gttgagttgg ctactaacaa tcagactgct ttgattaggt ctggaaatgg tttgggtgga 300

tctactttgg ttaatggagg tacttggact agaccacata aggctcaggt tgattcttgg 360

gaaactgttt ttggtaacga aggttggaac tgggataacg ttgcagctta ctctttgcaa 420

gcagaaagag ctagggctcc aaacgctaag caaattgctg ctggtcatta ctttaacgct 480

tcttgtcacg gtgttaacgg aactgtccac gccggaccta gagacactgg agatgattac 540

tctccaattg tcaaggcatt gatgtctgct gttgaagata gaggagtccc aaccaagaag 600

gatttcggtt gtggtgatcc acatggtgtt tctatgttcc caaatacatt gcacgaagat 660

caagttaggt ctgacgctgc tagagaatgg ttgttgccaa attatcaaag accaaacttg 720

caggtcttga ctggtcagta cgtcggtaag gttttgttgt ctcaaaacgg tactactcca 780

agagctgtcg gtgtcgagtt cggtactcat aagggtaata ctcacaacgt ttacgctaag 840

catgaagttt tgttggctgc tggttctgct gtttctccaa ccatcttgga gtattctgga 900

attggtatga agtctatttt ggaaccattg ggtattgata ctgtcgttga tttgccagtt 960

ggtttgaact tgcaggatca gactacagcc actgtcagat ccagaattac ttctgctggt 1020

gctggtcaag gtcaggctgc atggtttgct acttttaacg aaacttttgg tgattactct 1080

gaaaaggctc atgaattgtt gaacactaag ttggaacaat gggctgaaga agctgttgct 1140

agaggtggtt ttcataatac tactgctttg ttgattcaat acgaaaacta cagagactgg 1200

attgttaacc ataacgttgc ctattctgag ttgtttttgg acaccaaggg tgttgcttct 1260

tttgatgttt gggatttgtt gccatttaca agaggttacg ttcacatttt ggataaagat 1320

ccatacttgc atcactttgc atacgatcca caatactttt tgaacgaatt ggacttgttg 1380

ggtcaagctg ctgctactca attggctaga aacatttcta actctggtgc aatgcaaact 1440

tactttgccg gtgaaactat cccaggagat aacttggctt acgatgctga tttgtctgct 1500

tggactgaat acattccata ccatttcaga ccaaactacc acggtgtcgg tacttgttct 1560

atgatgccaa aggaaatggg aggtgttgtc gataacgctg caagagtcta cggagttcaa 1620

ggtttgagag ttattgatgg ttctattcca ccaactcaaa tgtcttctca tgttatgact 1680

gttttttacg ctatggcttt gaagatttct gatgctatct tggaagatta cgcttctatg 1740

caataa 1746

<210> 5

<211> 581

<212> PRT

<213> 5

<400> 5

Gly Ile Glu Ala Ser Leu Leu Thr Asp Pro Lys Asp Val Ser Gly Arg

1 5 10 15

Thr Val Asp Tyr Ile Ile Ala Gly Gly Gly Leu Thr Gly Leu Thr Thr

20 25 30

Ala Ala Arg Leu Thr Glu Asn Pro Asn Ile Ser Val Leu Val Ile Glu

35 40 45

Ser Gly Ser Tyr Glu Ser Asp Arg Gly Pro Ile Ile Glu Asp Leu Asn

50 55 60

Arg Tyr Gly Asp Ile Phe Gly Ser Ser Val Asp His Ala Tyr Glu Thr

65 70 75 80

Val Glu Leu Ala Thr Asn Asn Gln Thr Ala Leu Ile Arg Ser Gly Asn

85 90 95

Gly Leu Gly Gly Ser Thr Leu Val Asn Gly Gly Thr Trp Thr Arg Pro

100 105 110

His Lys Ala Gln Val Asp Ser Trp Glu Thr Val Phe Gly Asn Glu Gly

115 120 125

Trp Asn Trp Asp Asn Val Ala Ala Tyr Ser Leu Gln Ala Glu Arg Ala

