CN110846267A - Two high-temperature-resistant engineering bacteria for efficiently degrading nitroalkane compounds - Google Patents

Abstract

The invention discloses a thermophilic denitrified soil bacillus engineering bacterium for efficiently degrading nitroalkanes. The engineering bacteria of the Geobacillus thermodenitrificans for efficiently degrading the nitroalkanes are obtained by over-expressing key enzyme (NOEs) genes of a nitroalkane degradation approach, and the modified engineering bacteria are named as NG-S1 and NG-S2 respectively. The nucleotide sequence of the noes gene is shown as SEQ ID NO. 1-2. Compared with wild thermophilic denitrified soil bacillus, the engineering bacteria obtained by the invention have obviously improved degradation efficiency, and the degradation rates of NG-S1 (anaerobic condition) and NG-S2 (aerobic condition) are respectively improved by 2 times and 2.8 times. The invention provides two high-temperature resistant strains for efficiently degrading toxic pollutants in aerobic and anaerobic environments respectively, has important significance and application value for environmental pollution treatment, and provides a new method and example for the modification of biodegradable thermophilic engineering bacteria.

Description

Two high-temperature-resistant engineering bacteria for efficiently degrading nitroalkane compounds

Technical Field

The invention belongs to the field of microbial strain modification, and relates to construction of engineering strains NG-S1 and NG-S2 and application thereof in 2-nitropropane degradation, in particular to a thermophilic denitrification agrobacterium tumefaciens engineering strain for efficiently degrading nitroalkanes, a construction method and application thereof.

Background

Nitro compounds are widely used as solvents, fuels and organic synthesis intermediates in the chemical industry, as herbicides, insecticides, fungicides and the like in agriculture, and have important industrial significance. The nitroalkane compounds mainly comprise nitromethane, nitroethane, 1-nitropropane, 2-nitropropane and the like. 2-nitropropane is widely used in chemical intermediates, solvents and components of coatings such as inks, coatings, varnishes and the like. However, some nitroalkanes are considered toxic to humans and carcinogenic to mammals. Nitroalkane-oxidizing enzymes (NOEs) are key enzymes for catalyzing nitroalkane compounds, including Nitroalkoxygenases (NAO) and nitrogen-acid ester monooxygenase (NMO), and can effectively convert nitroalkane compounds into nontoxic or low-toxic substances. The ability of NOEs to break down nitroalkanes determines the prospects of their application in bioremediation. The nitroalkane oxidases reported at present are mostly derived from mesophilic bacteria, such asFusarium oxysporum， Pseudomonas aeruginosaAndStreptomycesansochromogenes. And the NOEs separated from the thermophilic bacteria have the characteristics of high temperature resistance and good stability, so that the thermophilic enzyme has more advantages than the normal temperature enzyme from the perspective of biotechnology, and the NOEs have better applicability than the normal temperature enzyme in application and have huge application value in environmental remediation and industrial application. Therefore, the biochemical characteristics of Nitroalkoxygenases (NOEs) have important application value and fundamental significance.

GeobacillusBelongs to thermophilic bacteria with important biological significance and is a main source of thermophilic enzyme. Due to the diversity of their metabolic functions,Geobacilluscan be used as cell catalyst in the processes of biotransformation, bioremediation and the like. To effectively utilizeGeobacillusAnd, it is necessary to develop a reliable method for genetic engineering thereof. At present, genetic manipulation methods are being explored, and gene expression systems have been studied to some extent.

The invention relates to genetic modification and application of NG80-2, which obtains optimal degradation engineering bacteria by over-expressing key enzyme of nitroalkane degradation path, provides high-efficiency strains suitable for aerobic and anaerobic conditions for degradation of toxic pollutants in high-temperature environment, has important significance and application value for environmental pollution treatment, and provides a new method and example for modification of biodegradable thermophilic engineering bacteria.

Disclosure of Invention

In order to improve the degradation rate of NG80-2 p-nitroalkane, the invention aims to provide a thermophilic denitrified soil bacillus engineering bacterium for efficiently degrading nitroalkane and a construction method and application thereof

In order to solve the technical problems, the invention provides the following technical scheme:

the engineering bacteria of the Geobacillus thermodenitrificans for efficiently degrading the nitroalkanes are characterized in that the engineering bacteria of the Geobacillus thermodenitrificans for efficiently degrading the nitroalkanols are obtained by overexpressing key enzyme (NOEs) genes of a nitroalkane degradation approach, and the transformed engineering bacteria are respectively named as NG-S1 and NG-S2; the nucleotide sequence of the noes gene of the NG-S1 is shown as SEQ ID NO. 1; the nucleotide sequence of the noes gene of the NG-S2 is shown as SEQ ID NO. 2.

The invention further discloses a construction method of the thermophilic denitrified soil bacillus engineering bacteria for efficiently degrading nitroalkanes, which is characterized by comprising the following steps:

step 1, extracting Geobacillus thermodenitrificans NG80-2 genome DNA, designing upstream and downstream primers GTNG 0930F and GTNG 0930R, GTNG 1755F and GTNG1755R by taking the DNA as a template to carry out PCR amplification, and obtaining gene fragments (including promoter fragments) of GTNG0930 and GTNG1755, wherein the gene nucleotide sequence of the gene fragments is shown as SEQ ID NO. 1;

step 2, extracting a pUCG18 plasmid;

step 3, carrying out enzyme digestion on the gene fragment prepared in the step 1 and the plasmid prepared in the step 2, connecting, and electrically transferring to escherichia coli DH5 α competent cells;

step 4, after the competent cells obtained in the step 3 are recovered, coating agar solid culture medium containing kanamycin and 50 mug/mL, and screening positive recombinant bacteria with kanamycin to obtain pUCG18 plasmid with noe gene;

and 5: transferring the correct plasmid into a competent cell of Geobacillus thermodenitrificans NG 80-2;

step 6: and (3) recovering the competent cells obtained in the step (5), coating the recovered competent cells on an agar solid culture medium containing kanamycin and 12 mu g/ml), and screening positive recombinant bacteria with kanamycin to prepare engineering bacteria NG-S1 and NG-S2 capable of efficiently degrading nitroalkanes.

Wherein in the step 1, the primer sequences of the GTNG 0930F and the GTNG 0930R are as follows:

GTNG 0930F：5'-TGTAAAACGACGGCCAGTGCCAGCTGATGTTGATTAAATCGATCG-3'

GTNG 0930R：5'-AACAGCTATGACCATGATTACGTTAGTTTGCCCAGCGGCACC-3'

the PCR amplification system is (1)Geobacillus thermodenitrificans) NG80-2 genome template 2uL, upstream primer GTNG 0930F 2uL, downstream primer GTNG 0930R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfuDNA Polymerase 1uL, ddH₂O37 uL, total volume 50uL;

the PCR amplification reaction program comprises pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 1min for 20s,30 cycles, final extension at 72 deg.C for 5min, and standing at 4 deg.C;

in the step 1, the primer sequences of GTNG 1755F and GTNG1755R are as follows:

GTNG 1755F：5'-AACTGCAGAGAGCTGTTTTCCATCTATCGAG-3

GTNG 1755R：5'-GCTCTAGAGATTGATTTAGCGACCCTGTG-3

the PCR amplification system is (1)Geobacillus thermodenitrificans) NG80-2 genome template 2uL, upstream primer GTNG 1755F 2uL, downstream primer GTNG1755R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfuDNA Polymerase 1uL, ddH₂O37 uL, total volume 50uL;

the PCR amplification reaction program comprises pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 1min for 20s,30 cycles, final extension at 72 deg.C for 5min, and standing at 4 deg.C.

The invention further discloses a construction method of the thermophilic denitrified agrobacterium engineering bacteria for efficiently degrading nitroalkane and application of the constructed engineering strains NG-S1(NG80-2 carries pNOE1.2.1) and NG-S2 (NG80-2 carries pNOE1.2.2) in preparation of toxic nitroalkane degradation. The degradation of the toxic nitroalkane refers to that: 2-nitropropane is degraded. The experimental results show that compared with the wild type, the degradation rates of NG-S1 (anaerobic condition) and NG-S2 (aerobic condition) are respectively improved by 2 times and 2.8 times.

The amino acid sequences of the nitroalkane oxidases GTNG-0930 and GTNG-1755 provided by the invention are derived from Geobacillus thermomodistrificans NG80-2

The invention provides recombinant plasmids pNOE1.2.1 and pNOE1.2.2 capable of expressing nitroalkane oxidases GTNG-0930 and GTNG-1755 (carrying respective promoters), which are used for the genetic modification of Geobacillus.

The nucleotide sequence of SEQ ID NO 1-2 provided by the invention is as follows:

Geobacillus thermodenitrificansNG80-2 SEQ ID NO:1

GCTGATGTTGATTAAATCGATCGCCAAGGCGTTTTCTCCGATGAAGGCGCGAAATTCCGGATCCATACCTGCTCCCTTTTTATGACCGGGAATGTGAAATTGGATTGGATCTTTTTTTACGTGTTCCAACAGCCCGGTAAACAATGGTGTCTCGAGTTGCGACAATGGTTTTTCACACCTCTTTACCTTAAAATAAAACAAGTGCATTATAGCATTTATTTTTTCGTTTGCAAAGAAGAAATGAATGCTATGTGAAAAAGGAAAACAGCGGTGAAAACAAGAAATAAAAGAAGGACAAAACCAAAAGGAGGCATAAGGGGATGGAATGGAAAACGAGAGTGACAGAATTGCTCGGCATTACATACCCGATCATTCAAGGAGGACTTGCCTATTTAGCGTACGCCGATTTAGCCGCTGCTGTCTCGAATGCGGGCGGCCTCGGGCAAATTACAGCGATGTCGCTAGAAAGCCCGGAGCGGTTGCGCGAGGAAATTCGCAAAGTGAAGGAAAAAACCGATCGGCCGTTTGGCGTCAATTTTGCCATCGGTCAGCACGGCCGCGCGTTTTCTCATATGCTTGAAGCCGCGCTTGACGAGGGAGTACCGGTTGTCTCGGTCACCGGCGGCAATCCGGCACCGTTTTTTGAGCAACTGAAGGGAACGGACGTAAAAACATTAGTGCTTGTCGCAGCAGTCCGCCAAGCGGTCAAAGCGGAAGAATTGGGCGCCGATGCGGTAATGGTCGTCGGCCAAGAAGGAGGCGGGCATCTCGGCAAATATGACACCGGCACGTTCGTCCTCATTCCGAAAGTCGTCGAATCGGTATCGATTCCGGTTATCGCCTCTGGCGGTATCGCCGATGGGCGCGGGCTGATGGCGGCGCTGGCTCTTGGGGCAGAAGGCATTGAAATGGGGACGCGGTTTATTGCGACGAAAGAATGTGTCCATGCCCATCCGGTGTATAAAGAAATGATCGTTAACGCCACAGAGCATGACACGGTCGTCATTAAACGGTCGCTTGGGGCGCCGGGGCGGGCGATCGCCAATCAATGGACGGAGAAAATATTGGAAATTGAGCGCCAAGGCGGCACGTACGAAGATTTGAAAGAATATATTAGCGGAGAGGCAAATCGCCGCTTCATTTATGAAGGAAAGGTGGAGGAAGGGTTCGCTTGGGCTGGACAGGCGATCGGGCTCATTCGCGACATTCCGTCCGTTGCTGAGCTGTTTGCCCGCATGATTGGTGAGGCGGAACAAATTCGGTGCCGCTGGGCAAACTAA

Geobacillus thermodenitrificansNG80-2 SEQ ID NO:2

AGAGCTGTTTTCCATCTATCGAGACGTATATCCACACACAAAAGAGATAGCGAAACGGTTAAAAGCGTTTCGGCCGTGACGACAAAACCTCCCCGAATCAATTGATGGTTTGGGGAGGTTTTTGTTTACTCAGGTAATCAGACAGGCTGACCCGCTAGGTTTGTCCAAGGAGAACTTGAAAGGTGAGAGCGAAACATGGACATTCGAAAAGAATTCGAAAATCTTAGATAGATTGATTGGCTAAGAGAAAGGGATTTTCTGCGCCAAGCACGAAAGAGTAAAGGGGAGTTAACTGAGCTAGGGTGGTTACTTATATGAGGGGAGAGATTAGCTATGTTCTCTACGCTTCCCGTCCCCATTATCCAAGCACCGATGGCAGGAGGGGTGTCAACGCCCGAACTGGCAGCGGCGGTGTCAAATGCCGGAGGGCTTGGATTTTTGGCTGGCGGGTACCAGACGGCGGAGATGATGAGAACGGAGATTCACAAGCTGCGAACATTGACGGACCGTCCGTTTGGAGTGAATGTGTTTGTGCCAGGGGAAACAACGGTCGATGAAGAGACGCTTAGTCGTTATCGCGCTGTACTGGCGACTGAGGCGGAACGGCTCGGCGCAACAGTCGGAGAGCCGAAATGGGATGACGATGATTGGGAGGCGAAACTCGATGTGCTCCTTAAAGAGCGGGTACCGGTCGTCAGCTTTACGTTTGGTTGCCCGGAAACAGCGGTGATCACTGCCTTGCAAAAGGCTGGGGCGTTTGTAATCGTGACAGTTACATCGGTGGAGGAAGCCCAAATCGCAGCAGAAGCTGGTGCGAATGCCCTTTGTGTGCAAGGGGCAGAAGCGGGTGGTCATCGTGCGTCGTTTCGCAACGATCCGGAAAAAGATGAAGTATTGACGTTGTTCCCGCTGTTGGCCGATGTACACGCGTCGGTTCGTCTCCCGCTTGTGGCGGCGGGTGGGATCATGGATGGGTACGGTATCGCAGCGGCGCTTCAAGCGGGGGCGAGTGCGGTGCAGCTCGGGACAGCGTTTTTACGCTGTCCTGAGAGCGGGGCGCATCCGCTCCATAAACAGGCGCTTGTGGATCCGCGCTTTACCGAAACAGCGGTAACAAGGGCGTTTACCGGCCGGCCGGCGCGCGGGCTGGCGAACCGGTTTATGGCTGAATATAGCGATCTAGCGCCGGCGGCGTATCCGCAAGTGCACCATATGACAAAGCCGATGCGCGCTGCGGCCGCCAAGGTGGGTGACCGAGAGCGGATGGCGCTTTGGGCTGGAGAAGGGTACCGAATGGCGCGAGAACTTCCCGCGGGGGAACTCGTGCGCGAATTGAAGCGGGAGCTCGAGGAGGCACAGGGTCGCTAAATCAATC

the invention is described in more detail below:

the invention provides a construction method of engineering strains NG-S1(NG80-2 carries pNOE1.2.1) and NG-S2 (NG80-2 carries pNOE1.2.2):

step 1 extraction of thermophilic denitrification soil budsBacillus (A), (B), (C)Geobacillus thermodenitrificans) NG80-2 genome DNA, using the DNA as a template, designing upstream and downstream primers GTNG 0930F and GTNG 0930R, GTNG 1755F and GTNG1755R to carry out PCR amplification, and obtaining gene fragments (including promoter fragments) of GTNG0930 and GTNG1755, wherein the gene nucleotide sequences are shown as SEQ ID NO.1 and SEQ ID NO. 2;

step 2, extracting a pUCG18 plasmid;

step 3, carrying out enzyme digestion on the gene fragment prepared in the step 1 and the plasmid prepared in the step 2, connecting, and electrically transferring to escherichia coli DH5 α competent cells;

step 4, after the competent cells obtained in the step 3 are recovered, coating agar solid culture medium containing kanamycin (50 mug/mL), and screening positive recombinant bacteria with kanamycin to obtain pUCG18 plasmid with noe gene;

and 5: transferring the correct plasmid into a competent cell of Geobacillus thermodenitrificans NG 80-2;

step 6: and (3) recovering the competent cells obtained in the step (5), coating the competent cells on an agar solid culture medium containing kanamycin (12 mu g/ml), and screening positive recombinant bacteria with kanamycin to prepare the engineering bacteria capable of efficiently degrading nitroalkanes.

Wherein, in the step 1, the primer sequences of the GTNG 0930F and the GTNG 0930R are as follows:

GTNG 0930F：5'-TGTAAAACGACGGCCAGTGCCAGCTGATGTTGATTAAATCGATCG-3'

GTNG 0930R：5'-AACAGCTATGACCATGATTACGTTAGTTTGCCCAGCGGCACC-3'

the PCR amplification system is (1)Geobacillus thermodenitrificans) NG80-2 genome template 2uL, upstream primer GTNG 0930F 2uL, downstream primer GTNG 0930R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfuDNA Polymerase 1uL, ddH₂O37 uL, total volume 50uL;

the PCR amplification reaction program comprises pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 1min for 20s,30 cycles, final extension at 72 deg.C for 5min, and standing at 4 deg.C;

in the step 1, the primer sequences of GTNG 1755F and GTNG1755R are as follows:

GTNG 1755F：5'-AACTGCAGAGAGCTGTTTTCCATCTATCGAG-3

GTNG 1755R：5'-GCTCTAGAGATTGATTTAGCGACCCTGTG-3

the PCR amplification system is (1)Geobacillus thermodenitrificans) NG80-2 genome template 2uL, upstream primer GTNG 1755F 2uL, downstream primer GTNG1755R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfuDNA Polymerase 1uL, ddH₂O37 uL, total volume 50uL;

the PCR amplification reaction program comprises pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 1min for 20s,30 cycles, final extension at 72 deg.C for 5min, and standing at 4 deg.C;

in steps 3 and 4, the reaction conditions are as follows:

purifying the two PCR products, performing double enzyme digestion by EcoRI, HindIII, Xba I and PstI respectively, performing enzymolysis by the same restriction enzyme respectively, cutting gel, recovering, connecting with plasmid pUCG18, electrically transferring to sensitive Escherichia coli DH5 α (purchased and stored in a laboratory), coating on LB solid medium (Tryptone: 1%; Yeast extract: 0.5%; NaCl: 1%; containing 50 ug/mL Kan (kanamycin)), culturing at 60 deg.C for 16-18 hours, picking out single colony, identifying, inserting single colony, and collecting the obtained productGTNG- 0930The pUCG18 plasmid of the coded DNA sequence is recombinant plasmid pNOE1.2.1, the recombinant Escherichia coli DH5 α containing the plasmid is DH5 α -1, and the plasmid is inserted withGTNG-1755The pUCG18 plasmid of the coded sequence is recombinant plasmid pNOE1.2.2, the recombinant Escherichia coli DH5 α containing the plasmid is DH5 α -2, the DNA fragment is sequenced by adopting a Sanger dideoxy method, the sequencing result shows that the inserted DNA sequence is correct, and then the recombinant plasmids pNOE1.2.1 and pNOE1.2.2 are respectively transformed intoGeobacillus thermodenitrificansNG80-2, and the engineering bacteria are named as NG-S1 and NG-S2 respectively.

Wherein, in the steps 5 and 6,Geobacillus thermodenitrificansthe NG80-2 competence preparation and transformation process is as follows:

1) NG80-2 was inoculated into 20 ml TGP liquid medium (aseptically handled in a super clean bench) and incubated overnight in a shaker at 180 rpm and 60 ℃.

2) The overnight cultured broth was inoculated into 50ml of the liquid medium (sterile in a clean bench) at a concentration of 1% (v/v) and cultured with shaking at 60 ℃ and 220 rpm on a shaker until the OD600 was about 1.0 to 1.6.

3) The flask containing the bacterial solution was iced for 10 min.

4) The bacterial solution was transferred to a 50ml Beckmam high-speed centrifuge tube in a clean bench, and centrifuged at 9000 g, 4 ℃ for 20 min.

5) The supernatant was discarded, 25 ml of about 4 ℃ precooled competent cell washing buffer [ 0.5M sorbitol, 0.5M mannitol, 10% glycerol (v/v) ] was added thereto, and the cells were resuspended by shaking, and then the volume of the suspension was made up to 50ml with the washing buffer, 9000 g, and centrifuged at 4 ℃ for 20 min. This step was repeated 3 more times, each time adding the washing buffer volume of 25 ml, 10 ml, 10 ml.

6) Discarding the supernatant, adding about 1.5 ml of washing buffer to redissolve the bacteria, and subpackaging the redissolved bacteria liquid into 0.5 ml centrifuge tubes, 60 μ l each tube, and rapidly storing at-80 ℃ for later use.

7) Sucking about 50 ng of plasmid, adding the plasmid into a centrifuge tube containing competent cells, gently blowing and uniformly mixing by using a pipette gun to avoid generating bubbles, sucking the mixture, transferring the mixture into a2 mm electric rotating cup for (-20 ℃ for precooling), wiping the electric rotating cup clean by using toilet paper, and placing the electric rotating cup into a BIO-RAD electric rotating instrument for 2.5 KV electric shock.

8) Adding 200 mul of mLB culture medium (preheated at 56 ℃) into an electric transformation cup, blowing and uniformly mixing by using a pipette gun, transferring into a sterilized 1.5 ml centrifuge tube, and incubating at 56 ℃ and 200 rpm for 2-4 h for recovery.

9) And sucking 500 mul of recovered bacterial liquid, coating the liquid on an mLB solid culture plate containing the kanamycin antibiotic with the corresponding concentration, and carrying out inverted culture in an incubator for 24 h at 56 ℃.

10) After the monoclone grows out, the monoclone is picked for corresponding identification.

Further, the engineering bacteria prepared in step 6 are inoculated to a thermophilic minimal medium to degrade the substrate 2-nitropropane (figure 1)

The LB culture medium consists of the following components: 10 g peptone, 5 g yeast extract and 10 g sodium chloride, to a volume of 1L ddH₂O

The TGP medium consists ofThe following components: 17 g peptone, 3 g Soy peptone, 2.5 g K₂HPO₄And5 g of sodium chloride to a constant volume of 1L ddH₂O

The thermophilic minimal medium consists of the following components: 8.37 g morpholinopropane sulfonate, 0.23 g KH₂PO₄,0.51 g NH₄Cl, 5 g NaCl, 1.47 g Na₂SO₄, 0.08 g NaHCO₃, 0.25 g KCl, 1.87 gMgCl·6H₂O, 0.41 g CaCl₂·2H₂O, 1 g NaNO₃And 0.5 g yeast extract to a volume of 1L ddH₂O（PH6.94）.

Further, the invention also provides engineering strains NG-S1(NG80-2 carries pNOE1.2.1) and NG-S2 (NG80-2 carries pNOE1.2.2) under aerobic and anaerobic conditionsGTNG 0930AndGTNG 1755at the transcriptional level (FIG. 2 a)

Further, the present invention also provides crude cell extracts of engineered strains NG-S1(NG80-2 carrying pNOE1.2.1) and NG-S2 (NG80-2 carrying pNOE1.2.2) to analyze the degradation of 2-nitropropane by GTNG0930 and GTNG1755 under aerobic and anaerobic conditions in two cases, no FMN and FMN (FIGS. 2b and c)

Further, NOEs are dependent on the coenzyme FMN to function, their enzymatic activity is substantially identical to that of their bacterial species, but the difference in transcription levels is significantly higher than these two levels, so it is speculated that although NOEs are expressed in large quantities, it is possible that insufficient quantities of coenzymes limit the enzymatic function, and therefore, FMN is supplemented when crude cell extracts are used to analyze 2-nitropropane degradation under aerobic and anaerobic conditions for GTNG0930 and GTNG1755 (FIG. 3), and riboflavin (which is a precursor for FMN synthesis) is supplemented in minimal media to enhance 2-nitropropane degradation under aerobic and anaerobic conditions for NG-S1 and NG-S2 (FIGS. 2d and e)

Compared with the prior art, the thermophilic denitrified soil bacillus engineering bacteria capable of efficiently degrading nitroalkanes and the construction method thereof disclosed by the invention have the following beneficial effects:

(1) the invention discloses a thermophilic bacteria engineering platform for degrading toxic compounds containing nitrogen for the first time, successfully obtains engineering strains NG-S1 and NG-S2 by over-expressing key enzymes in a nitroalkane degradation way, and obviously improves the degradation of the nitroalkane by thalli compared with wild strains.

(2) By optimizing the nutrient conditions, the degradation rate of the engineered strain was further increased (FIGS. 3a and b)

(3) The engineering strains NG-S1 and NG-S2 provided by the invention provide a brand new thought and method for realizing the degradation of nitroalkane, and the method has strong feasibility, good adaptability and important application value and prospect.

Drawings

FIG. 1 shows the degradation of 2-nitropropane by engineering bacteria NG-S1 and NG-S2 under aerobic and anaerobic conditions, respectively;

FIG. 2, engineering bacteria NG-S1 and NG-S2 degrade 2-nitropropane for 3 days, and then collect thalli;

(a) RT-PCR analysis is carried out on the transcription levels of genes GTNG0930 and GTNG1755 in engineering bacteria NG-S1 and NG-S2 under aerobic and anaerobic conditions;

(b) analyzing the amount of degradation products of 2-nitropropane under aerobic and anaerobic conditions using a cell extract;

(c) analysis of 2-nitropropane using cell extracts the amount of degradation products was analyzed by addition of FMN under aerobic and anaerobic conditions; (d) analyzing the degradation rate of the engineering bacteria NG-S1 and NG-S2 to the 2-nitropropane under aerobic and anaerobic conditions;

(e) analysis of degradation rate of 2-nitropropane by engineering bacteria NG-S1 and NG-S2 under aerobic and anaerobic conditions (riboflavin is added in a basal medium);

FIG. 3, the analysis of the degradation rate of the engineering bacteria NG-S1 and NG-S2 on the 2-nitropropane under different influence factors;

(a) influence of yeast extract (under aerobic and anaerobic conditions);

(b) the effect of riboflavin (under aerobic and anaerobic conditions).

Detailed Description

The invention is further described in detail by the following embodiments and the accompanying drawings. The following embodiments are merely illustrative and not restrictive of the invention.

The sources of the strains and raw materials used by the invention are as follows:

NG80-2 was isolated from 69-8 blocks of oil well formation water Bacillus stearothermophilus NG80-2 (N80-2) by Tianjin hong Kong oil field officer, ChinaGeobacillus thermodenitrificansThe strain is preserved in the China general microbiological culture Collection center with the preservation number of CGMCC No.1228, Escherichia coli DH5 α is purchased and then preserved in a laboratory, and the reagents used in the examples are all sold on the market.

Example 1

Clones encoding the complete sequence genes of the nitroalkane oxidases GTNG-0930 and GTNG-1755 (including promoter portions) were constructed.

1. Extraction of total DNA of Geobacillus thermodenitrificans NG80-2

In this embodiment, separation from deep reservoirs is usedGeobacillus thermodenitrificansNG80-2, collecting fresh culture of the strain overnight, centrifuging to collect thallus, suspending the thallus in 250 μ L50mM Tris buffer solution (pH8.0), adding 10 μ L0.4M EDTA (pH8.0), mixing, keeping the temperature at 37 ℃ for 20min, adding 30 μ L20mg/L lysozyme, mixing, keeping the temperature at 37 ℃ for 20min, adding 5 μ L20mg/L proteinase K, mixing, adding 20 μ L10% SDS, keeping the temperature at 50 ℃ until the solution is clear, extracting twice with equal volume of phenol, namely, chloroform, isoamyl alcohol, extracting once with final supernatant, adding 2.5 times volume of precooled absolute ethanol, recovering DNA, washing with 70% ethanol, precipitating in 100 μ LTE buffer solution (pH8.0, 10mM Tris, 1 mM EDTA), adding 10mg/L RNase 2 μ L, keeping the temperature at 65 ℃ for 30min, extracting once with phenol, chloroform, namely, isoamyl alcohol, adding 2.5 times volume of precooled absolute ethyl alcohol into the supernatant, recovering DNA, washing with 70% ethanol, vacuum drying, dissolving the precipitate in 50 mu LddH₂And (4) O buffer solution. The DNA solution was measured by uv spectrophotometer to be a260/a280=1.95, a260=0.76

2. Cloning and screening of nitroalkane oxidase genes

Amplifying the complete sequence gene of GTNG-0930 of NG80-2, taking 2. mu.L of the total DNA solution as a template, and carrying out 30-cycle PCR with the following oligonucleotide sequences as primers according to the PCR cycle parameters set as follows;

GTNG 0930F：5'-TGTAAAACGACGGCCAGTGCCAGCTGATGTTGATTAAATCGATCG-3'

GTNG 0930R：5'-AACAGCTATGACCATGATTACGTTAGTTTGCCCAGCGGCACC-3'

the PCR amplification system is (1)Geobacillus thermodenitrificans) NG80-2 genome template 2uL, upstream primer GTNG 0930F 2uL, downstream primer GTNG 0930R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfuDNA Polymerase 1uL, ddH₂O37 uL, total volume 50uL;

the PCR amplification reaction program comprises pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 1min for 20s,30 cycles, final extension at 72 deg.C for 5min, and standing at 4 deg.C;

GTNG 1755F：5'-AACTGCAGAGAGCTGTTTTCCATCTATCGAG-3

GTNG 1755R：5'-GCTCTAGAGATTGATTTAGCGACCCTGTG-3

the PCR amplification system is (1)Geobacillus thermodenitrificans) NG80-2 genome template 2uL, upstream primer GTNG 1755F 2uL, downstream primer GTNG1755R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfuDNA Polymerase 1uL, ddH₂O37 uL, total volume 50uL;

the PCR amplification reaction program comprises pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 1min for 20s,30 cycles, final extension at 72 deg.C for 5min, and standing at 4 deg.C;

purifying the two PCR products, performing double enzyme digestion by EcoRI, HindIII, Xba I and PstI respectively, performing enzymolysis by the same restriction enzyme respectively, cutting gel, recovering, connecting with plasmid pUCG18, electrically transferring to sensitive Escherichia coli DH5 α (purchased and stored in a laboratory), coating on LB solid medium (Tryptone: 1%; Yeast extract: 0.5%; NaCl: 1%; containing 50 ug/mL Kan (kanamycin)), culturing at 60 deg.C for 16-18 hours, picking out single colony, identifying, inserting single colony, and collecting the obtained productGTNG- 0930The pUCG18 plasmid of the coded DNA sequence is recombinant plasmid pNOE1.2.1, the recombinant Escherichia coli DH5 α containing the plasmid is DH5 α -1, and the plasmid is inserted withGTNG-1755pUCG18 of the encoded sequenceThe plasmid is recombinant plasmid pNOE1.2.2, the recombinant Escherichia coli DH5 α containing the plasmid is DH5 α -2, the DNA fragment is sequenced by a Sanger dideoxy method, and the sequencing result shows that the inserted DNA sequence is correct.

Example 2

Geobacillus thermodenitrificansThe NG80-2 competence preparation and transformation process is as follows:

1) NG80-2 was inoculated into 20 ml TGP broth and incubated overnight at 60 ℃ on a shaker at 180 rpm.

2) Inoculating the overnight cultured strain at a ratio of 1% (v/v) into 50ml of LTGP liquid medium, culturing at 60 deg.C under shaking at 180 rpm on a shaker until OD600 is about 1.0-1.6.

3) The bacterial solution was ice-cooled for 10 min.

4) The bacterial solution was transferred to a 50ml Beckmam high-speed centrifuge tube in a clean bench, and centrifuged at 9000 g, 4 ℃ for 20 min.

5) The supernatant was discarded, 25 ml of about 4 ℃ precooled competent cell washing buffer [ 0.5M sorbitol, 0.5M mannitol, 10% glycerol (v/v) ] was added thereto, and the cells were resuspended by shaking, and then the volume of the suspension was made up to 50ml with the washing buffer, 9000 g, and centrifuged at 4 ℃ for 20 min. This step was repeated 3 more times, each time adding the washing buffer volume of 25 ml, 10 ml, 10 ml.

6) Discarding the supernatant, adding about 1.5 ml of washing buffer to redissolve the bacteria, and subpackaging the redissolved bacteria liquid into 0.5 ml centrifuge tubes, 60 μ l each tube, and rapidly storing at-80 ℃ for later use.

7) Sucking about 50 ng of plasmid, adding the plasmid into a centrifuge tube containing competent cells, gently blowing and uniformly mixing by using a pipette gun to avoid generating bubbles, sucking the mixture, transferring the mixture into a2 mm electric rotating cup for (-20 ℃ for precooling), wiping the electric rotating cup clean, putting the electric rotating cup into a BIO-RAD electric rotating instrument, and electrically shocking at 2.5 KV.

8) Immediately transferring the cells into 1 ml of preheated (60 ℃) TGP, transferring the cells into a 50ml centrifuge tube, resuscitating the cells in a shaker at 60 ℃ and 180 rpm for 2 h

9) And sucking 500 mul of recovered bacterial liquid, coating the liquid on an mLB solid culture plate containing the kanamycin antibiotic with the corresponding concentration, and carrying out inverted culture in an incubator for 24 h at 56 ℃.

10) After the monoclone grows out, selecting the monoclone to carry out corresponding identification.

The identification result is correct.

Example 3

Degradation experiment of 2-nitropropane

The engineering bacteria (NG-S1, NG-S2) and NG80-2 are respectively inoculated into an LB culture medium containing kanamycin antibiotic and an LB culture medium not containing kanamycin antibiotic, and cultured for 12 hours at the temperature of 60 ℃. Cells were harvested by centrifugation, washed twice with a mesophilic minimal medium, and the cell pellet resuspended. Under aerobic conditions, 25 ml of minimal medium containing the appropriate antibiotic was added to a 100 ml headspace vial, to which was added 2 nitropropane to a final concentration of 1.08 mmol. The anaerobic conditions were as follows: the minimal medium was boiled for 30 minutes to eliminate most of the dissolved oxygen and placed in an anaerobic incubator to remove oxygen. L-cysteine and resazurin were added to the medium as an oxygen reducing agent and an indicator, respectively, at final concentrations of 0.1% and 0.01 g/L, respectively, until the oxygen indicator in the medium became colorless. The recombinant strain and NG80-2 are respectively inoculated into a thermophilic minimal medium, the initial OD600 is 0.068, samples are taken at different time points, the residual amount of the 2-nitropropane is detected by using high performance liquid chromatography and is shown in figure 1, and as can be seen from the figure, on day 21, the highest degradation efficiency of NG-S1 under anaerobic condition is 93.5%, and the highest degradation efficiency of NG-S2 under aerobic condition is 96.6%.

Engineering strains NG-S1(NG80-2 carries pNOE1.2.1) and NG-S2 (NG80-2 carries pNOE1.2.2) under aerobic and anaerobic conditionsGTNG 0930AndGTNG 1755at the transcriptional level (FIG. 2 a), where 690 and 740 times up-regulated under anaerobic and aerobic conditions, respectively, compared to the wild type.

Crude cell extracts of engineered strains NG-S1(NG80-2 carrying pNOE1.2.1) and NG-S2 (NG80-2 carrying pNOE1.2.2) were analyzed for the degradation of 2-nitropropane by GTNG0930 and GTNG1755 under aerobic and anaerobic conditions in two cases, no FMN and FMN (FIGS. 2b and c), and the results showed that the crude cell extracts increased 2-3 times the conversion efficiency of 2-NP by the addition of FMN.

Riboflavin, which is a precursor for FMN synthesis, was supplemented in minimal medium to enhance the degradation of 2-nitropropane by NG-S1 and NG-S2 under aerobic and anaerobic conditions (fig. 2d and e), with the most significant 1.8-fold increase in the degradation rate of NG-S2 under aerobic conditions.

The nutrient conditions were optimized and the degradation rate of the engineered strain was further increased (fig. 3a and b).

The degradation efficiency of the engineering bacteria obtained by the invention is obviously improved, and compared with the engineering bacteria without modified Geobacillus thermodenitrificans, the degradation rates of NG-S1 (under anaerobic condition) and NG-S2 (under aerobic condition) are respectively improved by 2 times and 2.8 times.

SEQUENCE LISTING

<110> university of southern kayak

<120> two high-temperature-resistant engineering bacteria for efficiently degrading nitroalkane compounds

<160>2

<170>PatentIn version 3.5

<210>1

<211>1280

<212>DNA

<213> Artificial sequence

<400>1

gctgatgttg attaaatcga tcgccaaggc gttttctccg atgaaggcgc gaaattccgg 60

atccatacct gctccctttt tatgaccggg aatgtgaaat tggattggat ctttttttac 120

gtgttccaac agcccggtaa acaatggtgt ctcgagttgc gacaatggtt tttcacacct 180

ctttacctta aaataaaaca agtgcattat agcatttatt ttttcgtttg caaagaagaa 240

atgaatgcta tgtgaaaaag gaaaacagcg gtgaaaacaa gaaataaaag aaggacaaaa 300

ccaaaaggag gcataagggg atggaatgga aaacgagagt gacagaattg ctcggcatta 360

catacccgat cattcaagga ggacttgcct atttagcgta cgccgattta gccgctgctg 420

tctcgaatgc gggcggcctc gggcaaatta cagcgatgtc gctagaaagc ccggagcggt 480

tgcgcgagga aattcgcaaa gtgaaggaaa aaaccgatcg gccgtttggc gtcaattttg 540

ccatcggtca gcacggccgc gcgttttctc atatgcttga agccgcgctt gacgagggag 600

taccggttgt ctcggtcacc ggcggcaatc cggcaccgtt ttttgagcaa ctgaagggaa 660

cggacgtaaa aacattagtg cttgtcgcag cagtccgcca agcggtcaaa gcggaagaat 720

tgggcgccga tgcggtaatg gtcgtcggcc aagaaggagg cgggcatctc ggcaaatatg 780

acaccggcac gttcgtcctc attccgaaag tcgtcgaatc ggtatcgatt ccggttatcg 840

cctctggcgg tatcgccgat gggcgcgggc tgatggcggc gctggctctt ggggcagaag 900

gcattgaaat ggggacgcgg tttattgcga cgaaagaatg tgtccatgcc catccggtgt 960

ataaagaaat gatcgttaac gccacagagc atgacacggt cgtcattaaa cggtcgcttg 1020

gggcgccggg gcgggcgatc gccaatcaat ggacggagaa aatattggaa attgagcgcc 1080

aaggcggcac gtacgaagat ttgaaagaat atattagcgg agaggcaaat cgccgcttca 1140

tttatgaagg aaaggtggag gaagggttcg cttgggctgg acaggcgatc gggctcattc 1200

gcgacattcc gtccgttgct gagctgtttg cccgcatgat tggtgaggcg gaacaaattc 1260

ggtgccgctg ggcaaactaa 1280

<210>2

<211>1375

<212>DNA

<213> Artificial sequence

<400>2

agagctgttt tccatctatc gagacgtata tccacacaca aaagagatag cgaaacggtt 60

aaaagcgttt cggccgtgac gacaaaacct ccccgaatca attgatggtt tggggaggtt 120

tttgtttact caggtaatca gacaggctga cccgctaggt ttgtccaagg agaacttgaa 180

aggtgagagc gaaacatgga cattcgaaaa gaattcgaaa atcttagata gattgattgg 240

ctaagagaaa gggattttct gcgccaagca cgaaagagta aaggggagtt aactgagcta 300

gggtggttac ttatatgagg ggagagatta gctatgttct ctacgcttcc cgtccccatt 360

atccaagcac cgatggcagg aggggtgtca acgcccgaac tggcagcggc ggtgtcaaat 420

gccggagggc ttggattttt ggctggcggg taccagacgg cggagatgat gagaacggag 480

attcacaagc tgcgaacatt gacggaccgt ccgtttggag tgaatgtgtt tgtgccaggg 540

gaaacaacgg tcgatgaaga gacgcttagt cgttatcgcg ctgtactggc gactgaggcg 600

gaacggctcg gcgcaacagt cggagagccg aaatgggatg acgatgattg ggaggcgaaa 660

ctcgatgtgc tccttaaaga gcgggtaccg gtcgtcagct ttacgtttgg ttgcccggaa 720

acagcggtga tcactgcctt gcaaaaggct ggggcgtttg taatcgtgac agttacatcg 780

gtggaggaag cccaaatcgc agcagaagct ggtgcgaatg ccctttgtgt gcaaggggca 840

gaagcgggtg gtcatcgtgc gtcgtttcgc aacgatccgg aaaaagatga agtattgacg 900

ttgttcccgc tgttggccga tgtacacgcg tcggttcgtc tcccgcttgt ggcggcgggt 960

gggatcatgg atgggtacgg tatcgcagcg gcgcttcaag cgggggcgag tgcggtgcag 1020

ctcgggacag cgtttttacg ctgtcctgag agcggggcgc atccgctcca taaacaggcg 1080

cttgtggatc cgcgctttac cgaaacagcg gtaacaaggg cgtttaccgg ccggccggcg 1140

cgcgggctgg cgaaccggtt tatggctgaa tatagcgatc tagcgccggc ggcgtatccg 1200

caagtgcacc atatgacaaa gccgatgcgc gctgcggccg ccaaggtggg tgaccgagag 1260

cggatggcgc tttgggctgg agaagggtac cgaatggcgc gagaacttcc cgcgggggaa 1320

ctcgtgcgcg aattgaagcg ggagctcgag gaggcacagg gtcgctaaat caatc 1375

Claims (5)

1. The engineering bacteria of the Geobacillus thermodenitrificans for efficiently degrading the nitroalkanes are characterized in that the engineering bacteria of the Geobacillus thermodenitrificans for efficiently degrading the nitroalkanols are obtained by overexpressing key enzyme (NOEs) genes of a nitroalkane degradation approach, and the transformed engineering bacteria are respectively named as NG-S1 and NG-S2; of said NG-S1noesThe nucleotide sequence of the gene is shown as SEQ ID NO. 1; of said NG-S2noesThe gene nucleotide sequence is shown in SEQ ID NO. 2.

2. The method for constructing the engineering bacteria of Geobacillus thermodenitrificans for efficiently degrading nitroalkanes according to claim 1, which comprises the following steps:

step 1, extracting Geobacillus thermodenitrificans (II)Geobacillus thermodenitrificans) NG80-2 genome DNA, designing upstream and downstream primers GTNG 0930F and GTNG 0930R, GTNG 1755F and GTNG1755R by taking the DNA as a template to carry out PCR amplification, and obtaining gene fragments (including promoter fragments) of GTNG0930 and GTNG1755, wherein the nucleotide sequences of the genes are shown as SEQ ID NO.1 and SEQ ID NO. 2;

step 2, extracting a pUCG18 plasmid;

step 3, carrying out enzyme digestion on the gene fragment prepared in the step 1 and the plasmid prepared in the step 2, connecting, and electrically transferring to escherichia coli DH5 α competent cells;

step 4, after the competent cells obtained in the step 3 are recovered, coating agar solid culture medium containing kanamycin and 50 mug/mL, and screening positive recombinant bacteria with kanamycin to obtain pUCG18 plasmid with noe gene;

and 5: transferring the correct plasmid into a competent cell of Geobacillus thermodenitrificans NG 80-2;

step 6: and (3) recovering the competent cells obtained in the step (5), coating the recovered competent cells on an agar solid culture medium containing kanamycin and 12 mu g/ml), and screening positive recombinant bacteria with kanamycin to prepare engineering bacteria NG-S1 and NG-S2 capable of efficiently degrading nitroalkanes.

3. The method of claim 2, wherein in step 1, the primer sequences of GTNG 0930F and GTNG 0930R are:

GTNG 0930F：5'-TGTAAAACGACGGCCAGTGCCAGCTGATGTTGATTAAATCGATCG-3'

GTNG 0930R：5'-AACAGCTATGACCATGATTACGTTAGTTTGCCCAGCGGCACC-3'

the PCR amplification system is (1)Geobacillus thermodenitrificans) NG80-2 genome template 2uL, upstream primer GTNG 0930F 2uL, downstream primer GTNG 0930R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfuDNA Polymerase 1uL, ddH₂O37 uL, total volume 50uL;

the PCR amplification reaction program comprises pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 1min for 20s,30 cycles, final extension at 72 deg.C for 5min, and standing at 4 deg.C;

in the step 1, the primer sequences of GTNG 1755F and GTNG1755R are as follows:

GTNG 1755F：5'-AACTGCAGAGAGCTGTTTTCCATCTATCGAG-3

GTNG 1755R：5'-GCTCTAGAGATTGATTTAGCGACCCTGTG-3

the PCR amplification system is (1)Geobacillus thermodenitrificans) NG80-2 genome template 2uL, upstream primer GTNG 1755F 2uL, downstream primer GTNG1755R 2uL,10 XPCR Buffer 5uL, dNTP Mix 1uL, pfuDNA Polymerase 1uL, ddH₂O37 uL, total volume 50uL;

the PCR amplification reaction program comprises pre-denaturation at 94 deg.C for 2min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 1min for 20s,30 cycles, final extension at 72 deg.C for 5min, and standing at 4 deg.C.

4. The method for constructing the engineering bacteria of Geobacillus thermodenitrificans for efficiently degrading nitroalkanes as claimed in claim 2, and the application of the engineering strains NG-S1 and NG-S2 constructed by the engineering bacteria in preparation of the engineering bacteria for degrading toxic nitroalkanes.

5. The use according to claim 4, wherein said degradation of the toxicant nitroalkane means: 2-nitropropane is degraded.

Images