CN110804545B - Paper-based nucleic acid detection platform and application thereof - Google Patents
Paper-based nucleic acid detection platform and application thereof Download PDFInfo
- Publication number
- CN110804545B CN110804545B CN201911222526.3A CN201911222526A CN110804545B CN 110804545 B CN110804545 B CN 110804545B CN 201911222526 A CN201911222526 A CN 201911222526A CN 110804545 B CN110804545 B CN 110804545B
- Authority
- CN
- China
- Prior art keywords
- layer
- nucleic acid
- paper
- detection
- liquid storage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6804—Nucleic acid analysis using immunogens
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention provides a paper-based nucleic acid detection platform and application thereof, wherein the paper-based platform comprises a liquid storage layer, a reaction layer and a detection layer which are sequentially arranged from top to bottom; the liquid storage layer is provided with a liquid storage cavity; the reaction layer is provided with a nucleic acid extraction layer and an amplification layer which are displayed on the FTA card; the detection layer is provided with a test strip. According to the invention, the three parts of nucleic acid extraction, nucleic acid amplification and nucleic acid detection are integrated together by arranging the liquid storage layer, the reaction layer and the detection layer on the paper-based platform, so that the purposes of full automation of nucleic acid extraction and amplification on the reaction layer and nucleic acid detection on the detection layer are realized, and the paper-based platform is simple to operate, low in cost and high in automation degree, and has a wide application prospect in the technical field of instant detection.
Description
Technical Field
The invention belongs to the technical field of instant detection, relates to a paper-based nucleic acid detection platform and application thereof, and particularly relates to a nucleic acid detection paper-based platform integrating extraction and amplification on an FTA card and application thereof.
Background
The nucleic acid has higher stability relative to protein, becomes an important biomarker in the fields of food safety, disease diagnosis, environmental monitoring and the like, and has wide application prospect in the early diagnosis field of diseases. In remote areas, due to the lack of professionals and professional equipment, the standard operation of nucleic acid detection cannot be guaranteed, and therefore, it is necessary to develop a fully integrated and automatic portable nucleic acid detection device. There are a variety of integrated devices and products commercially available today, but most products suffer from the limitation of being bulky in size and having to be tested in a particular environment, such as a laboratory or hospital. In recent years, point of care technology (POCT) has become a research hotspot as a simple and fast detection means that can be operated by non-professional personnel. POCT has the advantages of economy, high sensitivity, strong specificity, user friendliness, rapidness, no need of expensive equipment, deliverability to end users and the like. Therefore, the nucleic acid detection and POCT can be combined, so that the instant detection of the nucleic acid can be realized.
Currently, nucleic acid detection platforms mainly include microfluidic platforms and paper-based platforms. The microfluidic chip has the advantages of small sample requirement, low reagent consumption, low pollution and the like, but has the defects of incapability of controlling the flow rate of flow channel liquid, high production cost, complex operation, lack of specifications and standards of core technology, related professionals and the like, and is difficult to truly enter practical application; the paper-based platform has the characteristics of low cost, easy availability, random stacking, easy modification, and the dependence of capillary action on the flow of liquid on paper, and has been used for manufacturing pH test paper, urine test paper, early pregnancy test paper, blood glucose test paper and the like. Although the development of these strips has facilitated people's daily lives, it is still challenging to extract, amplify and detect nucleic acids directly on a paper substrate.
CN106916743a discloses an integrated nucleic acid extraction and amplification detection system, which comprises a disposable microfluidic chip and a matched detection device, wherein the microfluidic chip comprises a reaction unit and a waste liquid storage unit, when the chip works, the reaction reagents and the magnetic beads are mutually mixed by means of a vibration module, and the steps of nucleic acid adsorption, purification and the like are sequentially completed by means of a magnetic bead driving module; and (3) flushing the magnetic beads by using the PCR amplification reagent through the fluid driving module, eluting the amplification templates on the magnetic beads, entering a convection PCR reactor constructed by a vertical channel, and realizing CPCR amplification reaction and detection through the heating module and the fluorescent acquisition module. The device integrates nucleic acid extraction and CPCR amplification and detection, can automatically complete nucleic acid extraction and real-time CPCR amplification and detection on one chip, can remarkably improve nucleic acid diagnosis analysis efficiency, and has the characteristics of small volume, high degree of automation, convenience, quickness, simple operation, low cost and the like. However, the system has severe application conditions, needs a professional technician to operate, has large system volume and cannot carry out portable nucleic acid detection.
