CN110846267B - Two high-temperature-resistant engineering bacteria for efficiently degrading nitroalkane compounds - Google Patents

Abstract

The invention discloses a thermophilic denitrified soil bacillus engineering bacterium for efficiently degrading nitroalkanes. The thermophilic denitrification soil bacillus engineering bacteria for efficiently degrading the nitroalkane are obtained by over-expressing key enzyme (NOEs) genes of a nitroalkane degradation way, and the modified engineering bacteria are respectively named as NG-S1 and NG-S2. The nucleotide sequence of the noes gene is shown as SEQ ID NO. 1-2. Compared with wild thermophilic denitrification soil bacillus, the engineering bacteria obtained by the invention have the advantages that the degradation efficiency is obviously improved, and the degradation rates of NG-S1 (under anaerobic condition) and NG-S2 (under aerobic condition) are respectively improved by 2 times and 2.8 times. The invention provides two high-temperature resistant strains for efficiently degrading toxic pollutants in aerobic and anaerobic environments respectively, has important significance and application value for environmental pollution treatment, and provides a new method and example for the modification of biodegradable thermophilic engineering bacteria.

Description

Two high-temperature-resistant engineering bacteria for efficiently degrading nitroalkane compounds

Technical Field

The invention belongs to the field of microbial strain modification, and relates to construction of engineering strains NG-S1 and NG-S2 and application of the engineering strains to degradation of 2-nitropropane, in particular to a thermophilic denitrified soil bacillus engineering strain for efficiently degrading nitroalkanes, a construction method and application thereof.

Background

Nitro compounds are widely used as solvents, fuels and organic synthesis intermediates in the chemical industry, as herbicides, insecticides, fungicides and the like in agriculture, and have important industrial significance. The nitroalkane compounds mainly comprise nitromethane, nitroethane, 1-nitropropane, 2-nitropropane and the like. 2-nitropropane is widely used in chemical intermediates, solvents and components of coatings such as inks, coatings, varnishes and the like. However, some nitroalkanes are considered toxic to humans and carcinogenic to mammals. Nitroalkane-oxidizing enzymes (NOEs) are key enzymes for catalyzing nitroalkane compounds, including Nitroalkoxygenases (NAO) and nitrogen-acid ester monooxygenase (NMO), and can effectively convert nitroalkane compounds into nontoxic or low-toxic substances. The ability of NOEs to break down nitroalkanes determines the prospects of their application in bioremediation. Nitro radical reported so farThe alkane oxidase is mainly derived from mesophilic bacteria, such as Bacillus cereusFusarium oxysporum， Pseudomonas aeruginosaAndStreptomycesansochromogenes. And the NOEs separated from the thermophilic bacteria have the characteristics of high temperature resistance and good stability, so that the thermophilic enzyme has more advantages than the normal temperature enzyme from the perspective of biotechnology, and the NOEs have better applicability than the normal temperature enzyme in application and have huge application value in environmental remediation and industrial application. Therefore, the biochemical characteristics of Nitroalkoxygenases (NOEs) have important application value and fundamental significance.

GeobacillusBelongs to thermophilic bacteria with important biological significance and is a main source of thermophilic enzyme. Due to the diversity of their metabolic functions,Geobacilluscan be used as cell catalyst in the processes of biotransformation, bioremediation and the like. To effectively utilizeGeobacillusAnd, it is necessary to develop a reliable method for genetic engineering thereof. At present, genetic manipulation methods are being explored, and gene expression systems have been studied to some extent.

The invention relates to genetic modification and application of NG80-2, obtains optimal degradation engineering bacteria by over-expressing key enzyme of a nitroalkane degradation path, provides high-efficiency strains which are respectively suitable under aerobic and anaerobic conditions for degradation of toxic pollutants in a high-temperature environment, has important significance and application value for environmental pollution treatment, and provides a new method and example for modification of biodegradable thermophilic engineering bacteria.

Disclosure of Invention

In order to improve the degradation rate of NG80-2 p-nitroalkane, the invention aims to provide a thermophilic denitrified soil bacillus engineering bacterium for efficiently degrading nitroalkane and a construction method and application thereof.

In order to solve the technical problems, the invention provides the following technical scheme:

the engineering bacteria of the thermophilic denitrified soil bacillus for efficiently degrading the nitroalkanes are characterized in that the engineering bacteria of the thermophilic denitrified soil bacillus for efficiently degrading the nitroalkanes are obtained by adopting key enzyme (NOEs) genes of an over-expression nitroalkane degradation way, and the modified engineering bacteria are respectively named as NG-S1 and NG-S2; the nucleotide sequence of the noes gene of the NG-S1 is shown as SEQ ID NO. 1; the nucleotide sequence of the noes gene of the NG-S2 is shown as SEQ ID NO. 2.

The invention further discloses a construction method of the thermophilic denitrified soil bacillus engineering bacteria for efficiently degrading nitroalkanes, which is characterized by comprising the following steps:

step 1, extracting Geobacillus thermodenitrificans (Geobacillus thermodenitrificans) NG80-2 genome DNA, designing upstream and downstream primers GTNG 0930F and GTNG 0930R, GTNG 1755F and GTNG 1755R by taking the DNA as a template for PCR amplification, and obtaining gene fragments (including a promoter fragment) of GTNG0930 and GTNG1755, wherein the nucleotide sequence of the gene is shown as SEQ ID NO. 1;

step 2, extracting a pUCG18 plasmid;

step 3, carrying out enzyme digestion on the gene fragment prepared in the step 1 and the plasmid prepared in the step 2, connecting, and electrically transferring to escherichia coli DH5 alpha competent cells;

step 4, after the competent cells obtained in the step 3 are recovered, coating agar solid culture medium containing kanamycin and 50 mug/mL, and screening positive recombinant bacteria with kanamycin to obtain pUCG18 plasmid with noe gene;

and 5: transferring the correct plasmid into a competent cell of Geobacillus thermodenitrificans NG 80-2;

step 6: and (4) recovering the competent cells obtained in the step (5), coating the competent cells on an agar solid medium containing kanamycin and 12 mu g/ml), and screening positive recombinant bacteria with kanamycin to obtain engineering bacteria NG-S1 and NG-S2 capable of efficiently degrading nitroalkanes.

