CN110835643B - EBV virus detection kit - Google Patents
EBV virus detection kit Download PDFInfo
- Publication number
- CN110835643B CN110835643B CN201911293565.2A CN201911293565A CN110835643B CN 110835643 B CN110835643 B CN 110835643B CN 201911293565 A CN201911293565 A CN 201911293565A CN 110835643 B CN110835643 B CN 110835643B
- Authority
- CN
- China
- Prior art keywords
- seq
- probe
- detection kit
- ebv
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
Abstract
The invention relates to the field of molecular biotechnology and gene detection, in particular to an EBV virus detection kit, which comprises a) a primer pair; b) an upstream probe, a downstream probe, a hairpin probe; and c) two kinds of nano-gold probes. The primers and the probes can realize high-sensitivity, high-resolution and low-cost detection of EBV under a closed tube condition, and can effectively avoid cross contamination of amplification products.
Description
Technical Field
The invention relates to the field of molecular biotechnology and gene detection, in particular to an EBV (Epstein-Barr Virus) detection kit.
Background
Epstein-Barr virus (EBV) is a double-stranded DNA virus of lymphotropic cells, belongs to subfamily Gaps Virus gamma, EBV is found in 1964, diseases caused by confirmed EBV infection are more and more, the infection rate of EBV in normal population is more than 90%, and the EBV is carried throughout life. The conventional detection technology aiming at the EBV is mature day by day, the commonly used detection methods mainly comprise culture, immunoassay, EBV DNA load detection and the like, and EBV infected persons usually have the increase of peripheral blood lymphocytes and the increase of accompanied heterotypic lymphocytes and transaminase, but the detection technology has very little help on diagnosis of the EBV infection. Detection of antibodies by serum reflects the trend of disease to some extent, but does not present a specific number of active viruses. With the continuous development of Polymerase Chain Reaction (PCR) technology, the fluorescence PCR technology is gradually and widely applied to the detection of EBV, and through the detection of the EBV DNA loading capacity, the risk of nasopharyngeal carcinoma can be evaluated, the infection of unknown reasons can be distinguished, and meanwhile, the fluorescence PCR technology also has positive significance on the dynamic monitoring and prognosis evaluation of related tumors.
Disclosure of Invention
According to the invention, the detection of the EBV nucleic acid is realized by rapidly detecting the hybridization condition of the nanogold probe and the template through the visible light wavelength, and a simpler and faster mode is provided for EBV detection. The implementation process of the kit has low requirement on facility conditions, quick and simple result interpretation and low cost.
Specifically, the invention relates to an EBV virus detection kit, which comprises:
a) SEQ ID NO: 1 and SEQ ID NO: 2, and (b) a primer pair shown in the figure;
b) SEQ ID NO: 3, and the upstream probe shown in SEQ ID NO: 4, and the downstream probe shown in SEQ ID NO: 5; and
c) two nanogold probes, each comprising SEQ ID NO: 6 and SEQ ID NO: 7.
The primers and the probes can realize high-sensitivity, high-resolution and low-cost detection of EBV under a closed tube condition, and can effectively avoid cross contamination of amplification products.
According to still another aspect of the present invention, the present invention also relates to a composition prepared by mixing the EBV virus detection kit as described above.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1 shows the result of examining the hybridization efficiency of modified LNA gold nanoprobes according to one embodiment of the present invention;
FIG. 2 shows the results of a sensitivity test of an EBV nucleic acid detection reagent according to one embodiment of the present invention;
FIG. 3 is a graph showing the result of an experiment on the influence of interfering substances in the EBV nucleic acid detecting reagent according to one embodiment of the present invention;
FIG. 4 shows the result of verifying the specificity of the EBV nucleic acid detection reagent according to one embodiment of the present invention;
FIG. 5 shows the results of an actual clinical sample of the EBV nucleic acid detecting reagent according to one embodiment of the present invention;
FIG. 6 shows the real-time fluorescence PCR detection of EBV clinical samples according to one embodiment of the present invention.