130 135 140

Arg Ala Pro Asn Ala Lys Gln Ile Ala Ala Gly His Tyr Phe Asn Ala

145 150 155 160

Ser Cys His Gly Val Asn Gly Thr Val His Ala Gly Pro Arg Asp Thr

165 170 175

Gly Asp Asp Tyr Ser Pro Ile Val Lys Ala Leu Met Ser Ala Val Glu

180 185 190

Asp Arg Gly Val Pro Thr Lys Lys Asp Phe Gly Cys Gly Asp Pro His

195 200 205

Gly Val Ser Met Phe Pro Asn Thr Leu His Glu Asp Gln Val Arg Ser

210 215 220

Asp Ala Ala Arg Glu Trp Leu Leu Pro Asn Tyr Gln Arg Pro Asn Leu

225 230 235 240

Gln Val Leu Thr Gly Gln Tyr Val Gly Lys Val Leu Leu Ser Gln Asn

245 250 255

Gly Thr Thr Pro Arg Ala Val Gly Val Glu Phe Gly Thr His Lys Gly

260 265 270

Asn Thr Phe Asn Val Tyr Ala Lys His Glu Val Leu Leu Ala Ala Gly

275 280 285

Ser Ala Val Ser Pro Thr Ile Leu Glu Tyr Ser Gly Ile Gly Met Lys

290 295 300

Ser Ile Leu Glu Pro Leu Gly Ile Asp Thr Val Val Asp Leu Pro Val

305 310 315 320

Gly Leu Asn Leu Gln Asp Gln Thr Thr Ala Thr Val Arg Ser Arg Ile

325 330 335

Thr Ser Ala Gly Ala Gly Gln Gly Gln Ala Ala Trp Phe Ala Thr Phe

340 345 350

Asn Glu Thr Phe Gly Asp Tyr Ser Glu Lys Ala His Glu Leu Leu Asn

355 360 365

Thr Lys Leu Glu Gln Trp Ala Glu Glu Ala Val Ala Arg Gly Gly Phe

370 375 380

His Asn Thr Thr Ala Leu Leu Ile Gln Tyr Glu Asn Tyr Arg Asp Trp

385 390 395 400

Ile Val Asn His Asn Val Ala Tyr Ser Glu Leu Phe Leu Asp Thr Lys

405 410 415

Gly Val Ala Ser Phe Asp Val Trp Asp Leu Leu Pro Phe Thr Arg Gly

420 425 430

Tyr Val His Ile Leu Asp Lys Asp Pro Tyr Leu His His Phe Ala Tyr

435 440 445

Asp Pro Gln Tyr Phe Leu Asn Glu Leu Asp Leu Leu Gly Gln Ala Ala

450 455 460

Ala Thr Gln Leu Ala Arg Asn Ile Ser Asn Ser Gly Ala Met Gln Thr

465 470 475 480

Tyr Phe Ala Gly Glu Thr Ile Pro Gly Asp Asn Leu Ala Tyr Asp Ala

485 490 495

Asp Leu Ser Ala Trp Thr Glu Tyr Ile Pro Tyr His Phe Arg Pro Asn

500 505 510

Tyr His Gly Val Gly Thr Cys Ser Met Met Pro Lys Glu Met Gly Gly

515 520 525

Val Val Asp Asn Ala Ala Arg Val Tyr Gly Val Gln Gly Leu Arg Val

530 535 540

Ile Asp Gly Ser Ile Pro Pro Thr Gln Met Ser Ser His Val Met Thr

545 550 555 560

Val Phe Tyr Ala Met Ala Leu Lys Ile Ser Asp Ala Ile Leu Glu Asp

565 570 575

Tyr Ala Ser Met Gln

580

<210> 6

<211> 1746

<212> DNA

<213> 6

<400> 6

ggtattgagg catctttgtt gacagaccct aaggatgttt ctggaagaac cgttgactac 60

attattgctg gtggtggttt gaccggattg accactgccg caagattgac tgaaaatcca 120

aacatctctg ttttggtcat cgagtctggt tcttacgaat ctgacagagg acctattatc 180

gaagacttga acagatacgg tgatattttc ggatcttctg ttgatcatgc ctacgagaca 240