Wherein in the step 1, the primer sequences of the GTNG 0930F and the GTNG 0930R are as follows:

GTNG 0930F：5'-TGTAAAACGACGGCCAGTGCCAGCTGATGTTGATTAAATCGATCG-3'

GTNG 0930R：5'-AACAGCTATGACCATGATTACGTTAGTTTGCCCAGCGGCACC-3'

the PCR amplification system is (1)Geobacillus thermodenitrificans) NG80-2 genome template 2uL, upstream primer GTNG 0930F 2uL, downstream primer GTNG 0930R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfu DNA Polymerase 1uL, ddH ₂ O37 uL, total volume 50uL;

PCR amplification reaction program comprises pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 1min20s, circulation at 30, final extension at 72 deg.C for 5min, and standing at 4 deg.C;

in the step 1, the primer sequences of GTNG 1755F and GTNG 1755R are as follows:

GTNG 1755F：5'-AACTGCAGAGAGCTGTTTTCCATCTATCGAG-3

GTNG 1755R：5'-GCTCTAGAGATTGATTTAGCGACCCTGTG-3

the PCR amplification system is (1)Geobacillus thermodenitrificans) NG80-2 genome template 2uL, upstream primer GTNG 1755F 2uL, downstream primer GTNG 1755R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfu DNA Polymerase 1uL, ddH ₂ O37 uL, total volume 50uL;

the PCR amplification reaction program comprises pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 1min20s, circulation at 30, final extension at 72 ℃ for 5min, and standing at 4 ℃.

The invention further discloses a construction method of the thermophilic denitrification soil bacillus engineering bacteria for efficiently degrading the nitroalkane and application of the constructed engineering strains NG-S1 (NG 80-2 carries pNOE1.2.1) and NG-S2 (NG 80-2 carries pNOE1.2.2) in preparation of the toxic nitroalkane degradation. The degradation of the toxic nitroalkane refers to that: 2-nitropropane is degraded. The experimental results show that compared with the wild type, the degradation rates of NG-S1 (anaerobic condition) and NG-S2 (aerobic condition) are respectively improved by 2 times and 2.8 times.

The amino acid sequences of the nitroalkane oxidases GTNG-0930 and GTNG-1755 provided by the invention are derived from Geobacillus thermophilus Geobacillus herenodirificans NG80-2.

The invention provides recombinant plasmids pNOE1.2.1 and pNOE1.2.2 capable of expressing nitroalkane oxidases GTNG-0930 and GTNG-1755 (carrying respective promoters), which are used for the genetic modification of Geobacillus.

The nucleotide sequence of SEQ ID NO 1-2 provided by the invention is as follows:

Geobacillus thermodenitrificans NG80-2 SEQ ID NO:1

GCTGATGTTGATTAAATCGATCGCCAAGGCGTTTTCTCCGATGAAGGCGCGAAATTCCGGATCCATACCTGCTCCCTTTTTATGACCGGGAATGTGAAATTGGATTGGATCTTTTTTTACGTGTTCCAACAGCCCGGTAAACAATGGTGTCTCGAGTTGCGACAATGGTTTTTCACACCTCTTTACCTTAAAATAAAACAAGTGCATTATAGCATTTATTTTTTCGTTTGCAAAGAAGAAATGAATGCTATGTGAAAAAGGAAAACAGCGGTGAAAACAAGAAATAAAAGAAGGACAAAACCAAAAGGAGGCATAAGGGGATGGAATGGAAAACGAGAGTGACAGAATTGCTCGGCATTACATACCCGATCATTCAAGGAGGACTTGCCTATTTAGCGTACGCCGATTTAGCCGCTGCTGTCTCGAATGCGGGCGGCCTCGGGCAAATTACAGCGATGTCGCTAGAAAGCCCGGAGCGGTTGCGCGAGGAAATTCGCAAAGTGAAGGAAAAAACCGATCGGCCGTTTGGCGTCAATTTTGCCATCGGTCAGCACGGCCGCGCGTTTTCTCATATGCTTGAAGCCGCGCTTGACGAGGGAGTACCGGTTGTCTCGGTCACCGGCGGCAATCCGGCACCGTTTTTTGAGCAACTGAAGGGAACGGACGTAAAAACATTAGTGCTTGTCGCAGCAGTCCGCCAAGCGGTCAAAGCGGAAGAATTGGGCGCCGATGCGGTAATGGTCGTCGGCCAAGAAGGAGGCGGGCATCTCGGCAAATATGACACCGGCACGTTCGTCCTCATTCCGAAAGTCGTCGAATCGGTATCGATTCCGGTTATCGCCTCTGGCGGTATCGCCGATGGGCGCGGGCTGATGGCGGCGCTGGCTCTTGGGGCAGAAGGCATTGAAATGGGGACGCGGTTTATTGCGACGAAAGAATGTGTCCATGCCCATCCGGTGTATAAAGAAATGATCGTTAACGCCACAGAGCATGACACGGTCGTCATTAAACGGTCGCTTGGGGCGCCGGGGCGGGCGATCGCCAATCAATGGACGGAGAAAATATTGGAAATTGAGCGCCAAGGCGGCACGTACGAAGATTTGAAAGAATATATTAGCGGAGAGGCAAATCGCCGCTTCATTTATGAAGGAAAGGTGGAGGAAGGGTTCGCTTGGGCTGGACAGGCGATCGGGCTCATTCGCGACATTCCGTCCGTTGCTGAGCTGTTTGCCCGCATGATTGGTGAGGCGGAACAAATTCGGTGCCGCTGGGCAAACTAA

Geobacillus thermodenitrificans NG80-2 SEQ ID NO:2

AGAGCTGTTTTCCATCTATCGAGACGTATATCCACACACAAAAGAGATAGCGAAACGGTTAAAAGCGTTTCGGCCGTGACGACAAAACCTCCCCGAATCAATTGATGGTTTGGGGAGGTTTTTGTTTACTCAGGTAATCAGACAGGCTGACCCGCTAGGTTTGTCCAAGGAGAACTTGAAAGGTGAGAGCGAAACATGGACATTCGAAAAGAATTCGAAAATCTTAGATAGATTGATTGGCTAAGAGAAAGGGATTTTCTGCGCCAAGCACGAAAGAGTAAAGGGGAGTTAACTGAGCTAGGGTGGTTACTTATATGAGGGGAGAGATTAGCTATGTTCTCTACGCTTCCCGTCCCCATTATCCAAGCACCGATGGCAGGAGGGGTGTCAACGCCCGAACTGGCAGCGGCGGTGTCAAATGCCGGAGGGCTTGGATTTTTGGCTGGCGGGTACCAGACGGCGGAGATGATGAGAACGGAGATTCACAAGCTGCGAACATTGACGGACCGTCCGTTTGGAGTGAATGTGTTTGTGCCAGGGGAAACAACGGTCGATGAAGAGACGCTTAGTCGTTATCGCGCTGTACTGGCGACTGAGGCGGAACGGCTCGGCGCAACAGTCGGAGAGCCGAAATGGGATGACGATGATTGGGAGGCGAAACTCGATGTGCTCCTTAAAGAGCGGGTACCGGTCGTCAGCTTTACGTTTGGTTGCCCGGAAACAGCGGTGATCACTGCCTTGCAAAAGGCTGGGGCGTTTGTAATCGTGACAGTTACATCGGTGGAGGAAGCCCAAATCGCAGCAGAAGCTGGTGCGAATGCCCTTTGTGTGCAAGGGGCAGAAGCGGGTGGTCATCGTGCGTCGTTTCGCAACGATCCGGAAAAAGATGAAGTATTGACGTTGTTCCCGCTGTTGGCCGATGTACACGCGTCGGTTCGTCTCCCGCTTGTGGCGGCGGGTGGGATCATGGATGGGTACGGTATCGCAGCGGCGCTTCAAGCGGGGGCGAGTGCGGTGCAGCTCGGGACAGCGTTTTTACGCTGTCCTGAGAGCGGGGCGCATCCGCTCCATAAACAGGCGCTTGTGGATCCGCGCTTTACCGAAACAGCGGTAACAAGGGCGTTTACCGGCCGGCCGGCGCGCGGGCTGGCGAACCGGTTTATGGCTGAATATAGCGATCTAGCGCCGGCGGCGTATCCGCAAGTGCACCATATGACAAAGCCGATGCGCGCTGCGGCCGCCAAGGTGGGTGACCGAGAGCGGATGGCGCTTTGGGCTGGAGAAGGGTACCGAATGGCGCGAGAACTTCCCGCGGGGGAACTCGTGCGCGAATTGAAGCGGGAGCTCGAGGAGGCACAGGGTCGCTAAATCAATC

the present invention is described in more detail as follows:

the invention provides a construction method of engineering strains NG-S1 (NG 80-2 carries pNOE1.2.1) and NG-S2 (NG 80-2 carries pNOE1.2.2):

step 1, extracting Geobacillus thermodenitrificansGeobacillus thermodenitrificans) NG80-2 genome DNA, designing upstream and downstream primers GTNG 0930F and GTNG 0930R, GTNG 1755F and GTNG 1755R by taking the DNA as a template to carry out PCR amplification, and obtaining GTNG0930 and GTNG1755 gene fragments (including a promoter fragment), wherein the nucleotide sequences of the genes are shown as SEQ ID NO.1 and SEQ ID NO. 2;

step 2, extracting a pUCG18 plasmid;

step 3, carrying out enzyme digestion on the gene fragment prepared in the step 1 and the plasmid prepared in the step 2, connecting, and electrically transferring to escherichia coli DH5 alpha competent cells;

step 4, after reviving the competent cells obtained in the step 3, coating the competent cells on an agar solid culture medium containing kanamycin (50 mu g/mL), and screening positive recombinant bacteria with kanamycin to obtain a pUCG18 plasmid with a noe gene;

and 5: transferring the correct plasmid into a competent cell of Geobacillus thermodenitrificans NG 80-2;

step 6: and (3) recovering the competent cells obtained in the step (5), coating the competent cells on an agar solid culture medium containing kanamycin (12 mu g/ml), and screening positive recombinant bacteria with kanamycin to prepare the engineering bacteria capable of efficiently degrading nitroalkanes.