Detailed Description
Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.
It is therefore intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents. Other objects, features and aspects of the present invention are disclosed in or are apparent from the following detailed description. It is to be understood by one of ordinary skill in the art that the present discussion is a description of exemplary embodiments only, and is not intended as limiting the broader aspects of the present invention.
The invention relates to an EBV (Epstein-Barr virus) virus detection kit, which comprises:
a) SEQ ID NO: 1 and SEQ ID NO: 2, and (b) a primer pair shown in the figure;
b) SEQ ID NO: 3, and the upstream probe shown in SEQ ID NO: 4, and the downstream probe shown in SEQ ID NO: 5; and
c) two nanogold probes, each comprising SEQ ID NO: 6 and SEQ ID NO: 7.
The EBV nucleic acid detection kit provided by the invention detects the BamHI gene region sequence of the genome, and each sample can be read by only one tube of detection reagent without additional operations such as tube opening and the like. The detection steps mainly comprise the following three stages: the first stage is template amplification, and high-sensitivity amplification of a target template is realized through participation of a primer pair and an amplification enzyme; the second stage is signal generation and accumulation, and high-efficiency conversion of the target template to signal molecules is realized through specific binding of the probe and the amplification template, participation of endonuclease and hybridization of the nanogold probe and the signal molecules; and the third stage is signal interpretation, and the EBV is rapidly detected through the interpretation of the visible light intensity difference. In order to increase the hybridization efficiency of the nanogold probe, LNA (low-case letters in the sequence are LNA modified bases) is added on the sequence of the nanogold probe to improve the hybridization efficiency of the nanogold probe. The probe is added to ensure that the EBV is detected with high sensitivity, high resolution and low cost under the condition of closed tube by the three stages.
In some embodiments, the average particle size of the gold nanoparticles in the gold nanoparticle probe is 1nm to 200 nm.
In some embodiments, the average particle size of the gold nanoparticles in the gold nanoparticle probe is 5nm to 80 nm.
In some embodiments, the average particle size of the gold nanoparticles in the gold nanoparticle probe is 10nm to 30 nm.
In some embodiments, the nucleic acid sequence of SEQ ID NO: 6, the eighth position at the 5' end of the nucleic acid fragment is locked nucleic acid, and the nucleotide sequence shown in SEQ ID NO: 7 is locked nucleic acid at the sixth position of the 5' end.
Locked Nucleic Acids (LNA) can increase the melting temperature of the probe and enhance the stability of these test substances. Compared with the nano-gold probe without LNA modification, the reaction system containing the nano-gold probe modified by LNA has smaller reading of negative results, and the nano-gold probe modified by LNA participates in hybridization reaction more effectively, so that the signal value of the negative reaction result is lower, and the result differentiation is more remarkable finally.
In some embodiments, the nucleic acid sequence of SEQ ID NO: 6 and SEQ ID NO: 7 is independently connected with the gold nanoparticle through a connecting segment, and the connecting segments do not hybridize with each other and a) and b).
In the present invention, the criterion for the evaluation of "hybridization" means that nucleic acids do not hybridize under stringent conditions. Such "stringent conditions" are well known to those skilled in the art and include, for example, hybridization at 60 ℃ for 12 to 16 hours in a hybridization solution containing 400mM NaCl, 40mM PIPES (pH6.4) and 1mM EDTA, followed by washing with a washing solution containing 0.1% SDS and 0.1% SSC at 65 ℃ for 15 to 60 minutes. Alternatively, two nucleic acid fragments are cloned in a molecule such as Sambrook et al: the experimental manuals (1989) (Cold spring Lane laboratory Press, New York, USA) "expression of cloned genes in E.coli" section described under standard hybridization conditions with each other. Such conditions as hybridization at 45 ℃ in 6.0 XSSC, followed by a washing step at 50 ℃ in 2 XSSC. To select stringency, the salt concentration in the washing step can be chosen, for example, between 2.0 XSSC at 50 ℃ for low stringency and 2.0 XSSC at 50 ℃ for high stringency. In addition, the temperature in the washing step may vary between about 22 ℃ for low stringency at room temperature and 65 ℃ for high stringency. In a specific embodiment, the stringent conditions are those in the PCR reaction of the present application.
In some embodiments, the linking fragment is 1nt to 15nt in length; for example 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 nt.
In some embodiments, the linker fragment is Olig N, wherein N is deoxyribonucleic acid and is selected from A, T, C, G.
In some embodiments, the kit further comprises one or more of a DNA polymerase, an endonuclease, dntps, a buffer or buffer salt, a soluble magnesium salt, Tween-20, and water.
The term "buffer" as used herein refers to an aqueous solution or composition that resists changes in pH when an acid or base is added to the solution or composition. This resistance to pH changes is due to the buffer properties of such solutions. Thus, a solution or composition that exhibits buffering activity is referred to as a buffer or buffer solution. Buffers generally do not have the unlimited ability to maintain the pH of a solution or composition. Rather, they are generally capable of being maintained at a pH within a specified range, for example, pH 7-pH 9. Generally, Buffers are capable of maintaining a pH at their pKa and within the next logarithm (see, e.g., Mohan, Buffers, A guide for the preparation and use of Buffers in biological systems, CALBIOCHEM, 1999). Buffers and buffer solutions are generally prepared from buffered salts or preferably non-ionic buffer components such as TRIS and HEPES. The buffer which can be used in the method of the invention is preferably selected from the group consisting of phosphate buffer, phosphate buffered saline buffer (PBS), 2-amino-2 hydroxymethyl-1, 3-propanediol (TRIS) buffer, TRIS buffered saline solution (TBS) and TRIS/edta (te). The buffer can be obtained after dissolution of the buffer salt in a solvent, usually water.
In some embodiments, the soluble magnesium salt is MgCl2。
In some embodiments, the water is generally free of nucleic acids and nucleases, such as double distilled or deionized water. The water is distilled water, deionized water or reverse osmosis water.
In some embodiments, the DNA polymerase is selected from any of Taq, Bst, Vent, Phi29, Pfu, Tru, Tth, Tl1, Tac, Tne, Tma, Tih, Tf1, Pwo, Kod, Sac, Sso, Poc, Pab, Mth, Pho, ES4DNA polymerase, Klenow fragment.
Taq is preferably used in the present invention.
In some embodiments, the endonuclease is selected from any one of tapol, TthPol, TaqExo, AfuFEN, PfuFEN, mqifen, or MthFEN.
Afufen is preferably used in the present invention.
The invention also relates to a composition which is prepared by mixing the EBV virus detection kit.
In some embodiments, the composition is a solution, wherein the concentration of the primers in a) is independently selected from 0.5 μ M to 1.5 μ M, the concentration of the probes in b) is independently selected from 0.5 μ M to 1.5 μ M, and the concentration of the nanogold probes in c) is independently selected from 0.03 μ M to 0.2 μ M, and the composition further comprises the target nucleic acid.
In some embodiments, the target nucleic acid is extracted by a saturated phenol-chloroform method, a silica gel adsorption column method, a resin extraction method, or a magnetic bead extraction method; in some embodiments, the kit further comprises a target nucleic acid extraction system for performing the DNA extraction method described above.
In some embodiments, the composition has a pH of 8 to 9, preferably 8.5.
The invention also relates to a method for detecting EBV virus, which comprises the following steps:
a) obtaining a composition as described above;
b) PCR reaction was performed, and the presence or absence of EBV virus was determined by observing the color change of the reaction system.
Embodiments of the present invention will be described in detail with reference to examples.
Example 1
The EBV nucleic acid detection kit applied in the embodiment adopts the nano-gold probe without LNA modification and the nano-gold probe containing LNA modification to carry out detection respectively, so as to verify the superiority of the hybridization efficiency of the nano-gold probe modified by LNA.
In this embodiment, the EBV nucleic acid detection kit comprises a pair of primers, an upstream probe, a downstream probe, a hairpin probe, a pair of gold nanoparticles, a reaction solution and an enzyme solution, wherein the sequences of the primers and the probes are shown below.
An upstream primer: GCTAAGCCCAACACTCCACCAC (SEQ ID NO: 1);
a downstream primer: CCTTCTTAGGAGCTGTCCGAGGG (SEQ ID NO: 2);
an upstream probe: ACCCAGGCACACACTACACT (SEQ ID NO: 3);
downstream probing: CGCGCCGAGGACACCCACCCGTC (SEQ ID NO: 4);
hairpin probe: TTG GTC TGG TGC TAC ACT CGT CTC GGT TTT CCG AGA CGA GTC CTC GGC GCG ATC GTG ATG AAC CAT (SEQ ID NO: 5);
nano-gold probe 1: Au-TTTTTT-ATG GTT CaT CAC GAT (SEQ ID NO: 6);
and 2, nano-gold probe: GTA GCa CCA GAC CAA (SEQ ID NO: 7) -TTTTTT-Au.
In order to increase the hybridization efficiency of the nanogold probe, LNA (low-noise amplifier) modification is added on the sequence of the nanogold probe to improve the hybridization efficiency of the nanogold probe, wherein the lower case letters in the sequence are LNA modified bases.
The volume of the reaction solution of the kit is 20 mu L, and the components are respectively as follows: 10mM Tris buffer solution (pH 8.5), 1 μ M primers (upstream primer and downstream primer), 1 μ M probe (upstream probe, downstream probe and hairpin probe), 0.1 μ M nanogold probe (nanogold probe 1 and nanogold probe 2), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease AffFEN, wherein the nanogold probe comprises a nanogold probe without LNA modification and a nanogold probe with LNA modification respectively. Adding 10 into the system in sequence5And 0 copy of the nucleic acid to be tested (template sequence: 5-AGC CCA ACA CTC CAC CAC ACC CAG GCA CAC ACT ACA CAC ACC CAC CCG TCT CAG GGT CCC CTC GGA CAG CTC CTA AGA AGG CAC CGG TCG CCC AGT CCT-3, SEQ ID NO: 8). The reaction system is composed of the following reaction procedures: at 95 ℃ for 20 s; circulating at 99 deg.C for 2s, 70 deg.C for 30s, and 35 deg.C; at 63 ℃ for 10 min; 55 ℃ for 5 min. After the reaction was completed, the results are shown in FIG. 1. The results in fig. 1 show that the kit of the present invention can detect negative and positive signals with distinction regardless of the presence or absence of the LNA-modified nanogold probe, but the negative result of the reaction system containing the LNA-modified nanogold probe has a smaller reading value compared to the nanogold probe without LNA modification, and it is obvious that the nanogold probe containing LNA modification participates in the hybridization reaction more effectively, so that the signal value of the negative reaction result is lower, and the result distinction is more significant.
Example 2 optimization of EBV nucleic acid detection protocol
The EBV nucleic acid detection kit is applied in the embodiment, the EBV plasmid template and the negative reference substance are respectively detected, the detection result can be better distinguished by verifying different data processing modes, and meanwhile, the EBV nucleic acid detection kit conforms to the habit of a user in a better mode and enhances the user experience of the detection kit.
The volume of the reaction solution of the kit is 20 mu L, and the components are respectively as follows: 10mM Tris buffer (pH 8.5), 1. mu.M primer (upstream primer, downstream primer), 1. mu.M probe (upstream probe, downstream probe, hairpin probe), 0.05. mu.M nanogold probe (nanogold probe 1, nanogold probe 2), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease Afufen. Adding 10 into the system in sequence5And 0 copy of nucleic acid to be detected (the template sequence is shown as SEQ ID NO: 8). The reaction system is composed of the following reaction procedures: at 95 ℃ for 20 s; circulating at 99 deg.C for 2s, 70 deg.C for 30s, and 35 deg.C; at 63 ℃ for 10 min; 55 ℃ for 5 min. After the reaction was completed, the results are shown in table 1. The results in table 1 show that the negative and positive detection data of the kit of the invention are significantly different, which shows that the negative and positive results can be clearly distinguished.
And (3) analyzing according to the detection result, and completing by adopting two different data processing modes: the first data processing mode is Delta T ═ T610nm-T510nm(ii) a Second data processingIn a manner of Delta T ═ Delta Tmax-(T610nm-T510nm). It is easy to see that both data processing methods can easily judge the negative and positive of the detection result. In general, the detection value of the positive result is habitually considered to be larger than that of the negative result, and the second mode is more suitable for habitual interpretation than the first mode, and from the viewpoint, the second data processing mode is obviously more suitable for result analysis and data processing, so the data processing mode is adopted for result data analysis processing in the invention.
TABLE 1 EBV nucleic acid detection results and data processing
| Positive | Negative | |
| Delta T | 0.013 | 0.356 |
| Delta T' | 0.343 | 0 |
EXAMPLE 3 sensitivity of EBV nucleic acid detecting reagent
In this embodiment, the EBV nucleic acid detection kit is used to detect EBV plasmid templates with different concentrations, respectively, to verify the feasibility of the method of the present invention.
The volume of the reaction solution of the kit is 20 mu L, and the components are respectively as follows: 10mM Tris buffer(pH 8.5), 1. mu.M primers (upstream primer, downstream primer), 1. mu.M probe (upstream probe, downstream probe, hairpin probe), 0.05. mu.M Nanogold probe (Nanogold probe 1, Nanogold probe 2), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease Afufen. Adding 10 into the system in sequence5、104、103、10210, 1 and 0 copies of nucleic acid to be detected (the template sequence is shown in SEQ ID NO: 8). The reaction system is composed of the following reaction procedures: at 95 ℃ for 20 s; circulating at 99 deg.C for 2s, 70 deg.C for 30s, and 35 deg.C; at 63 ℃ for 10 min; 55 ℃ for 5 min. After the reaction was completed, the results are shown in fig. 2. The results in FIG. 2 show that the kit of the invention can distinguish between negative and positive and can detect as little as 10 copies/reaction of plasmid template.
Example 4 anti-interference Properties of EBV nucleic acid detection reagents
In this embodiment, the EBV nucleic acid detection kit is used to detect samples added with different interfering substances (hemoglobin, albumin, cholesterol, ethanol), respectively, so as to verify the influence of the interfering substances on the result when the detection method of the present invention detects the actual sample.
The volume of the reaction solution of the kit is 20 mu L, and the components are respectively as follows: 10mM Tris buffer (pH 8.5), 1 μ M primer (primer 1 sequence SEQ ID NO.1, primer 2 sequence SEQ ID NO.2), 1 μ M probe (probe 1 sequence SEQ ID NO.3, probe 2 sequence SEQ ID NO.4, probe 3 sequence SEQ ID NO.5), 0.05 μ M nanogold probe (probe 1 sequence SEQ ID NO.6, probe 2 sequence SEQ ID NO.7), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease A. Adding 10 into the system in sequence4And 0 copy of nucleic acid to be detected (the template sequence is shown in SEQ ID NO: 8), and adding different interfering substances (0.1mg/ml hemoglobin, 0.01mmol/L albumin, 0.2mmol/L cholesterol, 0.1% ethanol) into the system. The reaction system is composed of the following reaction procedures: at 95 ℃ for 20 s; circulating at 99 deg.C for 2s, 70 deg.C for 30s, and 35 deg.C; at 63 ℃ for 10 min; 55 ℃ for 5 min. After the reaction was completed, the results were compared with the results of the detection of the positive and negative reference substances without any interfering substances, and the results are shown in FIG. 3. The results in FIG. 3 show that different interfering substances (hemoglobin, albumin, cholesterol, ethanol) do not affect the detection of the kit of the inventionAnd (6) obtaining the result.
Example 5 specificity of EBV nucleic acid detection
In this embodiment, the EBV nucleic acid detection kit is used to detect nucleic acid samples (human gDNA, HBV DNA, HPV DNA, and HCV RNA, respectively) from different sources, respectively, to verify the specificity of the method of the present invention in detecting actual samples.
The volume of the reaction solution of the kit is 20 mu L, and the components are respectively as follows: 10mM Tris buffer (pH 8.5), 1. mu.M primer (upstream primer, downstream primer), 1. mu.M probe (upstream probe, downstream probe, hairpin probe), 0.05. mu.M nanogold probe (nanogold probe 1, nanogold probe 2), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease Afufen. Nucleic acids (respectively including human gDNA, HBV DNA, HPV DNA and HCV RNA) of different sources and a positive control template (the sequence of the template is shown in SEQ ID NO: 8) are sequentially added into the system. The reaction system is composed of the following reaction procedures: at 95 ℃ for 20 s; circulating at 99 deg.C for 2s, 70 deg.C for 30s, and 35 deg.C; at 63 ℃ for 10 min; 55 ℃ for 5 min. After the reaction was completed, the results are shown in FIG. 4, compared with the EBV positive control. The results in FIG. 4 show that the detection results of nucleic acids from different sources (human gDNA, HBV DNA, HPV DNA, and HCV RNA, respectively) are all negative, indicating the good specificity of the detection kit.
EXAMPLE 6 detection of actual clinical specimens by EBV nucleic acid detecting reagents
In this embodiment, the EBV nucleic acid detection kit is used to detect 12 clinical actual samples, respectively, for evaluating the ability of the detection method of the present invention to detect the actual samples.
The volume of the reaction solution of the kit is 20 mu L, and the components are respectively as follows: 10mM Tris buffer (pH 8.5), 1. mu.M primer (upstream primer, downstream primer), 1. mu.M probe (upstream probe, downstream probe, hairpin probe), 0.05. mu.M nanogold probe (nanogold probe 1, nanogold probe 2), 0.2mM dNTP, 0.5U Taq DNA polymerase and endonuclease Afufen. Different clinical samples and positive control templates (the template sequence is shown in SEQ ID NO: 8) are added into the system in sequence. The reaction system is composed of the following reaction procedures: at 95 ℃ for 20 s; circulating at 99 deg.C for 2s, 70 deg.C for 30s, and 35 deg.C; at 63 ℃ for 10 min; 55 ℃ for 5 min. The results of the analysis after the reaction were completed are shown in FIG. 5, in which S1 to S12 represent different samples and the control is a positive control. The results in FIG. 5 are consistent with the real-time fluorescence PCR detection results (FIG. 6), which shows that the detection kit of the present invention can normally reflect the detection results of clinical samples.
The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
SEQUENCE LISTING
<110> Guangzhou City Baozhua Biotechnology Co., Ltd
<120> EBV virus detection kit
<160> 7
<170> PatentIn version 3.3
<210> 1
<211> 22
<212> DNA
<213> artificial sequence
<400> 1
gctaagccca acactccacc ac 22
<210> 2
<211> 23
<212> DNA
<213> artificial sequence
<400> 2
ccttcttagg agctgtccga ggg 23
<210> 3
<211> 20
<212> DNA
<213> artificial sequence
<400> 3
<210> 4
<211> 23
<212> DNA
<213> artificial sequence
<400> 4
cgcgccgagg acacccaccc gtc 23
<210> 5
<211> 66
<212> DNA
<213> artificial sequence
<400> 5
ttggtctggt gctacactcg tctcggtttt ccgagacgag tcctcggcgc gatcgtgatg 60
aaccat 66
<210> 6
<211> 15
<212> DNA
<213> artificial sequence
<400> 6
atggttcatc acgat 15
<210> 7
<211> 15
<212> DNA
<213> artificial sequence
<400> 7
gtagcaccag accaa 15
Claims (8)
- An EBV virus detection kit comprising:a) SEQ ID NO: 1 and SEQ ID NO: 2, and (b) a primer pair shown in the figure;b) SEQ ID NO: 3, and the upstream probe shown in SEQ ID NO: 4, and the downstream probe shown in SEQ ID NO: 5; andc) two nanogold probes, each comprising SEQ ID NO: 6 and SEQ ID NO: 7;SEQ ID NO: 6, the eighth position at the 5' end of the nucleic acid fragment is locked nucleic acid, and the nucleotide sequence shown in SEQ ID NO: 7 is locked nucleic acid at the sixth position of the 5' end.
- 2. The EBV virus detection kit of claim 1, SEQ ID NO: 6 and SEQ ID NO: 7 is independently connected with the gold nanoparticle through a connecting fragment, and the connecting fragments do not hybridize with each other and a) and b);the connecting fragment is Olig N, wherein N is selected from A, T, C, G.
- 3. The EBV virus detection kit according to claim 2, wherein the length of the connecting fragment is 1 nt-15 nt.
- 4. The EBV virus detection kit of claim 1, further comprising one or more of a DNA polymerase, an endonuclease, dNTPs, a buffer, a soluble magnesium salt, Tween-20, and water.
- 5. The EBV virus detection kit of claim 4, wherein the DNA polymerase is selected from any one of Taq, Bst, Vent, Phi29, Pfu, Tru, Tth, Tl1, Tac, Tne, Tma, Tih, Tf1, Pwo, Kod, Sac, Sso, Poc, Pab, Mth, Pho, ES4DNA polymerase, Klenow fragment.
- 6. The EBV virus detection kit according to claim 4, wherein the endonuclease is selected from any one of TaqPol, TthPol, TaqExo, AffFEN, PfuFEN, MjaFEN and MthFEN.
- 7. The composition is prepared by mixing the EBV virus detection kit of any one of claims 1-6.
- 8. The composition according to claim 7, which is a solution, wherein the concentration of the primers in a) is independently selected from 0.5 to 1.5 μ M, the concentration of the probes in b) is independently selected from 0.5 to 1.5 μ M, the concentration of the nanogold probes in c) is independently selected from 0.03 to 0.2 μ M, and the composition further comprises a target nucleic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911293565.2A CN110835643B (en) | 2019-12-16 | 2019-12-16 | EBV virus detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911293565.2A CN110835643B (en) | 2019-12-16 | 2019-12-16 | EBV virus detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110835643A CN110835643A (en) | 2020-02-25 |
| CN110835643B true CN110835643B (en) | 2021-07-20 |
Family
ID=69578704
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911293565.2A Active CN110835643B (en) | 2019-12-16 | 2019-12-16 | EBV virus detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110835643B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113234863A (en) * | 2021-06-18 | 2021-08-10 | 重庆天科雅生物科技有限公司 | TCR primer group for specifically identifying EBV virus peptide segment with HLAA11 immune typing and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103642945A (en) * | 2013-12-30 | 2014-03-19 | 上海星耀医学科技发展有限公司 | Reference-containing high-sensitivity fluorescent quantitative polymerase chain reaction (PCR) kit for Epstein-Barr virus |
| CN104561243A (en) * | 2013-10-14 | 2015-04-29 | 周国华 | Novel closed type nucleic acid visual detecting method for coupling nucleic acid amplification reaction, nucleic acid intrusive reaction and nano-particle chromogenic reaction |
| CN106167829A (en) * | 2016-08-31 | 2016-11-30 | 广州市宝创生物技术有限公司 | Visualization CYP2C19 gene parting detecting reagent |
| CN106480220A (en) * | 2016-12-15 | 2017-03-08 | 广州市宝创生物技术有限公司 | Visualization MTHFR allelic gene typing detection reagent kit |
-
2019
- 2019-12-16 CN CN201911293565.2A patent/CN110835643B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561243A (en) * | 2013-10-14 | 2015-04-29 | 周国华 | Novel closed type nucleic acid visual detecting method for coupling nucleic acid amplification reaction, nucleic acid intrusive reaction and nano-particle chromogenic reaction |
| CN103642945A (en) * | 2013-12-30 | 2014-03-19 | 上海星耀医学科技发展有限公司 | Reference-containing high-sensitivity fluorescent quantitative polymerase chain reaction (PCR) kit for Epstein-Barr virus |
| CN106167829A (en) * | 2016-08-31 | 2016-11-30 | 广州市宝创生物技术有限公司 | Visualization CYP2C19 gene parting detecting reagent |
| CN106480220A (en) * | 2016-12-15 | 2017-03-08 | 广州市宝创生物技术有限公司 | Visualization MTHFR allelic gene typing detection reagent kit |
Non-Patent Citations (1)
| Title |
|---|
| Closed-Tube PCR with Nested Serial Invasion Probe Visualization Using Gold Nanoparticles;Jianping Wang et,al.;《Clin Chem.》;20170430;第63卷(第4期);第852-860页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110835643A (en) | 2020-02-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11649497B2 (en) | Methods and compositions for quantitation of proteins and RNA | |
| KR101656240B1 (en) | Multiplexed analyses of test samples | |
| JP2021100429A (en) | Method for detecting target nucleic acid | |
| CN111455114B (en) | High flux detection kit for SARS-CoV-2 | |
| EP4077717B1 (en) | Method of detecting an analyte | |
| CN111154754A (en) | Probe set for analyzing DNA sample and method for using the same | |
| CN112725410A (en) | Primer group for detecting pathogenic microorganisms | |
| US20100279885A1 (en) | Oligonucleotide microarray for identification of pathogens | |
| CN114015815B (en) | Microdroplet digital PCR kit for swine atypical pestivirus and detection method thereof | |
| CN110835643B (en) | EBV virus detection kit | |
| JP6387606B2 (en) | Nucleic acid detection method | |
| CN111518961A (en) | Primer for gene amplification of feline coronavirus and genotyping method | |
| JP2017532030A (en) | Diagnostic method and composition | |
| GB2401175A (en) | Detection of SARS virus by PCR | |
| US20010039012A1 (en) | Methods for diagnostic screening | |
| WO2012036111A1 (en) | Primer, probe, and method for multi-specimen analysis | |
| CN108998576B (en) | Specific primer pair, probe and detection kit for detecting spring carp virus | |
| CN111334610A (en) | Dengue virus universal RT-RAA-LFD amplification primer and detection method | |
| Timm Jr et al. | Amplification and detection of a Y‐chromosome DNA sequence by fluorescence in situ polymerase chain reaction and flow cytometry using cells in suspension | |
| US20240141420A1 (en) | Parallel detection and quantification of nucleic acid based markers | |
| JP5710190B2 (en) | Primer set, probe, assay kit and detection method for β-actin gene | |
| JP6202455B2 (en) | Target nucleic acid detection method | |
| WO1995020676A1 (en) | In situ nucleic acid amplification | |
| WO2023201487A1 (en) | Adapter, adapter ligation reagent, kit, and library construction method | |
| KR101566402B1 (en) | Diagnostic Multiplex Kit for White Spot Syndrome Virus Using Microarray Chip |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |