CN110835644B

CN110835644B - K-ras gene mutation site detection kit

Info

Publication number: CN110835644B
Application number: CN201911293559.7A
Authority: CN
Inventors: 王建平
Original assignee: Guangzhou City Biotron Biotechnology Co ltd
Current assignee: Guangzhou City Biotron Biotechnology Co ltd
Priority date: 2019-12-16
Filing date: 2019-12-16
Publication date: 2021-08-17
Anticipated expiration: 2039-12-16
Also published as: CN110835644A

Abstract

The invention relates to the field of molecular biotechnology and gene detection, in particular to a K-ras gene mutation site detection kit, which comprises: a) a primer pair; b) an upstream probe, a downstream probe, a hairpin probe; and c) two kinds of nano-gold probes. The primers and the probes can realize high-sensitivity, high-resolution and low-cost detection of the mutation sites of the K-ras gene under a closed tube condition, and can effectively avoid cross contamination of amplification products. The downstream probes can be used independently or matched with each other to carry out multiple detection in the same reaction system, so that the kit can simultaneously detect at most seven K-ras gene mutation sites, and has higher detection efficiency.

Description

K-ras gene mutation site detection kit

Technical Field

The invention relates to the field of molecular biotechnology and gene detection, in particular to a kit for detecting K-ras gene mutation sites.

Background

K-ras is a small molecule G protein at the downstream of an EGFR signal pathway, and inhibits the activity of GTP enzyme after mutation, so that the K-ras protein is always in an activated state, and the signal pathway is not regulated by an upstream EGFR signal instruction. The mutation rate of K-ras gene in colorectal cancer patients is about 40%, 70% occurs at

codon

12, and 30% occurs at codon 13. The K-ras gene mutation state is related to the curative effect of cetuximab, and cetuximab treatment is ineffective when K-ras gene is mutated, so that molecular typing detection is carried out on K-ras gene mutation, and a dosing scheme is very necessary to be established according to the mutation condition. However, in general, in actual clinical samples, mutant genes are often mixed in a large number of wild-type gene sequences, and since the sequences between the two often differ by only one base, it is difficult to detect the mutant genes in a targeted manner. Based on this, most of the current gene locus detection is completed based on a molecular detection method with higher specificity, and more technical platforms are ARMS technology and NGS technology, and the two methods can detect about 1% of gene mutation, but the cost of the kit is higher (or the requirement on an operator is higher), so that a larger economic burden is brought to a patient.

Disclosure of Invention

The invention realizes the detection of the mutation site by the regular change of the characteristic absorption wavelength caused by the hybridization between the nanogold probe and the template, and is a rapid, simple and economic K-ras gene mutation detection method compared with the prior method because no expensive machine or complex operation is needed.

Specifically, the invention relates to a K-ras gene mutation site detection kit, which comprises:

a) SEQ ID NO: 1 and SEQ ID NO: 2, and (b) a primer pair shown in the figure;

b) SEQ ID NO: 3, and the upstream probe shown in SEQ ID NO: 4-10, and at least one of the downstream probes shown in SEQ ID NO: 11; and

c) two nanogold probes, each comprising SEQ ID NO: 12 and SEQ ID NO: 13.

The primers and the probes can realize high-sensitivity, high-resolution and low-cost detection of the mutation sites of the K-ras gene under a closed tube condition, and can effectively avoid cross contamination of amplification products. The downstream probes can be used independently or matched with each other to carry out multiple detection in the same reaction system, so that the kit can simultaneously detect at most seven K-ras gene mutation sites, and has higher detection efficiency.