Wherein, in the step 1, the primer sequences of the GTNG 0930F and the GTNG 0930R are as follows:

GTNG 0930F：5'-TGTAAAACGACGGCCAGTGCCAGCTGATGTTGATTAAATCGATCG-3'

GTNG 0930R：5'-AACAGCTATGACCATGATTACGTTAGTTTGCCCAGCGGCACC-3'

the PCR amplification system is (1)Geobacillus thermodenitrificans) NG80-2 genome template 2uL, upstream primer GTNG 0930F 2uL, downstream primer GTNG 0930R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfu DNA Polymerase 1uL, ddH ₂ O37 uL, total volume 50uL;

PCR amplification reaction program comprises pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 1min20s, circulation at 30, final extension at 72 deg.C for 5min, and standing at 4 deg.C;

in the step 1, primer sequences of GTNG 1755F and GTNG 1755R are as follows:

GTNG 1755F：5'-AACTGCAGAGAGCTGTTTTCCATCTATCGAG-3

GTNG 1755R：5'-GCTCTAGAGATTGATTTAGCGACCCTGTG-3

the PCR amplification system is (1)Geobacillus thermodenitrificans) NG80-2 genome template 2uL, upstream primer GTNG 1755F 2uL, downstream primer GTNG 1755R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfu DNA Polymerase 1uL, ddH ₂ O37 uL, total volume 50uL;

PCR amplification reaction program comprises pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 1min20s, circulation at 30, final extension at 72 deg.C for 5min, and standing at 4 deg.C;

in steps 3 and 4, the reaction conditions are as follows:

the two PCR products are purified, digested separately with EcoRI, hindIII, xba I and PstI, digested separately with the same restriction endonuclease, and after gel cutting and recovery, ligated with plasmid pUCG18, transformed into competent Escherichia coli DH5 alpha (purchased, stored in laboratory), spread on LB solid medium (Tryptone: 1%; yeast Extr) containing 50. Mu.g/mL Kan (kanamycin)act 0.5%, naCl 1%. ) The above. Culturing at 60 deg.C for 16-18 hr, selecting monoclonal colony, identifying, insertingGTNG-0930The pUCG18 plasmid of the encoded DNA sequence is recombinant plasmid pNOE1.2.1, and the recombinant Escherichia coli DH5 alpha containing the plasmid is DH5 alpha-1. Is inserted withGTNG-1755The pUCG18 plasmid of the coded sequence is a recombinant plasmid pNOE1.2.2, and the recombinant Escherichia coli DH5 alpha containing the plasmid is DH5 alpha-2. The DNA fragment was sequenced by Sanger dideoxy method, and the sequencing result showed that the inserted DNA sequence was correct. The recombinant plasmids pNOE1.2.1 and pNOE1.2.2 were then transformed intoGeobacillus thermodenitrificansNG80-2, and the engineering bacteria are named as NG-S1 and NG-S2 respectively.

Wherein, in the steps 5 and 6,Geobacillus thermodenitrificansthe NG80-2 competence preparation and transformation process is as follows:

1) NG80-2 was inoculated into 20 ml of TGP liquid medium (aseptically handled in a super clean bench) and incubated overnight in a shaker at 60 ℃ and 180 rpm.

2) The overnight cultured broth was inoculated into 50ml of liquid medium (sterile in a clean bench) at a concentration of 1% (v/v) and cultured with shaking at 60 ℃ and 220 rpm on a shaker until the OD600 was about 1.0 to 1.6.

3) The flask containing the bacterial solution was iced for 10 min.

4) The bacterial solution was transferred to a 50ml Beckmam high-speed centrifuge tube in a clean bench, 9000 g,4 ℃ and centrifuged for 20 min.

5) The supernatant was discarded, 25 ml of about 4 ℃ pre-cooled competent cell washing buffer [ 0.5M sorbitol, 0.5M mannitol, 10% glycerol (v/v) ] was added thereto, and the cells were resuspended by shaking, then filled to 50ml with the washing buffer, 9000 g, and centrifuged at 4 ℃ for 20 min. This step was repeated 3 more times, each time adding a volume of 25 ml,10 ml of washing buffer.

6) Discarding the supernatant, adding about 1.5 ml of washing buffer solution to redissolve the bacteria, subpackaging the redissolved bacteria solution into 0.5 ml centrifuge tubes, each tube is 60 μ l, and rapidly storing at-80 ℃ for later use.

7) Sucking about 50 ng of plasmid, adding the plasmid into a centrifuge tube containing competent cells, gently blowing and uniformly mixing by using a pipette gun to avoid generating bubbles, sucking the mixture, transferring the mixture into a2 mm electric revolving cup (precooling at the temperature of minus 20 ℃), wiping the electric revolving cup cleanly by using toilet paper, and placing the electric revolving cup into a BIO-RAD electric converter for 2.5 KV electric shock.

8) 200 mul of mLB culture medium (preheated at 56 ℃) is added into an electric transformation cup and is blown and evenly mixed by a liquid transfer gun, and the mixture is transferred into a sterilized 1.5 ml centrifuge tube and is incubated at 56 ℃ and 200 rpm for 2 to 4 hours for recovery.

9) 500 μ l of the recovered bacterial liquid was pipetted and spread on mLB solid culture plates containing the kanamycin antibiotics at the corresponding concentration, and the plates were cultured in an incubator for 24 hours while being inverted.

10 Etc., selecting the single clone for corresponding identification.

Further, the engineered bacterium prepared in step 6 is inoculated to a thermophilic minimal medium to degrade the substrate 2-nitropropane (fig. 1).

The LB culture medium consists of the following components: 10 g peptone, 5 g yeast extract and 10 g sodium chloride, to a volume of 1L ddH ₂ O。

The TGP medium consists of the following components: 17 g peptone, 3 g Soy peptone, 2.5 g K ₂ HPO ₄ And 5 g of sodium chloride to a constant volume of 1L ddH ₂ O。

The thermophilic minimal medium consists of the following components: 8.37 g morpholinopropane sulfonate, 0.23 g KH ₂ PO ₄ , 0.51 g NH ₄ Cl, 5 g NaCl, 1.47 g Na ₂ SO ₄ , 0.08 g NaHCO ₃ , 0.25 g KCl, 1.87 g MgCl ₂ ·6H ₂ O, 0.41 g CaCl ₂ ·2H ₂ O, 1 g NaNO ₃ And 0.5 g yeast extract to a volume of 1L ddH ₂ O（PH6.94）。

Furthermore, the invention also provides engineering strains NG-S1 (NG 80-2 carries pNOE1.2.1) and NG-S2 (NG 80-2 carries pNOE1.2.2) under aerobic and anaerobic conditionsGTNG 0930AndGTNG 1755at the transcriptional level (FIG. 2 a).

Further, the present invention also provides crude cell extracts of engineered strains NG-S1 (NG 80-2 carries pNOE1.2.1) and NG-S2 (NG 80-2 carries pNOE1.2.2) to analyze the degradation of 2-nitropropane by GTNG0930 and GTNG1755 under aerobic and anaerobic conditions in two cases, no FMN and FMN (FIGS. 2b and c).

Further, NOEs were dependent on the coenzyme FMN to function, and the enzymatic activity response was substantially identical to that of the degradation of its species, but the difference in transcription level was significantly higher than these two levels, so it was speculated that although NOEs were expressed in large amounts, it was possible that insufficient amounts of coenzymes limited the enzymatic function, and therefore, in the analysis of 2-nitropropane degradation under aerobic and anaerobic conditions using crude cell extracts, GTNG0930 and GTNG1755 were supplemented with FMN (fig. 3), and in addition, in minimal medium, riboflavin (which is a precursor for FMN synthesis) was supplemented to enhance the degradation of 2-nitropropane by NG-S1 and NG-S2 under aerobic and anaerobic conditions (fig. 2d and e).

Compared with the prior art, the thermophilic denitrification soil bacillus engineering bacteria for efficiently degrading nitroalkanes and the construction method thereof disclosed by the invention have the following beneficial effects:

(1) The invention discloses a thermophilic bacteria engineering platform for degrading toxic compounds containing nitrogen for the first time, successfully obtains engineering strains NG-S1 and NG-S2 by over-expressing key enzymes in a nitroalkane degradation way, and obviously improves the degradation of the nitroalkane by thalli compared with wild strains.

(2) The degradation rate of the engineered strain was further increased by optimizing the nutrient conditions (fig. 3a and b).

(3) The engineering strains NG-S1 and NG-S2 provided by the invention provide a brand-new thought and method for realizing the degradation of nitroalkane, and the method has the advantages of strong feasibility, good adaptability and important application value and prospect.

Drawings

FIG. 1 shows the degradation of 2-nitropropane by engineering bacteria NG-S1 and NG-S2 under aerobic and anaerobic conditions, respectively;

FIG. 2, engineering bacteria NG-S1 and NG-S2 degrade 2-nitropropane for 3 days, and then collect thalli;

(a) RT-PCR analysis is carried out on the transcription levels of genes GTNG0930 and GTNG1755 in engineering bacteria NG-S1 and NG-S2 under aerobic and anaerobic conditions;

(b) Analyzing the amount of degradation products of 2-nitropropane under aerobic and anaerobic conditions using a cell extract;

(c) Analysis of 2-nitropropane using cell extracts the amount of degradation products was analyzed by addition of FMN under aerobic and anaerobic conditions; (d) Analyzing the degradation rate of the engineering bacteria NG-S1 and NG-S2 to the 2-nitropropane under the aerobic and anaerobic conditions;

(e) Analyzing the degradation rate of the engineering bacteria NG-S1 and NG-S2 to the 2-nitropropane under aerobic and anaerobic conditions (adding riboflavin in a basic culture medium);

FIG. 3 is a graph showing the analysis of the degradation rate of 2-nitropropane by engineering bacteria NG-S1 and NG-S2 under different influence factors;

(a) The effect of yeast extract (under aerobic and anaerobic conditions);

(b) The effect of riboflavin (under aerobic and anaerobic conditions).

Detailed Description

The invention is further described in detail by the following embodiments and the accompanying drawings. The following embodiments are merely illustrative and not restrictive of the invention.

The sources of the strains and raw materials used by the invention are as follows:

NG80-2 is isolated from 69-8 blocks of oil well formation water Geobacillus thermodenitrificans NG80-2 (of Tianjin Dagang oil field officials, china)Geobacillus thermodenitrificansThe strain is preserved in the China general microbiological culture Collection center with the preservation number of CGMCC No. 1228); e.coli DH 5. Alpha. Was purchased and stored in the laboratory; it is specifically noted that the reagents used in the examples are commercially available.

Example 1

Clones (including promoter parts) of the genes encoding the complete sequences of the nitroalkane oxidases GTNG-0930 and GTNG-1755 were constructed.

1. Extraction of total DNA of Geobacillus thermodenitrificans NG80-2

In this embodiment, separation from deep reservoirs is usedGeobacillus thermodenitrificansNG80-2, which is cultured overnightCentrifuging to collect thallus, suspending thallus in 250 μ L50mM Tris buffer solution (pH 8.0), adding 10 μ L0.4M EDTA (pH 8.0), mixing, keeping the temperature at 37 deg.C for 20min, adding 30 μ L20mg/L lysozyme, mixing, keeping the temperature at 37 deg.C for 20min, adding 5 μ L20mg/L proteinase K, mixing, adding 20 μ L10% SDS, keeping the temperature at 50 deg.C until the solution is clarified, extracting with isovolumic phenol chloroform isoamyl alcohol twice, extracting with chloroform isoamyl alcohol once, precooling the supernatant, adding 2.5 times volume of absolute ethyl alcohol, recovering DNA, washing with 70% ethyl alcohol, dissolving the precipitate in 100 μ LTE buffer solution (pH 8.0, 10mmTris,1 mMEDTA), adding 10mg/L RN2μ L, keeping the temperature at 65 deg.C for 30min, respectively dissolving phenol chloroform isoamyl alcohol, chloroform, extracting with 1 μ L isoamyl alcohol once, adding 2.5 times volume of supernatant, precipitating with 70% water, recovering DNA, vacuum drying, and recovering ethanol, drying ₂ And (4) O buffer solution. The DNA solution was measured by uv spectrophotometer to be a260/a280=1.95, and a260=0.76.

2. Cloning and screening of nitroalkane oxidase genes

Amplifying the complete sequence gene of GTNG-0930 of NG80-2, taking 2 μ L of the total DNA solution as a template, taking the following oligonucleotide sequences as primers, and carrying out 30-cycle PCR according to the PCR cycle parameters set as follows;

GTNG 0930F：5'-TGTAAAACGACGGCCAGTGCCAGCTGATGTTGATTAAATCGATCG-3'

GTNG 0930R：5'-AACAGCTATGACCATGATTACGTTAGTTTGCCCAGCGGCACC-3'

the PCR amplification system is (1)Geobacillus thermodenitrificans) NG80-2 genome template 2uL, upstream primer GTNG 0930F 2uL, downstream primer GTNG 0930R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfu DNA Polymerase 1uL, ddH ₂ O37 uL, total volume 50uL;

PCR amplification reaction program comprises pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 1min20s, circulation at 30, final extension at 72 deg.C for 5min, and standing at 4 deg.C;

GTNG 1755F：5'-AACTGCAGAGAGCTGTTTTCCATCTATCGAG-3

GTNG 1755R：5'-GCTCTAGAGATTGATTTAGCGACCCTGTG-3

the PCR amplification system is (1)Geobacillus thermodenitrificans) NG80-2 genome template 2uL, upstream primer GTNG 1755F 2uL, downstream primer GTNG 1755R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfu DNA Polymerase 1uL, ddH ₂ O37 uL, total volume 50uL;

PCR amplification reaction program comprises pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 1min20s, circulation at 30, final extension at 72 deg.C for 5min, and standing at 4 deg.C;

after the two groups of PCR products are purified, ecoRI, hindIII, xba I and PstI are respectively used for double enzyme digestion, the products are respectively connected with plasmid pUCG18 after being subjected to enzymolysis and gel cutting recovery by the same restriction enzyme, after the products are electrically transferred to competent Escherichia coli DH5 alpha (purchased and stored in a laboratory), the competent Escherichia coli DH5 alpha is smeared on LB solid culture medium (Tryptone: 1%; yeast Extract: 0.5%; naCl: 1%; containing 50 mu g/mL Kan (kanamycin). Culturing at 60 deg.C for 16-18 hr, selecting monoclonal colony, identifying, insertingGTNG-0930The pUCG18 plasmid of the encoded DNA sequence is recombinant plasmid pNOE1.2.1, and the recombinant Escherichia coli DH5 alpha containing the plasmid is DH5 alpha-1. Is inserted withGTNG-1755The pUCG18 plasmid of the coded sequence is a recombinant plasmid pNOE1.2.2, and the recombinant Escherichia coli DH5 alpha containing the plasmid is DH5 alpha-2. The DNA fragment was sequenced by Sanger dideoxy method, and the sequencing result showed that the inserted DNA sequence was correct.

Example 2

Geobacillus thermodenitrificansNG80-2 competence preparation and transformation processes are as follows:

1) NG80-2 was inoculated into 20 ml of TGP liquid medium and cultured overnight at 60 ℃ in a shaker at 180 rpm.

2) The overnight cultured bacterial liquid was inoculated into 50ml LTGP liquid medium at a ratio of 1% (v/v), and cultured at 60 ℃ and 180 rpm with shaking on a shaker until the OD600 was about 1.0 to 1.6.

3) The bacterial solution was ice-cooled for 10 min.

4) The bacterial solution was transferred to a 50ml Beckmam high-speed centrifuge tube in a clean bench, 9000 g,4 ℃ and centrifuged for 20 min.

5) The supernatant was discarded, 25 ml of about 4 ℃ pre-cooled competent cell washing buffer [ 0.5M sorbitol, 0.5M mannitol, 10% glycerol (v/v) ] was added thereto, and the cells were resuspended by shaking, then filled to 50ml with the washing buffer, 9000 g, and centrifuged at 4 ℃ for 20 min. This step was repeated 3 more times, each time adding a volume of 25 ml,10 ml of washing buffer.

6) Discarding the supernatant, adding about 1.5 ml of washing buffer to redissolve the bacteria, and subpackaging the redissolved bacteria liquid into 0.5 ml centrifuge tubes, 60 μ l each tube, and rapidly storing at-80 ℃ for later use.

7) Sucking about 50 ng of plasmid, adding into a centrifuge tube containing competent cells, gently blowing and uniformly mixing by using a pipette gun to avoid generating bubbles, sucking the mixture, transferring into a2 mm electric rotating cup (precooling at the temperature of minus 20 ℃), wiping the electric rotating cup clean, putting into a BIO-RAD electric rotating instrument, and electrically shocking at the voltage of 2.5 KV.

8) The cells were immediately transferred to 1 ml of preheated (60 ℃) TGP into a 50ml centrifuge tube and thawed in a shaker at 60 ℃ and 180 rpm for 2 h.

9) 500 μ l of the recovered bacterial liquid was pipetted and spread on mLB solid culture plates containing the kanamycin antibiotics at the corresponding concentration, and the plates were cultured in an incubator for 24 hours while being inverted.

10 ) growing a single clone, and picking the single clone for corresponding identification.

The identification result is correct.

Example 3

Degradation experiment of 2-nitropropane

The engineering bacteria (NG-S1, NG-S2) and NG80-2 are respectively inoculated into an LB culture medium containing kanamycin antibiotic and an LB culture medium not containing kanamycin antibiotic, and cultured for 12 hours at the temperature of 60 ℃. Cells were harvested by centrifugation, washed twice with thermophilic minimal medium, and the cell pellet resuspended. Under aerobic conditions, 25 ml of minimal medium containing the appropriate antibiotic was added to a 100 ml headspace vial to a final concentration of 1.08 mmol of 2-nitropropane. The anaerobic conditions were as follows: the minimal medium was boiled for 30 minutes to eliminate most of the dissolved oxygen and placed in an anaerobic incubator to remove oxygen. L-cysteine and resazurin were added to the medium as an oxygen reducing agent and an indicator, respectively, at final concentrations of 0.1% and 0.01 g/L, respectively, until the oxygen indicator in the medium became colorless. The recombinant strain and NG80-2 are respectively inoculated into a thermophilic minimal medium, the initial OD600 is 0.068, samples are taken at different time points, the residual amount of the 2-nitropropane is detected by using high performance liquid chromatography and is shown in figure 1, and as can be seen from the figure, on day 21, the highest degradation efficiency of NG-S1 under anaerobic condition is 93.5%, and the highest degradation efficiency of NG-S2 under aerobic condition is 96.6%.

Engineering strains NG-S1 (NG 80-2 carries pNOE1.2.1) and NG-S2 (NG 80-2 carries pNOE1.2.2) under aerobic and anaerobic conditionsGTNG 0930AndGTNG 1755at the transcriptional level (FIG. 2 a), where 690 and 740 times up-regulated under anaerobic and aerobic conditions, respectively, compared to the wild type.

Crude cell extracts of engineering strains NG-S1 (NG 80-2 carries pNOE1.2.1) and NG-S2 (NG 80-2 carries pNOE1.2.2) were used to analyze the degradation of 2-nitropropane by GTNG0930 and GTNG1755 under aerobic and anaerobic conditions in two cases, no FMN and FMN (FIGS. 2b and c), and the results showed that the crude cell extracts increased the 2-NP conversion efficiency by 2-3 times after FMN was added.

Riboflavin, which is a precursor for FMN synthesis, was supplemented in minimal medium to enhance the degradation of 2-nitropropane by NG-S1 and NG-S2 under both aerobic and anaerobic conditions (fig. 2d and e), with the most obvious enhancement of the degradation rate of NG-S2 by a factor of 1.8 under aerobic conditions.

The nutrient conditions were optimized and the degradation rate of the engineered strain was further increased (fig. 3a and b).

The engineering bacteria obtained by the invention have obviously improved degradation efficiency, and compared with the engineering bacteria without modified Geobacillus thermodenitrificans, the degradation rates of NG-S1 (under anaerobic condition) and NG-S2 (under aerobic condition) are respectively improved by 2 times and 2.8 times.

SEQUENCE LISTING

<110> university of southern kayak

<120> two high-temperature-resistant engineering bacteria for efficiently degrading nitroalkane compounds

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 1280

<212> DNA

<213> Artificial sequence

<400> 1

gctgatgttg attaaatcga tcgccaaggc gttttctccg atgaaggcgc gaaattccgg 60

atccatacct gctccctttt tatgaccggg aatgtgaaat tggattggat ctttttttac 120

gtgttccaac agcccggtaa acaatggtgt ctcgagttgc gacaatggtt tttcacacct 180

ctttacctta aaataaaaca agtgcattat agcatttatt ttttcgtttg caaagaagaa 240

atgaatgcta tgtgaaaaag gaaaacagcg gtgaaaacaa gaaataaaag aaggacaaaa 300

ccaaaaggag gcataagggg atggaatgga aaacgagagt gacagaattg ctcggcatta 360

catacccgat cattcaagga ggacttgcct atttagcgta cgccgattta gccgctgctg 420

tctcgaatgc gggcggcctc gggcaaatta cagcgatgtc gctagaaagc ccggagcggt 480

tgcgcgagga aattcgcaaa gtgaaggaaa aaaccgatcg gccgtttggc gtcaattttg 540

ccatcggtca gcacggccgc gcgttttctc atatgcttga agccgcgctt gacgagggag 600

taccggttgt ctcggtcacc ggcggcaatc cggcaccgtt ttttgagcaa ctgaagggaa 660

cggacgtaaa aacattagtg cttgtcgcag cagtccgcca agcggtcaaa gcggaagaat 720

tgggcgccga tgcggtaatg gtcgtcggcc aagaaggagg cgggcatctc ggcaaatatg 780

acaccggcac gttcgtcctc attccgaaag tcgtcgaatc ggtatcgatt ccggttatcg 840

cctctggcgg tatcgccgat gggcgcgggc tgatggcggc gctggctctt ggggcagaag 900

gcattgaaat ggggacgcgg tttattgcga cgaaagaatg tgtccatgcc catccggtgt 960

ataaagaaat gatcgttaac gccacagagc atgacacggt cgtcattaaa cggtcgcttg 1020

gggcgccggg gcgggcgatc gccaatcaat ggacggagaa aatattggaa attgagcgcc 1080

aaggcggcac gtacgaagat ttgaaagaat atattagcgg agaggcaaat cgccgcttca 1140

tttatgaagg aaaggtggag gaagggttcg cttgggctgg acaggcgatc gggctcattc 1200

gcgacattcc gtccgttgct gagctgtttg cccgcatgat tggtgaggcg gaacaaattc 1260

ggtgccgctg ggcaaactaa 1280

<210> 2

<211> 1375

<212> DNA

<213> Artificial sequence

<400> 2

agagctgttt tccatctatc gagacgtata tccacacaca aaagagatag cgaaacggtt 60

aaaagcgttt cggccgtgac gacaaaacct ccccgaatca attgatggtt tggggaggtt 120

tttgtttact caggtaatca gacaggctga cccgctaggt ttgtccaagg agaacttgaa 180

aggtgagagc gaaacatgga cattcgaaaa gaattcgaaa atcttagata gattgattgg 240

ctaagagaaa gggattttct gcgccaagca cgaaagagta aaggggagtt aactgagcta 300

gggtggttac ttatatgagg ggagagatta gctatgttct ctacgcttcc cgtccccatt 360

atccaagcac cgatggcagg aggggtgtca acgcccgaac tggcagcggc ggtgtcaaat 420

gccggagggc ttggattttt ggctggcggg taccagacgg cggagatgat gagaacggag 480

attcacaagc tgcgaacatt gacggaccgt ccgtttggag tgaatgtgtt tgtgccaggg 540

gaaacaacgg tcgatgaaga gacgcttagt cgttatcgcg ctgtactggc gactgaggcg 600

gaacggctcg gcgcaacagt cggagagccg aaatgggatg acgatgattg ggaggcgaaa 660

ctcgatgtgc tccttaaaga gcgggtaccg gtcgtcagct ttacgtttgg ttgcccggaa 720

acagcggtga tcactgcctt gcaaaaggct ggggcgtttg taatcgtgac agttacatcg 780

gtggaggaag cccaaatcgc agcagaagct ggtgcgaatg ccctttgtgt gcaaggggca 840

gaagcgggtg gtcatcgtgc gtcgtttcgc aacgatccgg aaaaagatga agtattgacg 900

ttgttcccgc tgttggccga tgtacacgcg tcggttcgtc tcccgcttgt ggcggcgggt 960

gggatcatgg atgggtacgg tatcgcagcg gcgcttcaag cgggggcgag tgcggtgcag 1020

ctcgggacag cgtttttacg ctgtcctgag agcggggcgc atccgctcca taaacaggcg 1080

cttgtggatc cgcgctttac cgaaacagcg gtaacaaggg cgtttaccgg ccggccggcg 1140

cgcgggctgg cgaaccggtt tatggctgaa tatagcgatc tagcgccggc ggcgtatccg 1200

caagtgcacc atatgacaaa gccgatgcgc gctgcggccg ccaaggtggg tgaccgagag 1260

cggatggcgc tttgggctgg agaagggtac cgaatggcgc gagaacttcc cgcgggggaa 1320

ctcgtgcgcg aattgaagcg ggagctcgag gaggcacagg gtcgctaaat caatc 1375

Claims (3)

1. The engineering bacteria of the Geobacillus thermodenitrificans for efficiently degrading the nitroalkanes are obtained by overexpressing key enzyme (NOEs) genes of a nitroalkane degradation path, and the transformed engineering bacteria are respectively named as NG-S1 and NG-S2; of said NG-S1noesThe gene nucleotide sequence is shown as SEQ ID NO. 1; of said NG-S2noesThe gene nucleotide sequence is shown in SEQ ID NO. 2.

2. The method for constructing the engineering bacteria of Geobacillus thermodenitrificans for efficiently degrading nitroalkanes according to claim 1, which comprises the following steps:

step 1, extracting Geobacillus thermodenitrificans (II)Geobacillus thermodenitrificans) NG80-2 genome DNA, designing upstream and downstream primers GTNG 0930F and GTNG 0930R, GTNG 1755F and GTNG 1755R by taking the DNA as a template for PCR amplification to obtain GTNG0930 and GTNG1755 gene fragments comprising promoter fragments, wherein the gene nucleotide sequences are shown as SEQ ID NO.1 and SEQ ID NO.2；

Step 2, extracting a pUCG18 plasmid;

step 3, carrying out enzyme digestion on the gene fragment prepared in the step 1 and the plasmid prepared in the step 2, connecting, and electrically transferring to escherichia coli DH5 alpha competent cells;

step 4, after reviving the competent cells obtained in the step 3, coating the competent cells on a kanamycin agar solid culture medium containing 50 micrograms/mL, and screening positive recombinant bacteria with kanamycin resistance to obtain a pUCG18 plasmid with a noe gene;

and 5: transferring the pUCG18 plasmid having the noe gene obtained in step 4 into a Geobacillus thermodenitrificans NG80-2 competent cell;

step 6: recovering the competent cells obtained in the step 5, coating the recovered competent cells on a kanamycin agar solid culture medium containing 12 mug/mL, and screening positive recombinant bacteria with kanamycin resistance to obtain engineering bacteria NG-S1 and NG-S2 capable of efficiently degrading nitroalkanes;

in the step 1, primer sequences of GTNG 0930F and GTNG 0930R are as follows:

GTNG 0930F：5'-TGTAAAACGACGGCCAGTGCCAGCTGATGTTGATTAAATCGATCG-3'

GTNG 0930R：5'-AACAGCTATGACCATGATTACGTTAGTTTGCCCAGCGGCACC-3'

the PCR amplification system comprises NG80-2 genome template 2uL, upstream primer GTNG 0930F 2uL, downstream primer GTNG 0930R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfu DNA Polymerase 1uL, ddH, and dNTP Mix 1uL, and the like ₂ O37 uL, total volume 50uL;

PCR amplification reaction program comprises pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 1min20s, circulation at 30, final extension at 72 deg.C for 5min, and standing at 4 deg.C;

in the step 1, primer sequences of GTNG 1755F and GTNG 1755R are as follows:

GTNG 1755F：5'-AACTGCAGAGAGCTGTTTTCCATCTATCGAG-3

GTNG 1755R：5'-GCTCTAGAGATTGATTTAGCGACCCTGTG-3

the PCR amplification system comprises NG80-2 genome template 2uL, upstream primer GTNG 1755F 2uL, downstream primer GTNG 1755R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfu DNA Polymerase 1uL, ddH ₂ O37 uL, total volume 50uL;

the PCR amplification reaction program comprises pre-denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 1min20s,30 cycles, final extension at 72 ℃ for 5min, and standing at 4 ℃.

3. The application of the engineering strains NG-S1 and NG-S2 constructed by the construction method of the thermophilic denitrified agrobacterium engineering bacteria for efficiently degrading nitroalkanes in the aspect of preparing the toxic nitroalkane degradation according to claim 2; wherein said degradation for the toxicant nitroalkane means: 2-nitropropane is degraded.

Images