gttgagttgg ctactaacaa tcagactgct ttgattaggt ctggaaatgg tttgggtgga 300

tctactttgg ttaatggagg tacttggact agaccacata aggctcaggt tgattcttgg 360

gaaactgttt ttggtaacga aggttggaac tgggataacg ttgcagctta ctctttgcaa 420

gcagaaagag ctagggctcc aaacgctaag caaattgctg ctggtcatta ctttaacgct 480

tcttgtcacg gtgttaacgg aactgtccac gccggaccta gagacactgg agatgattac 540

tctccaattg tcaaggcatt gatgtctgct gttgaagata gaggagtccc aaccaagaag 600

gatttcggtt gtggtgatcc acatggtgtt tctatgttcc caaatacatt gcacgaagat 660

caagttaggt ctgacgctgc tagagaatgg ttgttgccaa attatcaaag accaaacttg 720

caggtcttga ctggtcagta cgtcggtaag gttttgttgt ctcaaaacgg tactactcca 780

agagctgtcg gtgtcgagtt cggtactcat aagggtaata ctttcaacgt ttacgctaag 840

catgaagttt tgttggctgc tggttctgct gtttctccaa ccatcttgga gtattctgga 900

attggtatga agtctatttt ggaaccattg ggtattgata ctgtcgttga tttgccagtt 960

ggtttgaact tgcaggatca gactacagcc actgtcagat ccagaattac ttctgctggt 1020

gctggtcaag gtcaggctgc atggtttgct acttttaacg aaacttttgg tgattactct 1080

gaaaaggctc atgaattgtt gaacactaag ttggaacaat gggctgaaga agctgttgct 1140

agaggtggtt ttcataatac tactgctttg ttgattcaat acgaaaacta cagagactgg 1200

attgttaacc ataacgttgc ctattctgag ttgtttttgg acaccaaggg tgttgcttct 1260

tttgatgttt gggatttgtt gccatttaca agaggttacg ttcacatttt ggataaagat 1320

ccatacttgc atcactttgc atacgatcca caatactttt tgaacgaatt ggacttgttg 1380

ggtcaagctg ctgctactca attggctaga aacatttcta actctggtgc aatgcaaact 1440

tactttgccg gtgaaactat cccaggagat aacttggctt acgatgctga tttgtctgct 1500

tggactgaat acattccata ccatttcaga ccaaactacc acggtgtcgg tacttgttct 1560

atgatgccaa aggaaatggg aggtgttgtc gataacgctg caagagtcta cggagttcaa 1620

ggtttgagag ttattgatgg ttctattcca ccaactcaaa tgtcttctca tgttatgact 1680

gttttttacg ctatggcttt gaagatttct gatgctatct tggaagatta cgcttctatg 1740

caataa 1746

Claims (6)

1. A glucose oxidase mutant is characterized in that the 65 th amino acid and the 416 th amino acid of the glucose oxidase with the amino acid sequence of SEQ ID NO. 1 are simultaneously substituted; wherein the 65 th amino acid is changed from A to R, and the 416 th amino acid is changed from A to K.

2. The glucose oxidase mutant according to claim 1, further comprising a substitution at amino acid 275; amino acids were changed from H to F.

3. A gene encoding a glucose oxidase mutant according to any of claims 1-2.

4. A recombinant expression vector carrying the gene of claim 3.

5. A host cell carrying the recombinant expression vector of claim 4.

6. Use of the glucose oxidase mutant according to any of claims 1-2 in the field of feed.