According to still another aspect of the present invention, the present invention also relates to a composition prepared by mixing the kit for detecting K-ras gene mutation sites as described above.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a schematic diagram illustrating the use principle of the kit provided by the present invention;

FIG. 2 shows the results of independent detection of seven mutation sites of K-ras gene in one embodiment of the present invention;

FIG. 3 shows the result of multiplex assay of seven mutation sites of K-ras gene in the same tube according to an embodiment of the present invention;

FIG. 4 shows the amount of the K-ras gene mutation site detection reagent used in the amount of 3X 10 as the template in one embodiment of the present invention⁴Copying a sensitivity detection result;

FIG. 5 shows the amount of the K-ras gene mutation site detection reagent used in the amount of 3X 10 as a template in one embodiment of the present invention³Copying a sensitivity detection result;

FIG. 6 shows the amount of the K-ras gene mutation site detection reagent used in the amount of 3X 10 as a template in one embodiment of the present invention²Copying a sensitivity detection result;

FIG. 7 is a diagram showing the effect of interfering substances in a reagent for detecting a mutation site of K-ras gene according to an embodiment of the present invention;

FIG. 8 is a diagram showing the confirmation of the specificity of a K-ras gene mutation site detection reagent in one embodiment of the present invention;

FIG. 9 shows the results of actual clinical specimens tested by the K-ras gene mutation site assay reagent according to one embodiment of the present invention;

FIG. 10 shows the real-time fluorescence PCR detection results of actual clinical samples of K-ras gene mutation sites in one embodiment of the present invention.

Detailed Description

Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.

It is therefore intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents. Other objects, features and aspects of the present invention are disclosed in or are apparent from the following detailed description. It is to be understood by one of ordinary skill in the art that the present discussion is a description of exemplary embodiments only, and is not intended as limiting the broader aspects of the present invention.

The invention relates to a K-ras gene mutation site detection kit, which comprises:

a) SEQ ID NO: 1 and SEQ ID NO: 2, and (b) a primer pair shown in the figure;

c) two nanogold probes, each comprising SEQ ID NO: 12 and SEQ ID NO: 13.

The K-ras gene mutation site detection kit provided by the invention can realize one-tube detection of hot spot mutations on at most seven K-ras genes, and the whole process can be interpreted without complex operation and complex detection equipment and instruments. The specific principle is as follows. Firstly, a pair of common primers is used for amplifying a hotspot mutation site region to obtain a high-concentration target sequence amplicon. By utilizing the characteristic that hotspot mutation sites of the amplicon are concentrated, a common auxiliary probe and seven detection probes specific to seven mutation targets are designed, when a target sequence exists, the probes are specifically combined with a template, signal molecules are cut under the participation of endonuclease, and different signal differences are formed after the hybridization with the nanogold probe. The signal difference can be interpreted through the visible light difference, and the rapid detection of one or more mutation sites of the K-ras gene in one tube is realized based on the signal difference. Compared with a fluorescent PCR method, the method has the characteristics of sensitivity, simplicity, rapidness and low cost, and is easier to popularize and use.

Obviously, preferably, the kit comprises SEQ ID NO: 4 to 10 in the above range.

In some embodiments, the average particle size of the gold nanoparticles in the gold nanoparticle probe is 1nm to 200 nm.

In some embodiments, the average particle size of the gold nanoparticles in the gold nanoparticle probe is 5nm to 80 nm.

In some embodiments, the average particle size of the gold nanoparticles in the gold nanoparticle probe is 10nm to 30 nm.

In some embodiments, the nucleic acid sequence of SEQ ID NO: 12 and SEQ ID NO: 13 is independently connected with the gold nanoparticle through a connecting segment, and the connecting segments do not hybridize with each other and a) and b).

In the present invention, the criterion for the evaluation of "hybridization" means that nucleic acids do not hybridize under stringent conditions. Such "stringent conditions" are well known to those skilled in the art and include, for example, hybridization at 60 ℃ for 12 to 16 hours in a hybridization solution containing 400mM NaCl, 40mM PIPES (pH6.4) and 1mM EDTA, followed by washing with a washing solution containing 0.1% SDS and 0.1% SSC at 65 ℃ for 15 to 60 minutes. Alternatively, two nucleic acid fragments are cloned in a molecule such as Sambrook et al: the experimental manuals (1989) (Cold spring Lane laboratory Press, New York, USA) "expression of cloned genes in E.coli" section described under standard hybridization conditions with each other. Such conditions as hybridization at 45 ℃ in 6.0 XSSC, followed by a washing step at 50 ℃ in 2 XSSC. To select stringency, the salt concentration in the washing step can be chosen, for example, between 2.0 XSSC at 50 ℃ for low stringency and 2.0 XSSC at 50 ℃ for high stringency. In addition, the temperature in the washing step may vary between about 22 ℃ for low stringency at room temperature and 65 ℃ for high stringency. In a specific embodiment, the stringent conditions are those in the PCR reaction of the present application.

In some embodiments, the linking fragment is 1nt to 15nt in length, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 nt; preferably 3nt to 5 nt.

In some embodiments, the kit further comprises one or more of a DNA polymerase, an endonuclease, dntps, a buffer or buffer salt, a soluble magnesium salt, Tween-20, and water.

The term "buffer" as used herein refers to an aqueous solution or composition that resists changes in pH when an acid or base is added to the solution or composition. This resistance to pH changes is due to the buffer properties of such solutions. Thus, a solution or composition that exhibits buffering activity is referred to as a buffer or buffer solution. Buffers generally do not have the unlimited ability to maintain the pH of a solution or composition. Rather, they are generally capable of being maintained at a pH within a specified range, for example, pH 7 to pH 9. Generally, the buffer is capable of maintaining a pH at its pKa and within the next logarithm (see, e.g., Mohan, Buffers, agent for the preparation and use of Buffers in biological systems, CALBIOCHEM, 1999). Buffers and buffer solutions are generally prepared from buffered salts or preferably non-ionic buffer components such as TRIS and HEPES. The buffer which can be used in the method of the invention is preferably selected from the group consisting of phosphate buffer, phosphate buffered saline buffer (PBS), 2-amino-2 hydroxymethyl-1, 3-propanediol (TRIS) buffer, TRIS buffered saline solution (TBS) and TRIS/edta (te). The buffer can be obtained after dissolution of the buffer salt in a solvent, usually water.

In some embodiments, the DNA polymerase is selected from any of Taq, Bst, Vent, Phi29, Pfu, Tru, Tth, Tl1, Tac, Tne, Tma, Tih, Tf1, Pwo, Kod, Sac, Sso, Poc, Pab, Mth, Pho, ES4 DNA polymerase, Klenow fragment.

In some embodiments, the endonuclease is selected from any one of tapol, TthPol, TaqExo, AfuFEN, PfuFEN, mqifen, or MthFEN.

In some embodiments, the soluble magnesium salt is MgCl₂。

In some embodiments, the water is generally free of nucleic acids and nucleases, such as double distilled or deionized water. The water is distilled water, deionized water or reverse osmosis water.

The invention also relates to a composition which is prepared by mixing the EGFR gene T790M locus detection kit.

In some embodiments, the composition is a solution, wherein the concentration of the primers in a) is independently selected from 0.5 μ M to 1.5 μ M, the concentration of the probes in b) is independently selected from 0.5 μ M to 1.5 μ M, and the concentration of the nanogold probes in c) is independently selected from 0.03 μ M to 0.2 μ M, and the composition further comprises the target nucleic acid.

In some embodiments, the composition has a pH of 8 to 9, preferably 8.5.

The invention also relates to a method for detecting K-ras gene mutation sites, which comprises the following steps:

a) obtaining a composition as described above;

b) and carrying out PCR reaction, and observing the color change of the reaction system to judge the mutation condition of the K-ras gene mutation site.

The method can be used for the medication guidance of K-ras gene targeted drugs.

Embodiments of the present invention will be described in detail with reference to examples.

Example 1 detection of mutated sites in K-ras Gene Using primer probes

Specific primers and probes are designed according to sequences of hot spot mutation sites (shown in table 1) on codons 12 and 13 of the K-ras gene exon, the specificity of a detection result can be determined by a primer pair and a probe pair together, and the design principle is shown in figure 1.

TABLE 1 common hot-spot mutation types of K-ras genes

The K-ras gene mutation site detection kit is composed of a primer, a conventional probe, a nanogold probe, reaction liquid and enzyme liquid, wherein the sequences of the primer and the probe are shown as follows.

An upstream primer: GTA CTG GTG GAG TAT TTG ATA GTG TAT TAA CCT TAT G (SEQ ID NO: 1);

a downstream primer: TGG TCC TGC ACC AGT AAT ATG CAT ATT AAA ACA AG (SEQ ID NO: 2);

an upstream probe: GGACACCGCATGGC (SEQ ID NO: 3);

downstream probe 1: CACCGCATGGCTCACCAGCTCCAACTAC (SEQ ID NO: 4);

downstream probe 2: CACCGCATGGCCCAACAGCTCCAACTAC (SEQ ID NO: 5);

downstream probe 3: CACCGCATGGCCCATCAGCTCCAACTAC (SEQ ID NO: 6);

downstream probe 4: CACCGCATGGCCCAGCAGCTCCAACTAC (SEQ ID NO: 7);

downstream probe 5: CACCGCATGGCCCACTAGCTCCAACTAC (SEQ ID NO: 8);

downstream probe 6: CACCGCATGGCCCACGAGCTCCAACTAC (SEQ ID NO: 9);

downstream probe 7: CACCGCATGGCCCACAAGCTCCAACTAC (SEQ ID NO: 10);

hairpin probe: CGT GTT CAG CCA TG ATC CGT CTC GGT TTT CCG AGA CGG AT GCC ATG CGG TG TAC TTC TCT ATG CAG (SEQ ID NO: 11);

nano-gold probe 1: Au-AATT-CTG CAT AGA GAA GTA (SEQ ID NO: 12);

and 2, nano-gold probe: CAT GGC TGA ACA CG (SEQ ID NO: 13) -TTAA-Au.

Example 2 verification of independent detection results of seven mutation sites of K-ras gene

In the embodiment, the K-ras gene mutation site detection kit is used for detecting templates with different K-ras gene percentage mutation contents by respectively combining a pair of primers, a probe 1, a nanogold probe, a reaction solution, an enzyme solution, a probe 2-probe 8 and the like, and is used for verifying the feasibility of a single independent detection system.

The volume of the reaction solution of the kit is 20 mu L, and the components are respectively as follows: 10mM Tris buffer (pH 8.5), 1 μ M primer (upstream primer, downstream primer), 1 μ M probe (upstream probe, downstream probe 1~ 7, hairpin probe), 0.1 μ M nanogold probe (nanogold probe 1, nanogold probe 2), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease Afufen. Respectively adding the specific mutation templates to be detected with the mixing ratio of 50%, 10%, 2%, 1%, 0.5%, 0.2%, 0.1%, 0.05% and 0% in sequence into the corresponding detection system. And (3) performing Negative (NC) and Positive (PC) quality control simultaneously, wherein the reaction program is as follows: at 95 ℃ for 30 s; circulating at 95 ℃, 20s, 70 ℃, 30s and 32 s; at 62 ℃ for 15 min; 55 ℃ for 5 min. After the reaction was completed, the results are shown in fig. 2. The results in FIG. 2 show that the kits of the present invention can detect at least as low as 1% of mixed percentage template for probe 2-probe 8 detection reactions, where probe 2 can further detect as low as 0.1% of mixed percentage template, probes 3 and 4 can detect as low as 0.2% of mixed percentage template, and probes 5, 6, and 7 can detect as low as 0.5% of mixed percentage template. Therefore, the probes 2 to 8 can achieve better detection effect.

Example 3 validation of seven mutation sites of K-ras gene by in-tube detection results

In the embodiment, the K-ras gene mutation site detection kit is used for verifying the feasibility of multiple detection of multiple mutation sites in a single reaction system by combining a pair of primers, a probe 1, a nanogold probe, a reaction solution, an enzyme solution, a probe 2-a probe 8 and the like to detect the percentage mutation contents of different K-ras genes.

The volume of the reaction solution of the kit is 20 mu L, and the components are respectively as follows: 10mM Tris buffer (pH 8.5), 1 μ M primer (upstream primer, downstream primer), 1 μ M probe (upstream probe, downstream probe 1~ 7, hairpin probe), 0.1 μ M nanogold probe (nanogold probe 1, nanogold probe 2), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease Afufen. Respectively adding 50%, 2%, 1%, 0.5%, 0.2%, 0.1%, 0.05% and 0% of specific mutation templates to be detected into the corresponding detection system in sequence. And (3) performing Negative (NC) and Positive (PC) quality control simultaneously, wherein the reaction program is as follows: at 95 ℃ for 30 s; circulating at 95 ℃, 20s, 70 ℃, 30s and 32 s; at 62 ℃ for 15 min; 55 ℃ for 5 min. After the reaction was completed, the results are shown in FIG. 3. The results in FIG. 3 show that the kits of the present invention can detect at least as low as 1% of mixed percentage template for multiple detection reactions, wherein probe 2 can further detect as low as 0.2% of mixed percentage template, and probe 3, probe 4, probe 5, probe 6 can detect as low as 0.5% of mixed percentage template. Therefore, the detection results of the multiple detection system and the single detection system are basically consistent, and the better detection effect can be achieved.

Example 4 sensitivity of K-ras Gene mutation site detection reagent

In this embodiment, the detection conditions of the K-ras gene mutation site positive reference substances with different percentage concentrations under different nucleic acid template dosages are respectively examined by using the K-ras gene mutation site detection kit, so as to verify the superiority of the method disclosed by the invention.

The volume of the reaction solution of the kit is 20 mu L, and the components are respectively as follows: 10mM Tris buffer (pH 8.5), 1. mu.M primer (forward primer, reverse primer), 1. mu.M probe: (Upstream probe, downstream probe 1-7, hairpin probe), 0.1 μ M nanogold probe (nanogold probe 1, nanogold probe 2), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease AfuFEN. Respectively adding 50%, 2%, 1%, 0.5%, 0.2%, 0.1%, 0.05%, 0% of specific mutation template to be detected into corresponding detection system in sequence, wherein the total amount of template is 3 × 10⁴Copy, 3X 10³Copy, 3X 10²And (6) copying. And (3) performing Negative (NC) and Positive (PC) quality control simultaneously, wherein the reaction program is as follows: at 95 ℃ for 30 s; circulating at 95 ℃, 20s, 70 ℃, 30s and 32 s; at 62 ℃ for 15 min; 55 ℃ for 5 min. The results after the reaction are shown in fig. 4, 5, 6 and table 2. The results show that the total dosage of the kit in the template is respectively 3 multiplied by 10⁴Copy, 3X 10³Copy, 3X 10²At copy, the lowest percentage of the template that can detect the percentage of different mutation sites of the K-ras gene is shown in Table 2. As the template dosage is reduced, the lowest percentage of the template for detecting the mixed percentage of different mutation sites of the K-ras gene by using the kit is gradually reduced, which is consistent with a theoretical value. The total template dosage is respectively 3 multiplied by 10⁴Copy, 3X 10³Copy, 3X 10²The mutant template molecules added into the reaction system are respectively about 60 copies, 15 copies and 3 copies during copying, namely positive signals can still be detected when the mutant template molecules are only 3 copies, and the method has remarkable advantages.

TABLE 2 sensitivity of detection reagent for K-ras Gene mutation site

Example 5 anti-interference of K-ras Gene mutation site detection reagent

In this embodiment, the K-ras gene mutation site detection kit is used to detect samples added with different interfering substances (hemoglobin, albumin, cholesterol, ethanol), respectively, so as to verify the influence of the interfering substances on the result when the detection method of the present invention is used to detect the actual samples.

The volume of the reaction solution of the kit is 20 mu L, and the components are respectively as follows: 10mM Tris buffer (pH 8.5), 1 μ M primer (upstream primer, downstream primer), 1 μ M probe (upstream probe, downstream probe 1~ 7, hairpin probe), 0.1 μ M nanogold probe (nanogold probe 1, nanogold probe 2), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease Afufen. Respectively adding specific mutation templates to be detected with a mixing ratio of 1% to the corresponding detection systems in turn, wherein the total template usage amount is 3 × 10⁴Different interfering substances (0.1mg/ml hemoglobin, 0.01mmol/L albumin, 0.2mmol/L cholesterol, 0.1% ethanol) were added to the test line simultaneously. And (3) performing Negative (NC) and Positive (PC) quality control simultaneously, wherein the reaction program is as follows: at 95 ℃ for 30 s; circulating at 95 ℃, 20s, 70 ℃, 30s and 32 s; at 62 ℃ for 15 min; 55 ℃ for 5 min. After the reaction was completed, the results are shown in fig. 7. The results in FIG. 7 show that different interfering substances (hemoglobin, albumin, cholesterol, ethanol) do not affect the detection results of the kit of the present invention.

Example 6 specificity of detection of mutated sites of K-ras Gene

In this embodiment, the kit for detecting K-ras gene mutation sites is used to detect nucleic acid samples from different sources, such as human gDNA, L858R DNA (EGFR gene No. 21 exon mutation plasmid), L747_ P753> S (EGFR gene No. 19 exon a deletion mutation plasmid), E746_ T751> I (EGFR gene No. 19 exon a deletion mutation plasmid), and E746_ T751del (EGFR gene No. 19 exon a deletion mutation plasmid), respectively, so as to verify the specificity of the method for detecting nucleic acid samples.

The volume of the reaction solution of the kit is 20 mu L, and the components are respectively as follows: 10mM Tris buffer (pH 8.5), 1 μ M primer (upstream primer, downstream primer), 1 μ M probe (upstream probe, downstream probe 1~ 7, hairpin probe), 0.1 μ M nanogold probe (nanogold probe 1, nanogold probe 2), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease Afufen. Human gDNA, EGFR L858R DNA, EGFR L747_ P753> S, K-ras c.183A > C, Braf V600E, E746_ T751del and control (PC and NC) templates were added to the system in sequence. The reaction procedure is as follows: at 95 ℃ for 30 s; circulating at 95 ℃, 20s, 70 ℃, 30s and 32 s; at 62 ℃ for 15 min; 55 ℃ for 5 min. After the reaction was completed, the results are shown in fig. 8. The results in FIG. 8 show that the detection results of nucleic acids from different sources are all negative, indicating the good specificity of the detection kit.

Example 7 detection of K-ras Gene mutation site detection reagent actual clinical specimens

In this example, 14 clinical practical samples were respectively detected by using the K-ras gene mutation site detection kit, and the detection method of the present invention was used to evaluate the ability of detecting practical samples.

The volume of the reaction solution of the kit is 20 mu L, and the components are respectively as follows: 10mM Tris buffer (pH 8.5), 1 μ M primer (upstream primer, downstream primer), 1 μ M probe (upstream probe, downstream probe 1~ 7, hairpin probe), 0.1 μ M nanogold probe (nanogold probe 1, nanogold probe 2), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease Afufen. To the system were added 15 clinical specimens and control (PC and NC) templates in sequence. The reaction procedure is as follows: at 95 ℃ for 30 s; circulating at 95 ℃, 20s, 70 ℃, 30s and 32 s; at 62 ℃ for 15 min; 55 ℃ for 5 min. After the reaction, the results are shown in FIG. 9 (S1 to S14 represent different clinical specimens, respectively). The results in FIG. 9 are consistent with the real-time fluorescence PCR detection results (FIG. 10), and 3 positive results are detected, which shows that the detection kit of the present invention can normally reflect the detection results of clinical samples.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Guangzhou City Baozhua Biotechnology Co., Ltd