In order to solve the problems of high cost, overlarge instrument and equipment, need of professional operation and the like in the existing nucleic acid detection process, development of a paper-based platform for automatic nucleic acid detection, which is low in cost, rapid, sensitive, portable and easy to operate, is needed.
Disclosure of Invention
Aiming at the defects and actual demands of the prior art, the invention provides a paper-based nucleic acid detection platform and application thereof, wherein the paper-based platform integrates three parts of nucleic acid extraction, nucleic acid amplification and nucleic acid detection, has simple operation, low cost and high degree of automation, and has wide application prospect in the technical field of instant detection.
To achieve the purpose, the invention adopts the following technical scheme:
in a first aspect, the invention provides a paper-based platform, which comprises a liquid storage layer, a reaction layer and a detection layer which are sequentially arranged from top to bottom;
the liquid storage layer is provided with a liquid storage cavity 1;
the reaction layer is provided with a nucleic acid extraction amplification layer displayed on the FTA card 3;
the detection layer is provided with a test strip 5.
According to the invention, the three parts of nucleic acid extraction, nucleic acid amplification and nucleic acid detection are integrated together by arranging the liquid storage layer, the reaction layer and the detection layer on the paper-based platform, so that the purposes of full-automatic nucleic acid extraction and amplification in the reaction layer and nucleic acid detection in the detection layer are realized.
Preferably, the liquid storage cavity 1 comprises a liquid storage bag, and any one or at least two of nucleic acid purification reagent, amplification reagent, elution reagent or loading reagent are contained in the liquid storage bag.
Preferably, the reservoir bag is sealed with a thermoplastic elastomer film.
In the invention, the nucleic acid purification reagent, the amplification reagent, the elution reagent and the sample loading reagent are released by needling the liquid storage bag at different times and flow into the FTA card 3 in the nucleic acid reaction layer, so that the effects of automatic extraction and amplification of nucleic acid are realized, and the needling action is completed by a machine.
In the present invention, the amplification reagents are stored in the form of lyophilized powders, and the lyophilized amplification reagents and the dissolution liquid are packaged separately.
Preferably, the nucleic acid reaction layer comprises FTA card 3.
Preferably, the reservoir containing the amplification reagents is partitioned between a lyophilized reagent containing the enzyme for the reaction, the modified primer and/or probe, and a protecting agent and a solubilizing reagent.
Preferably, the 5' end of the primer is labeled with biotin.
Preferably, the probe is labelled with FAM groups and/or tetrahydrofuran residues.
In the invention, the FTA is specially made filter paper, the surface of the FTA contains a special powerful denaturant and a chelating agent, after capturing cells, the FTA is automatically subjected to cell lysis and is combined with nucleic acid, the integrity of DNA in a sample is maintained, the nucleic acid is protected from degradation, nuclease, oxidant and ultraviolet rays are prevented from being damaged, and the growth of bacteria and other microorganisms can be prevented.
Preferably, a blood filter layer 2 is disposed on the upper part of the FTA card 3, for separating nucleic acids from proteins, erythrocytes and other impurities in the blood.
Preferably, a heating plate 4 is arranged at the lower part of the FTA card 3, and is used for adjusting the temperature of the FTA card 3.
In the invention, the heating plate 4 is powered by a lithium battery with rated voltage of 5V and rated power of 2-3W, and provides a temperature range of 37-42 ℃.
Preferably, a channel is arranged between the liquid storage layer and the reaction layer.
In the invention, the channel is enclosed inside the paper-based platform.
In the invention, the reagent in the liquid storage cavity flows from the liquid storage layer to the reaction layer through the channel and reaches the FTA card 3 for nucleic acid purification and amplification.
Preferably, the FTA card 3 is circular with a diameter of 4 mm.
In the present invention, the FTA card 3 is manufactured to an appropriate size by punching.
The temperature of the heating sheet 4 is preferably 37 to 42 ℃, and may be 37 ℃, 38 ℃, 39 ℃, 40 ℃, 41 ℃ or 42 ℃, for example.