<120> K-ras gene mutation site detection kit

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 37

<212> DNA

<213> artificial sequence

<400> 1

gtactggtgg agtatttgat agtgtattaa ccttatg 37

<210> 2

<211> 35

<212> DNA

<213> artificial sequence

<400> 2

tggtcctgca ccagtaatat gcatattaaa acaag 35

<210> 3

<211> 14

<212> DNA

<213> artificial sequence

<400> 3

ggacaccgca tggc 14

<210> 4

<211> 28

<212> DNA

<213> artificial sequence

<400> 4

caccgcatgg ctcaccagct ccaactac 28

<210> 5

<211> 28

<212> DNA

<213> artificial sequence

<400> 5

caccgcatgg cccaacagct ccaactac 28

<210> 6

<211> 28

<212> DNA

<213> artificial sequence

<400> 6

caccgcatgg cccatcagct ccaactac 28

<210> 7

<211> 28

<212> DNA

<213> artificial sequence

<400> 7

caccgcatgg cccagcagct ccaactac 28

<210> 8

<211> 28

<212> DNA

<213> artificial sequence

<400> 8

caccgcatgg cccactagct ccaactac 28

<210> 9

<211> 28

<212> DNA

<213> artificial sequence

<400> 9

caccgcatgg cccacgagct ccaactac 28

<210> 10

<211> 28

<212> DNA

<213> artificial sequence

<400> 10

caccgcatgg cccacaagct ccaactac 28

<210> 11

<211> 66

<212> DNA

<213> artificial sequence

<400> 11

cgtgttcagc catgatccgt ctcggttttc cgagacggat gccatgcggt gtacttctct 60

atgcag 66

<210> 12

<211> 15

<212> DNA

<213> artificial sequence

<400> 12

ctgcatagag aagta 15

<210> 13

<211> 14

<212> DNA

<213> artificial sequence

<400> 13

catggctgaa cacg 14

Claims

A kit for detecting K-ras gene mutation sites, comprising:

a) SEQ ID NO: 1 and SEQ ID NO: 2, and (b) a primer pair shown in the figure;

b) SEQ ID NO: 3, and the upstream probe shown in SEQ ID NO: 4-10, and a downstream probe shown in SEQ ID NO: 11; and

c) nucleic acid fragments of the two nanogold probes are shown as SEQ ID NO: 12 and SEQ ID NO: shown at 13.
2. The kit for detecting K-ras gene mutation site of claim 1, SEQ ID NO: 12 and SEQ ID NO: 13 is independently connected with the gold nanoparticle through a connecting segment, and the connecting segments do not hybridize with each other and a) and b).
3. The K-ras gene mutation site detection kit as claimed in claim 2, wherein the length of the connecting fragment is 1nt to 15 nt.
4. The K-ras gene mutation site detection kit as claimed in claim 3, wherein the length of the connecting fragment is 3nt to 5 nt.
5. The K-ras gene mutation site detection kit as claimed in any one of claims 1 to 4, further comprising one or more of DNA polymerase, endonuclease, dNTP, buffer or buffer salt, soluble magnesium salt, Tween-20 and water.
6. The K-ras gene mutation site detection kit of claim 5, wherein the DNA polymerase is selected from Taq.
7. The K-ras gene mutation site detection kit of claim 5, wherein the endonuclease is selected from Afufen.
8. The kit for detecting K-ras gene mutation site of claim 5, wherein the soluble magnesium salt is MgCl₂。
9. The composition is prepared by the K-ras gene mutation site detection kit as defined in any one of claims 1 to 8.
10. The composition according to claim 9, which is a solution, wherein the concentration of the primers in a) is independently selected from 0.5 to 1.5 μ M, the concentration of the probes in b) is independently selected from 0.5 to 1.5 μ M, the concentration of the nanogold probes in c) is independently selected from 0.03 to 0.2 μ M, and the composition further comprises a target nucleic acid.