In the invention, the temperature of the FTA card 3 is regulated to be 37-42 ℃ by adopting the heating plate 4, which is favorable for completing the steps of nucleic acid extraction and isothermal amplification.
In the invention, the temperature of the FTA card is regulated to 37-42 ℃, the recombinase polymerase isothermal amplification (RPA) of nucleic acid is carried out on the FTA card, one of the primers is not modified at all, the 5 'end of the other primer is modified with biotin, the 5' end of the probe is modified with FAM groups, the middle of the probe is provided with abasic nucleic acid analogues (tetrahydrofuran residues (THF)), the amplified products with biotin at one end and FAM groups at the other end can be finally obtained by nfo enzyme cleavage.
Preferably, the test strip 5 comprises a substrate, and a sample pad, a marking pad, a nitrocellulose membrane and absorbent paper which are arranged on the substrate and sequentially lapped and stuck, wherein the nitrocellulose membrane is provided with at least one detection line and one quality control line.
Preferably, the labeling pad is coated with a labeled antibody or antigen which corresponds to the sample to be tested and reacts with the antigen and the antibody of the sample to be tested.
Preferably, the labeled antibody or antigen is labeled with colloidal gold, quantum dots, latex or fluorescent latex.
Preferably, the detection line is coated with a protein which has a specific affinity reaction with the sample to be detected.
Preferably, the quality control line is coated with an antigen or antibody which is subjected to antigen-antibody binding reaction with the labeled antibody or antigen on the labeling pad.
Preferably, the labeling pad is coated with a colloidal gold-labeled anti-FAM antibody.
Preferably, the detection line is coated with streptavidin.
Preferably, the quality control line is coated with any one of an anti-mouse IgG antibody, an anti-rabbit IgG antibody or an anti-chicken IgG antibody, preferably an anti-rabbit IgG antibody.
Preferably, the paper-based platform further comprises a waste liquid layer 7, and a switch 6 is arranged between the waste liquid layer 7 and the detection layer.
In the invention, the liquid flow direction of the liquid to the detection layer or the waste liquid layer is controlled by arranging the switch between the waste liquid layer and the detection layer, the switch is sealed inside the paper-based platform, and the switching action is completed by machinery.
In a second aspect, the present invention provides the use of a paper-based platform as described in the first aspect for the preparation of an automated nucleic acid detection device.
Compared with the prior art, the invention has the following beneficial effects:
(1) According to the paper-based platform, the liquid storage layer, the reaction layer and the detection layer are arranged on the paper-based platform, and three parts of nucleic acid extraction, nucleic acid amplification and nucleic acid detection are integrated together, so that the purpose of fully automatically extracting and amplifying nucleic acid in the reaction layer and detecting nucleic acid in the detection layer is realized;
(2) The colloidal gold labeled antibody is coated on the test strip of the paper-based platform, so that the detection result can be observed by naked eyes, and the convenience of nucleic acid detection is further enhanced;
(3) The paper-based platform of the invention utilizes mechanical automation to carry out simple operations such as sample adding, needling, channel switch changing and the like, thereby realizing the extraction, amplification and detection of nucleic acid in a sample, and the detection process does not need a thermal cycler, a centrifuge, a pump and other large-scale instruments, thereby reducing the cost and completing the operations in the specific environments such as laboratories, hospitals and the like by professionals;
(4) The paper-based platform adopts paper as a base material, has the characteristics of low cost, easy acquisition, easy modification, stackable, regional functional regions, capillary action dependence of the flow of liquid on the paper and the like, is simple in operation, low in cost and high in automation degree, is applied to nucleic acid detection, avoids an additional liquid flow driving device, and is more suitable for instant detection.
Drawings
FIG. 1 is a schematic illustration of the operation of a paper-based platform;
fig. 2 (a) is a front view of the paper-based platform, fig. 2 (B) is a top view of the paper-based platform, fig. 2 (C) is a left side view of the paper-based platform, and fig. 2 (D) is a bottom view of the paper-based platform;
FIG. 3 is an electrophoretogram of amplified products of HPV;
FIG. 4 is a test strip detection chart of HPV DNA.
Detailed Description
The technical means adopted by the invention and the effects thereof are further described below with reference to the examples and the attached drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting thereof.
The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.
Example 1
The operation schematic diagram of the paper-based platform is shown in fig. 1, and the structure schematic diagram is shown in fig. 2.
The paper-based platform comprises a liquid storage layer, a reaction layer and a detection layer which are sequentially arranged from top to bottom;
the liquid storage layer is provided with a liquid storage cavity 1;
the reaction layer is provided with a nucleic acid extraction amplification layer displayed on the FTA card;
the detection layer is provided with a test strip 5;
the liquid storage cavity 1 comprises a liquid storage bag, wherein a nucleic acid purification reagent, an amplification reagent, an elution reagent and a sample loading reagent are contained in the liquid storage bag;
the liquid storage bag is sealed by a thermoplastic elastomer film;
the nucleic acid comprises FTA card 3;
the upper part of the FTA card 3 is provided with a blood filter layer 2 for separating nucleic acid in blood from impurities such as protein, red blood cells and the like;
the lower part of the FTA card 3 is provided with a heating plate 4 for adjusting the temperature of the FTA card 3;
a channel is arranged between the liquid storage layer and the reaction layer;
the FTA card 3 is round with the diameter of 4 mm;
the temperature of the heating plate 4 is 37-42 ℃;
the freeze-dried reagent and the dissolving reagent are separated in the liquid storage bag filled with the amplification reagent, the freeze-dried reagent contains enzyme for reaction, a modified primer and/or a probe and a protective agent, one of the primers is not modified at all, the 5 'end of the other primer is modified with biotin, the 5' end of the probe is modified with FAM group, and the middle of the probe is provided with tetrahydrofuran residue (THF);
the test strip 5 comprises a substrate, a sample pad, a marking pad, a nitrocellulose membrane and absorbent paper, wherein the sample pad, the marking pad, the nitrocellulose membrane and the absorbent paper are arranged on the substrate and are sequentially overlapped and stuck, and the nitrocellulose membrane is provided with a detection line and a quality control line;
the marked pad is coated with a colloidal gold marked anti-FAM antibody;
the detection line is coated with streptavidin;
the quality control line is coated with an anti-rabbit IgG antibody;
the paper-based platform further comprises a waste liquid layer 7, and a switch 6 is arranged between the waste liquid layer 7 and the detection layer.
The working principle of the paper-based platform is as follows:
mechanically puncturing a liquid storage bag in a liquid storage cavity 1 to enable a nucleic acid purification reagent, an amplification reagent, an elution reagent and a sample loading reagent in the liquid storage bag to flow onto an FTA card 3, regulating the temperature of the FTA card 3 to be 37-42 ℃ by a heating plate 4, completing extraction and isothermal amplification of nucleic acid on the FTA card 3, enabling one end of an amplification product to be provided with biotin and the other end to be provided with a FAM group, and enabling the amplification product to flow into a test strip 5 through a regulating switch 6;
the amplified product is combined with the colloidal gold marked anti-FAM antibody on the marking pad under the chromatographic action, and then combined with the anti-rabbit IgG antibody on the detection line to form a marked compound which is fixed on the detection line; then, the colloidal gold labeled anti-FAM antibody flows through a quality control line along with the continuous progress of chromatography and is captured by an anti-rabbit IgG antibody on the quality control line;
the colloidal gold signal can be directly observed by naked eyes.
Example 2 amplification and detection of HPV DNA Using paper-based platform
The reagent sources or formulations used in this example are as follows:
nucleic acid purification reagent: whatman-purification reagents;
nucleic acid amplification reagents: hangzhou mass measurement company-basic kit and nfo kit;
nucleic acid eluting reagent: TE-1buffer (10mM Tris,0.1mM EDTA,pH 8.0)
Sample loading reagent: 4 XSSC buffer;
anti-FAM antibodies: tsingKE;
anti-rabbit IgG antibody: tsingKE.
(1) Primer and probe sequences for HPV DNA
Upstream primer (SEQ ID NO: 1): TTGTTGGGGTAACCAACTATTTGTTACTGTT;
downstream primer (SEQ ID NO: 2):
Biotin-CCTCCCCATGTCGTAGGTACTCCTTAAAG；
probe (SEQ ID NO: 3):
FAM-CAGTACAAATATGTCATTATGTGCTGCCATATC-THF-ACTTCAGAAACTACAT-Pho；
(2) Preparation of colloidal gold test strip
(1) Preparation of nitrocellulose membranes
Controlling the interval between the detection line and the quality control line to be 5mm, debugging a film spraying machine, spraying and coating according to the spraying liquid amount of 0.18 mu L/cm, airing at room temperature for 20min, and transferring to a 50 ℃ oven for drying overnight;
(2) preparation of marking pad
Marking the anti-FAM antibody on colloidal gold according to a conventional marking method to form a gold-labeled conjugate, uniformly coating the gold-labeled conjugate on a marking pad, wherein the concentration of the colloidal gold-labeled anti-FAM antibody is 30%, the coating amount is 0.18 mu L/cm, drying overnight at 37 ℃, sealing a bag, and sealing and preserving at room temperature for standby;
(3) preparation of sample pad
Preparing sample pad treating fluid of 0.5% ovalbumin, 0.01% Tween-20, 0.01M pH=7.0 PBS, 0.02% sodium azide (antiseptic), standing at 4deg.C for use, coating glass fiber with coating parameters of 1cm 2 Drying at 37deg.C overnight, sealing, and sealing at room temperature;
(4) preparation of test paper strip
And sequentially overlapping and pasting the nitrocellulose membrane, the absorbent paper, the marking pad and the sample pad on the PVC plate to form a large plate, and cutting the large plate into single strips with the width of 4mm by using a slitter to obtain the test paper strip.
As shown in FIG. 3, HPV DNA was successfully amplified, wherein lane M is DNA molecular weight, lane 1 is negative control, lane 2 is HPV DNA amplification product, the length is 137bp, and lanes 1 and 2 differ only in that the template is water or HPV DNA; the purpose of the negative control was to make the experimental results more reliable.
As shown in FIG. 4, the HPV DNA products amplified successfully are diluted and then added to a test strip for detection, the negative control only has a quality control line for color development, the amplified products are both developed on the detection line and the quality control line, and the amplified products of template DNA with different concentrations show different trends on the T line of the test strip.
In summary, the paper-based platform of the invention integrates three parts of nucleic acid extraction, nucleic acid amplification and nucleic acid detection by arranging the liquid storage layer, the reaction layer and the detection layer on the paper-based platform, thereby realizing the purposes of full-automatic nucleic acid extraction and amplification on the reaction layer and nucleic acid detection on the detection layer; the paper-based platform of the invention utilizes mechanical automation to carry out simple operations such as sample adding, needling, channel switch changing and the like, thereby realizing the extraction, amplification and detection of nucleic acid in a sample, and the detection process does not need a thermal cycler, a centrifuge, a pump and other large-scale instruments, thereby reducing the cost and completing the operations in the specific environments such as laboratories, hospitals and the like by professionals;
the applicant states that the detailed method of the present invention is illustrated by the above examples, but the present invention is not limited to the detailed method described above, i.e. it does not mean that the present invention must be practiced in dependence upon the detailed method described above. It should be apparent to those skilled in the art that any modification of the present invention, equivalent substitution of raw materials for the product of the present invention, addition of auxiliary components, selection of specific modes, etc., falls within the scope of the present invention and the scope of disclosure.
SEQUENCE LISTING
<110> company of Biotechnology, industriant, suzhou
<120> paper-based nucleic acid detection platform and application thereof
<130> 20191120
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 31
<212> DNA
<213> Synthesis
<400> 1
ttgttggggt aaccaactat ttgttactgt t 31
<210> 2
<211> 29
<212> DNA
<213> Synthesis
<400> 2
cctccccatg tcgtaggtac tccttaaag 29
<210> 3
<211> 49
<212> DNA
<213> Synthesis
<400> 3
cagtacaaat atgtcattat gtgctgccat atcacttcag aaactacat 49
Claims (5)
1. The paper-based platform is characterized by comprising a liquid storage layer, a reaction layer and a detection layer which are sequentially arranged from top to bottom;
the liquid storage layer is provided with a liquid storage cavity (1);
the reaction layer is provided with a nucleic acid extraction amplification layer displayed on the FTA card (3);
the detection layer is provided with a test strip (5);
the liquid storage cavity (1) comprises a liquid storage bag, wherein the liquid storage bag is filled with any one or a combination of at least two of a nucleic acid purification reagent, an amplification reagent, an elution reagent and a sample loading reagent;
the nucleic acid extraction amplification layer comprises an FTA card (3);
the upper part of the FTA card (3) is provided with a blood filter layer (2) for removing protein and red blood cells in blood;
the lower part of the FTA card (3) is provided with a heating plate (4) for adjusting the temperature of the FTA card (3);
a channel is arranged between the liquid storage layer and the reaction layer;
the reservoir of amplification reagents comprises a separate lyophilized reagent and a lysis reagent, the lyophilized reagent comprising an enzyme, modified primer and/or probe for the reaction and a protecting agent;
the 5' end of the primer is marked with biotin;
the probes are labeled with FAM groups and/or tetrahydrofuran residues;
the test strip (5) comprises a substrate, a sample pad, a marking pad, a nitrocellulose membrane and absorbent paper, wherein the sample pad, the marking pad, the nitrocellulose membrane and the absorbent paper are arranged on the substrate and are sequentially lapped and stuck, and at least one detection line and one quality control line are arranged on the nitrocellulose membrane;
the marking pad is coated with a marking antibody or antigen which corresponds to the sample to be tested and reacts with the antigen-antibody of the sample to be tested;
the labeled antibody or antigen is labeled by adopting colloidal gold, quantum dots, latex or fluorescent latex;
the detection line is coated with proteins which have specific affinity reaction with a sample to be detected;
the quality control line is coated with an antigen or an antibody which is subjected to antigen-antibody binding reaction with a labeled antibody or an antigen on the labeling pad;
the marked pad is coated with a colloidal gold marked anti-FAM antibody;
the detection line is coated with streptavidin;
the quality control line is coated with any one of an anti-mouse IgG antibody, an anti-rabbit IgG antibody or an anti-chicken IgG antibody,
the paper-based platform further comprises a waste liquid layer (7), and a switch (6) is arranged between the waste liquid layer (7) and the detection layer.
2. The paper-based platform of claim 1, wherein the reservoir bag is sealed with a thermoplastic elastomer film.
3. The paper-based platform of claim 1, wherein the quality control line is coated with an anti-rabbit IgG antibody.
4. A paper-based platform according to any of claims 1-3, characterized in that the FTA card (3) is circular with a diameter of 4 mm;
the temperature of the heating sheet (4) is 37-42 ℃.
5. Use of a paper-based platform according to any one of claims 1-4 for the preparation of an automated nucleic acid detection device.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911222526.3A CN110804545B (en) | 2019-12-03 | 2019-12-03 | Paper-based nucleic acid detection platform and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911222526.3A CN110804545B (en) | 2019-12-03 | 2019-12-03 | Paper-based nucleic acid detection platform and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110804545A CN110804545A (en) | 2020-02-18 |
| CN110804545B true CN110804545B (en) | 2023-05-05 |
Family
ID=69492344
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911222526.3A Active CN110804545B (en) | 2019-12-03 | 2019-12-03 | Paper-based nucleic acid detection platform and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110804545B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113416632A (en) * | 2021-04-27 | 2021-09-21 | 上海交通大学 | Miniature integrated device of nucleic acid detection of flammable environmental protection |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102816855A (en) * | 2012-09-03 | 2012-12-12 | 华南师范大学 | Method for detecting food-borne pathogenic bacteria by using nucleic acid test strip based on hyper-branched rolling cycle amplification and kit |
| CN103243087A (en) * | 2013-04-28 | 2013-08-14 | 上海快灵生物科技有限公司 | Closed nucleic acid chromatographic test paper detection kit preserved at normal temperature and detection method |
| WO2016192168A1 (en) * | 2015-05-30 | 2016-12-08 | 深圳市共创百业科技开发有限公司 | Biomarker-based tumor early detection kit and preparation method thereof |
| KR20170008131A (en) * | 2015-07-13 | 2017-01-23 | 국립암센터 | Kit and Method for detecting nucleic acids using nanoparticles |
| CN106520536A (en) * | 2016-10-17 | 2017-03-22 | 西安交通大学 | Nucleic-acid extraction, amplification and detection integrated device and manufacturing method and detection method thereof |
| CN106636387A (en) * | 2016-12-14 | 2017-05-10 | 天津科技大学 | Salmonella nucleic acid rapid detection kit, test strip and detection method |
| CN110218769A (en) * | 2019-07-08 | 2019-09-10 | 中国人民解放军东部战区疾病预防控制中心 | The multi-joint test strips of integration integral type for LAMP or RT-LAMP |
-
2019
- 2019-12-03 CN CN201911222526.3A patent/CN110804545B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102816855A (en) * | 2012-09-03 | 2012-12-12 | 华南师范大学 | Method for detecting food-borne pathogenic bacteria by using nucleic acid test strip based on hyper-branched rolling cycle amplification and kit |
| CN103243087A (en) * | 2013-04-28 | 2013-08-14 | 上海快灵生物科技有限公司 | Closed nucleic acid chromatographic test paper detection kit preserved at normal temperature and detection method |
| WO2016192168A1 (en) * | 2015-05-30 | 2016-12-08 | 深圳市共创百业科技开发有限公司 | Biomarker-based tumor early detection kit and preparation method thereof |
| KR20170008131A (en) * | 2015-07-13 | 2017-01-23 | 국립암센터 | Kit and Method for detecting nucleic acids using nanoparticles |
| CN106520536A (en) * | 2016-10-17 | 2017-03-22 | 西安交通大学 | Nucleic-acid extraction, amplification and detection integrated device and manufacturing method and detection method thereof |
| CN106636387A (en) * | 2016-12-14 | 2017-05-10 | 天津科技大学 | Salmonella nucleic acid rapid detection kit, test strip and detection method |
| CN110218769A (en) * | 2019-07-08 | 2019-09-10 | 中国人民解放军东部战区疾病预防控制中心 | The multi-joint test strips of integration integral type for LAMP or RT-LAMP |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110804545A (en) | 2020-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2022209255B2 (en) | Systems and methods for performing biological assays | |
| CN107583676B (en) | Micro-fluidic chip and research method for capturing and detecting exosome | |
| CN106520536B (en) | Nucleic acid extraction, amplification and detection integrating device and its manufacture method and detection method | |
| EP2496351B1 (en) | Device | |
| CN102671729B (en) | Micro-fluidic chip for multi-index biochemical detection | |
| CA2988128C (en) | A component of a device, a device, and a method for purifying and testing biomolecules from biological samples | |
| Yang et al. | Inkjet-printed barcodes for a rapid and multiplexed paper-based assay compatible with mobile devices | |
| CN103055967A (en) | A preparation method of a simple, low-cost, multi-channel microfluidic chemiluminescent paper chip and an on-site detection method by using the same | |
| WO2008089198A1 (en) | Sample collector and tester | |
| CN102373273A (en) | Kit for detecting nucleic acid of mycobacterium tuberculosis and method thereof | |
| CN105154314A (en) | Gene detecting device integrating extraction, amplification and detection | |
| CN110804545B (en) | Paper-based nucleic acid detection platform and application thereof | |
| WO2019086019A1 (en) | Droplet detection apparatus | |
| US20230227888A1 (en) | Point of need diagnostic device and methods of use thereof | |
| CN205115443U (en) | Collection draws, amplifys and detects integrated gene detection device | |
| US20040133128A1 (en) | Assay device with attachable seal for use with specimen collection and assay containers | |
| CN113786869A (en) | Detection chip, equipment and method | |
| CN1963519A (en) | Test paper bar for testing colloidal gold of A-group wheel virus antigen | |
| CN216117640U (en) | Sampling and detection integrated rapid detection structure | |
| CN111733288B (en) | Nucleic acid detection method and device and application in COVID-19 detection | |
| JP2007147539A (en) | Immunoassay method, protein analyzer, and micro flow cell for immunoassay | |
| CN210954058U (en) | Magnetic bead releasing mechanism and system | |
| CN106902901B (en) | Microfluidic chip device and application thereof | |
| CN112226352A (en) | Multifunctional gene detection device | |
| CN204537700U (en) | A kind of detection USB flash disk for medical diagnosis on disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |