CN110734479B

CN110734479B - Escherichia coli cyclic adenosine monophosphate receptor protein mutant, gene engineering bacteria and application

Info

Publication number: CN110734479B
Application number: CN201910989216.8A
Authority: CN
Inventors: 吴绵斌; 袁新松; 毛宇迪; 林建平; 杨立荣
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2019-10-17
Filing date: 2019-10-17
Publication date: 2021-07-06
Anticipated expiration: 2039-10-17
Also published as: CN110734479A

Abstract

The invention discloses a mutant of a cyclic adenosine monophosphate receptor protein of escherichia coli, a genetically engineered bacterium and application. The invention obtains the cyclic adenosine monophosphate receptor protein (CRP) by mutating 112 th amino acid I of CRP of escherichia coli to L, 127 th T to G and 144 th A to T^GThe strain is combined with a ptsG gene knockout delta ptsG scheme to be applied to escherichia coli for producing xylitol, the strain thoroughly eliminates CCR effect, greatly improves the concentration and production efficiency of xylitol, improves the tolerance of the strain to poisons and inhibiting factors in hydrolysate raw materials, directly utilizes hemicellulose hydrolysate before ion exchange to efficiently produce xylitol, simplifies the raw material treatment process, reduces equipment investment, reduces production cost and reduces sewage discharge.

Description

Escherichia coli cyclic adenosine monophosphate receptor protein mutant, gene engineering bacteria and application

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a mutant of a cyclic adenosine monophosphate receptor protein of escherichia coli, a genetic engineering bacterium and application.

Background

Xylitol, a naturally occurring five-carbon sugar alcohol, is a white powdery crystal that is present in many plants and microorganisms, and among the normal metabolic intermediates of the human body, is also present. Xylitol has wide application in food, medicine, cosmetics and health products. At present, the production of xylitol by using bacillus subtilis, corynebacterium glutamicum, yeast and escherichia coli as hosts is reported. Among them, Escherichia coli has been widely studied as an ideal strain in the fields of metabolic engineering and synthetic biology because it can utilize pentose and hexose, has a high growth rate, and is mature in a gene editing method.

The applicant discloses a xylose reductase mutant and a genetic engineering bacterium in an invention patent application with the publication number of CN105671013A, wherein the xylose reductase mutant is derived from 8 amino acids of xylose reductase of neurospora crassa, and the 8 amino acids are respectively mutated into: L102V, L107M, L109Q, I110C, V114I and KSN271-273RTT, wherein the obtained xylose reductase mutant is named as XR-8M, and the activity of catalyzing arabinose to be arabitol is reduced and the selectivity of converting the arabinose into xylitol is improved by the mutant xylose reductase mutant obtained after mutation.

The applicant disclosed in the invention patent application with publication number CN 104789586A: the insertion sequence IS5 was ligated to the R6K replicon, chloramphenicol resistance gene, and then to the promoter P43, XR, and terminator to construct a recombinant plasmid pRC 43. Extracting plasmid pRC43, transforming by taking HK401 strain as a multicopy integration host, preparing the obtained strain into competence, introducing PCP20 plasmid, deleting chloramphenicol resistance gene carried by the strain by means of FRT locus, and repeating the steps to obtain strains IS5-1, IS5-2, IS5-3, IS5-4, IS5-5 and IS5-6 with different copy numbers, wherein the strains have better xylose production capability when the copy number reaches 5.

Although the CCR effect of the Escherichia coli IS5-5 strain of delta ptsG (ptsG gene knockout) IS basically eliminated, the simultaneous utilization of glucose and xylose mixed sugar IS realized, and the IS5-5 IS utilized to efficiently produce xylitol from corn cob hemicellulose hydrolysate by fermentation. However, the IS5-5 strain has not completely eliminated the CCR effect, the rates of transporting and converting xylose are not high enough, and the xylitol concentration and production efficiency are still to be further improved. In particular, the used hemicellulose hydrolysate raw material needs to be subjected to ion exchange to remove poisons and inhibiting factors, the process is time-consuming and cost-increasing, and a large amount of waste water is generated to pollute the environment.

The CCR effect of the strain is thoroughly eliminated by a genetic engineering technology, the xylitol concentration and the production efficiency are greatly improved, the tolerance of the strain to poisons and inhibiting factors in hydrolysate raw materials is improved, the hemicellulose hydrolysate before ion exchange is directly utilized to efficiently produce xylitol, and huge economic benefits and environmental protection values are created.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides a mutant of a cyclic adenosine monophosphate receptor protein of escherichia coli, a genetically engineered bacterium and application.

Escherichia coli cyclic adenosine monophosphate receptor protein mutant (CRP for short)^G) The amino acid sequence is shown as SEQ ID No.1, and is obtained by mutating 112 th amino acid I of cyclic adenosine monophosphate receptor protein (CRP) of escherichia coli into L, 127 th T into G, and 144 th A into T.

The invention also provides a coding gene of the Escherichia coli cyclic adenosine monophosphate receptor protein mutant.

Preferably, the gene sequence of the coding gene is shown as SEQ ID No. 2. The sequence of the wild CRP gene is shown in SEQ ID No. 3.

The invention also provides the application of the Escherichia coli cyclic adenosine monophosphate receptor protein mutant or the encoding gene in the production of xylitol from corncob hydrolysate.

The invention also provides a genetic engineering bacterium, which mutates 112 th amino acid I of the cyclic adenosine monophosphate receptor protein of escherichia coli into L, mutates 127 th T into G and mutates 144 th A into T.

Preferably, the ptsG gene of E.coli is knocked out (abbreviated as Δ ptsG).

More preferably, the ptsF gene, xylA gene and xylB gene of E.coli are knocked out.

Further preferably, the genetically engineered bacterium IS obtained by mutating 112 th amino acid I of the cyclic adenosine monophosphate receptor protein to L, 127 th T to G and 144 th A to T by using an escherichia coli strain IS 5-5. The strain IS5-5 IS constructed by taking W3110 with ptsG gene, ptsF gene, xylA gene and xylB gene deleted as chassis cells and inserting 5 copies of xylose reductase expression module (see the invention patent application with the publication number of CN104789586A for details).

The invention also provides application of the genetic engineering bacteria in producing xylitol.

Preferably, the raw material for producing the xylitol is corncob hydrolysate which is not subjected to ion exchange treatment.

The invention mutates 112 site amino acid I into L, 127 site T into G and 144 site A of cyclic adenosine monophosphate receptor protein (CRP) of escherichia coliObtaining CRP for T^GThe strain is combined with a ptsG gene knockout delta ptsG scheme to be applied to escherichia coli for producing xylitol, the strain thoroughly eliminates CCR effect, greatly improves the concentration and production efficiency of xylitol, improves the tolerance of the strain to poisons and inhibiting factors in hydrolysate raw materials, directly utilizes hemicellulose hydrolysate before ion exchange to efficiently produce xylitol, simplifies the raw material treatment process, reduces equipment investment, reduces production cost and reduces sewage discharge.

Drawings

FIG. 1 is a graph of the glucose and xylose mixed sugar utilization profile of wild type E.coli W3110 strain.

FIG. 2 is a graph of the W3110G strain using mixed sugars of glucose and xylose.

FIG. 3 is a graph of the glucose and xylose mixed sugar utilization profile of the W3110 Δ ptsG strain.

FIG. 4 is a graph of the glucose and xylose mixed sugar utilization profile of the W3110G Δ ptsG strain.

FIG. 5 IS a graph showing the production of xylitol by shake flask fermentation of IS5-5 strain using mixed sugar of glucose and xylose.

FIG. 6 IS a graph showing the production of xylitol by shake flask fermentation of IS5-5G strain using mixed sugar of glucose and xylose.

FIG. 7 IS a graph showing the relationship between concentration and time of fermentation of the IS5-5 strain to produce xylitol by using the corn cob hemicellulose hydrolysate 15-L tank before ion exchange.

FIG. 8 IS a graph showing the relationship between concentration and time in the production of xylitol by fermentation of IS5-5G strain using corn cob hemicellulose hydrolysate in a 15-L tank before ion exchange.

Detailed Description

The invention is further researched on the basis of the invention patent application with the application number of 201510196843.8 entitled Escherichia coli genome integration vector, genetic engineering bacteria and application in xylitol production.

The cloning strain used in the application IS Escherichia coli DH5 alpha, the expression strain IS Escherichia coli W3110, the gene modification starting strain IS5-5 (see earlier application with application number 201510196843.8 for details, and the Escherichia coli W3110 IS obtained by inserting 5 copies of xylose reductase expression modules on the basis of knocking out ptsG gene, xylA gene, xylB gene and ptsF gene), and the strains are all deposited in the laboratory. The plasmids pCas and pTargetF used for CRISPR/Cas9 gene editing are gifts for Shanghai plant growing institute Yangshen sanden researcher of Chinese academy of sciences.

Primers used for strain construction are shown in table 1.

Table 1 primers used for gene editing.

Primers	Sequence(5’-3’)
		N20-crp-F	ccgtcacgtcgaggaacgccgttttagagctagaaatagcaag
N20-crp-R	ggcgttcctcgacgtgacggactagtattatacctaggactgagc
		N20check-F	cgccacctctgacttgagcg
N20check-R	cgatgacgccaactacctctg
		CrpG-u-F	gcatggtgcttggcaaaccgc
CrpG-u-R	cccactttctctgagccgacttgcagacgacgcgccatctgtgcagacaaacgcatcaggaggtccgggtttacctgaatcaattg
		CrpG-d-F	cgtctgcaagtcggctcagagaaagtgggcaatctggcgttcctcgacgtgacgggccgcattactcagactctgctgaatctggc
CrpG-d-R	catgtatcccgccaaactgaggg
		crp-check-F	gctctggagaaagcttataacagagg
crp-check-R	gtgcccaacgcatagatgagcaac

Reagent:

yeast powder (Yeast extract) and peptone (Tryptone): oxoid of UK

Agarose: shanghai worker

Glucose, agar powder: chemical reagents of national drug group Co Ltd

isopropylthio-P-D-galactoside (IPTG): GEN-VIEW Inc. of USA

Ampicillin, streptomycin sulfate, kanamycin sulfate, chloramphenicol: GEN-VIEW Inc. of USA

Xylose, arabinose, xylitol, arabitol: shanghai Aladdin Biotechnology Ltd

3-morpholinopropanesulfonic acid (MOPS): shanghai Aladdin Biotechnology Ltd

Reduced coenzyme ii (nadph): GEN-VIEW Inc. of USA

The common kit comprises:

plasmid miniprep kit: kangning Life sciences (Wujiang) Co., Ltd

Genome DNA extraction kit: kangning Life sciences (Wujiang) Co., Ltd

DNA gel recovery kit: kangning Life sciences (Wujiang) Co., Ltd

Preparing a kit from escherichia coli competent cells: takara Corp Ltd

PCR related reagents and products: takara, Inc.

Common reagent and medium formulations:

1000 × Trace Metals composition (L)^-1)：FeCl₃ 1.6g，CoCl₂·6H₂O 0.2g，CuCl₂ 0.1g，ZnCl₂·4H₂O 0.2g，NaMoO₄ 0.2g，H₃BO₃0.05g, prepared using 0.1M HCl.

Luria-Bertani (LB) Medium composition (L)^-1): dissolving peptone 10g, yeast powder 5g, sodium chloride 10g and deionized water, adjusting pH value to 7.0 with 5M NaOH, and sterilizing at 121 ℃ for 20 min. 2% agar powder is added into the LB solid culture medium.

Shake flask fermentation Medium composition (L)^-1)：Na₂HPO₄ 6g，KH₂PO₄ 3g，NH₄Cl 1g，NaCl 0.5g，1mM MgSO₄，1mM CaCl₂Yeast powder 5g, 1mL of 1,000 × Trace Metals, 50mM MOPS (pH 7.4, for pH stabilization).

Example 1

The steps of constructing an IS5-5G strain (I112L, T127G and A144T three-site mutation of a cyclic adenosine monophosphate receptor protein CRP) by using IS5-5 as an original strain and adopting a CRISPR/Cas9 method are as follows:

1) construction of pTarget-G plasmid

Firstly, a PAM site is found on a target gene, a corresponding N20 sequence is determined, and a cadAspacter on a pTargetF plasmid is replaced by an N20 sequence of the target gene. The pTarget-G plasmid is constructed by full plasmid mutation PCR with N20-crp-F/N20-crp-R as primer and pTargetF plasmid as template.

2) Repair template construction

Taking Escherichia coli W3110 genome as template, CrpG-u-F and CrpG-u-R as primer amplification upstream homology arm, CrpG-d-F and CrpG-d-R as primer amplification downstream homology arm, running nucleic acid electrophoresis and recovering by related kit. Then taking CrpG-u-F and CrpG-d-R as primers and an equal proportion mixture of an upstream homologous arm and a downstream homologous arm as a template, carrying out overlap extension PCR, cutting gel and recovering fragments with corresponding lengths to obtain a repair template of the gene with the 127 th mutation site.

3) Heat shock method for transferring pCas plasmid

a. IS5-5 stored at-80 ℃ was streaked onto a plate of solid medium without antibody and incubated overnight at 37 ℃. Selecting single colony, culturing in liquid LB culture medium at 37 deg.C and 200rpm for about 10 hr, transferring 1mL bacterial liquid into 250mL triangular flask containing 50mL liquid LB culture medium, and growing to OD₆₀₀When the temperature reaches 0.6-0.8, the bacterial liquid is iced for 10min, and transformation competence is prepared according to a Takara escherichia coli competence kit.

b. The prepared IS5-5 competence IS placed on ice, 2 mu L of pCas plasmid IS added under the aseptic condition after melting, and the mixture IS placed in ice bath for 30min after being mixed evenly.

c.42 ℃ water bath or metal bath heat shock for 90s, immediately ice bath for 2 min.

d. Add 700. mu.L liquid LB or resuscitating medium and resuscitate at 30 deg.C and 200rpm for 50 min.

e. Sucking 100 μ L of recovered bacterial liquid, and spreading on kan containing 50mg/L^ROn solid LB plates, and incubated overnight at 30 ℃.

f. And selecting a colony of the single clone for PCR or plasmid extraction verification to obtain successfully transformed Escherichia coli IS5-5 pCas.

4) Electrotransformation site-directed mutagenesis of pTargetF and repair template donor DNA

a. Taking Escherichia coli obtained in 1) as a starting strain, streaking on a 50mg/L kanamycin sulfate resistant plate, culturing at 30 ℃ overnight (the same antibiotics with the same concentration are required to be added in subsequent culture), selecting a single colony to be cultured in liquid LB at 30 ℃, culturing at 200rpm for 10-12h, transferring into 1mL to 50mL LB, culturing at 30 ℃ and 200rpm for 1h, adding sterilized L-arabinose with the working concentration of 0.5% to induce and express Red recombinant protein, and continuously culturing until OD is OD₆₀₀And (3) cooling the mixture for about 0.6 to 0.8 hours in ice bath for 10min to prepare electrotransformation competence.

b. A sterilized 10mL Ep tube is used, the bacterial liquid is subpackaged into 10mL tubes, the tube is centrifuged at 4 ℃ and 4000rpm for 5min, and the supernatant is discarded.

c. Resuspend with 1mL of pre-cooled sterilized 10% glycerol, centrifuge at 4000rpm for 10min at 4 ℃ and carefully discard the supernatant.

d. Repeat c step 2 times. (the subsequent precipitate easily flowed out with the supernatant and the supernatant was discarded with a gentle caution)

e. Resuspended with 100. mu.L of 10% glycerol, transferred to a sterilized 1.5mL Ep tube, and used immediately or placed in a-80 ℃ freezer for future use. (the competence is best for use at present, the longest time can not be kept for more than 72h, otherwise the conversion efficiency is reduced sharply)

f. Using the prepared competence or taking out the previously prepared competence from-80 ℃, it was left on ice for 5min, and 400ng of pTargetF plasmid having point mutation G constructed and 800ng of repair template were added. After mixing, the mixture was transferred to a sterile 2mm electric rotor, and left on ice for 10min for electric conversion.

g. And (3) electrotransfer conditions: 2.5kV, 25 muF, 200 omega, and the electric conversion time is about 5 ms.

h. Immediately after the electrotransfer was completed, 1mL of fresh liquid LB was added, mixed by pipetting back and forth, and transferred to a 2mL sterilized Ep tube. Resuscitated at 30 deg.C and 150rpm for about 2 h.

i. Centrifugally concentrating the recovered bacterial liquid, and coating the concentrated liquid on kan containing 50mg/L^RAnd 50mg/L of spec^RPlates were incubated overnight at 30 ℃.

j. Picking single colony to kan containing 50mg/L^RAnd 0.5mM of IPTG in LB were cultured at 30 ℃ and 200rpm for about 12 hours to eliminate pTarget plasmid.

k. And (5) verifying gene editing. And for positive transformants with successful point mutation, a PCR product sequencing mode is adopted for identification.

If necessary, the temperature-sensitive plasmid pCas can be eliminated by culturing at 30 ℃ and 200rpm for about 12 hours.

The procedure for constructing other strains using the CRISPR/Cas9 method is similar to that described above.

Example 2

A W3110 strain is used as an original strain, and a W3110G strain (three-site mutation of I112L, T127G and A144T of a cyclic adenosine monophosphate receptor protein CRP) is constructed by a CRISPR/Cas9 method.

When the CRISPR/Cas9 method is adopted for construction, the method is the same as that in example 1, and the used primers and plasmids are the same as the pTarget-G plasmid and the repair template in steps (1) and (2) in example 1.

Example 3

The method comprises the following steps of constructing a W3110 delta ptsG strain (ptsG gene is knocked out) by using Escherichia coli W3110 as an initial strain and adopting a CRISPR/Cas9 method, wherein the steps are as follows:

the pTarget-ptsG plasmid was constructed by whole plasmid mutagenesis PCR using N20-ptsG-F/N20-ptsG-R as primers and pTargetF plasmid as a template. Taking Escherichia coli W3110 genome as template, Del-ptsG-u-F and Del-ptsG-u-R as primer to amplify upstream homology arm, and Del-ptsG-d-F and Del-ptsG-d-R as primer to amplify downstream homology arm, running nucleic acid electrophoresis and recovering with related kit. Then, performing overlap extension PCR by using Del-ptsG-u-F and Del-ptsG-d-R as primers and an equal proportion mixture of an upstream homology arm and a downstream homology arm as a template, cutting gel and recovering a fragment with a corresponding length to obtain a repair template for knocking out ptsG genes.

Primers used for strain construction are shown in table 2.

Table 2 primers used for gene editing.

Example 4

A W3110G strain (constructed in example 2) is used as a starting strain, and a W3110G delta ptsG strain (I112L, T127G and A144T three-site mutation of a cyclic adenosine monophosphate receptor protein CRP is adopted by a CRISPR/Cas9 method, and then a ptsG gene is knocked out).

When the CRISPR/Cas9 method is adopted for construction, the method is the same as that in the embodiment 3, and the used primers and plasmids are the same as the pTarget-G plasmid and the repair template in the step in the embodiment 3.

Example 5

1. Shake flask fermentation

Preparing a shake flask fermentation culture medium, filling 45mL of liquid in a 250mL triangular flask, inoculating 1mL of seed liquid, culturing at 37 ℃ and 200rpm for 4h, and adding 5mL of sterilized concentrated corncob hydrolysate (containing 200g/L of xylose and 100g/L of glucose, wherein the calculated final concentration of the xylose is 20g/L and the final concentration of the glucose is 10 g/L). Shaking flask fermentation is carried out at 30 ℃ and 200rpm, sampling is carried out at regular time, and the change condition of relevant parameters is detected. While each set of experiments contained 3 replicates.

2. Fermenting in upper tank

(1) Raw materials and apparatus

1) Fermentation raw materials: corn cob hemicellulose hydrolysate without ion exchange provided by Zhejiang Huakang pharmaceutical industry (initial pH2.5, neutralized to 6.4 with 1M NaOH, vacuum concentrated at 60 deg.C, the concentrations of xylose, glucose and arabinose are 550g/L, 35g/L and 45g/L respectively);

2) LB plate solid Medium (g/L): 5% of yeast powder, 10% of peptone, 10% of NaCl and 1.8% of agar powder (mass fraction);

primary seed Medium (LB Medium, g/L): yeast powder 5, peptone 10, and NaCl 10;

secondary seed medium (g/L): 7.5 of yeast powder, 7.5 of peptone, 15 of glucose and 10 of NaCl;

fermentation medium (g/L): 10 portions of glucose, 24 portions of corn steep liquor dry powder, 0.5 portion of NaCl and KH₂PO₄ 3，Na₂HPO₄·12H₂O9，NH₄And (3) Cl 1. Glucose was sterilized separately.

3) An experimental instrument:

10L rotary evaporator; a national strength 15-L mechanical stirring ventilation type fermentation tank; agilent 1260 HPLC; an ELSD detector; bio-red HPX87C analytical column

(2) Experimental methods

1) And (3) concentrating the hemicellulose hydrolysate: concentrating the hydrolysate by a rotary evaporator to a xylose concentration of about 550g/L for later use by adopting a vacuum decompression concentration principle.

2) Strain activation: taking a glycerol tube storage strain, streaking the glycerol tube storage strain on an LB solid culture medium flat plate, and culturing for 12h at 37 ℃.

3) Preparing first-class seeds: single colonies on LB plates were picked, inoculated into 5mL tubes of LB medium, and cultured overnight at 37 ℃ and 200 rpm.

4) Preparing secondary seeds: 2mL of the inoculum was inoculated into a 1L Erlenmeyer flask containing 300mL of seed medium and cultured at 37 ℃ and 200rpm for 10 hours to OD₆₀₀Is about 6.

5) Inoculation: the fermenter was filled with 5.5L of fermentation medium (excluding glucose), sterilized at 121 ℃ for 30min, cooled to 30 ℃ and adjusted to pH 7.0. The fermentation seeds (about 600mL) were inoculated with killed glucose solution using flame inoculation, at which time the volume in the tank was about 7L.

6) Preparation of raw materials: and (4) taking the concentrated hemicellulose hydrolysate. Measuring 2.5L of hydrolysate (1370 g of xylose mass) according to the final volume of about 10L, sterilizing at 115 ℃ for 30min, and feeding xylose for 75g/L in the first time and 76g/L in the second time. Weighing a certain amount of glucose according to the mass ratio of the xylose to the glucose of 1: 0.6, dissolving, and sterilizing separately at 115 ℃ for 30min to prepare continuous flow feeding materials.

And (3) preparation of a nitrogen source: weighing 160g of corn steep liquor dry powder, dissolving, and sterilizing at 115 ℃ for 30 min.

7) Feeding: after inoculation, the pH was controlled at 7.0 and the temperature at 30 ℃. Aeration quantity is 0.6vvm, initial rotation speed is 400rpm, initial dissolved oxygen is set to be 30, and feeding is carried out when the culture lasts for about 9 hours and OD is more than 20. Adopting a flame inoculation method, adding the prepared raw materials and a nitrogen source, and adopting a fed-batch method for glucose. After the feed supplement, the pH was controlled to 7.0 and the dissolved oxygen was set to 20-25.

8) Putting in a tank: and determining the fermentation end point according to the pH change, sampling and analyzing by HPLC when the pH rises and the dissolved oxygen rises, and stopping fermentation if the concentration of the xylitol is not increased any more.

3. Liquid phase detection method for sugar and sugar alcohol

The sample was diluted to an appropriate concentration and then filtered using a 0.22 μm filter head. Quantitative detection of xylose, glucose, arabinose, xylitol and arabitol was performed using a Dionex UltiMate 3000 high performance liquid system. A detector: corona Charged Aerosol Detector (CAD), analytical column: aminex HPX-87C (Φ 7.8 mm. times.300 mm), mobile phase: ultrapure water, flow rate: 0.6mL/min, column temperature setting: at 76 ℃.

4. Results

The wild-type E.coli W3110 strain showed a clear CCR effect, using no xylose at all in the presence of glucose (FIG. 1); the W3110G strain relieved CCR effects to some extent (fig. 2); the W3110 Δ ptsG strain substantially eliminated CCR effects (fig. 3); the W3110G Δ ptsG strain abolished the CCR effect and achieved simultaneous xylose and glucose utilization (FIG. 4), indicating that CRP^GThe combined strategy of mutation (I112L, T127G, a144T three-site mutation of cyclic adenosine receptor protein CRP) and Δ ptsG (knock-out ptsG gene) did eliminate the CCR effect of e.

IS5-5 (. DELTA.ptsG) produced 17.8g/L xylitol (FIG. 5); IS5-5G (Δ ptsG + CRP)^GMutation) produced 20.2g/L xylitol (FIG. 6), suggesting that CRP was used^GThe mutation and Δ ptsG combination strategy could indeed effectively improve the ability of the strain to produce xylitol under shake flask fermentation conditions.

The IS5-5 and IS5-5G strains are fermented by adopting a 15-L tank fed batch respectively, and corn cob hemicellulose hydrolysate which IS not subjected to ion exchange IS utilized. IS5-5 strain 78h produced 93g/L xylitol, at a production rate of 1.19g/L, with a xylitol to xylose yield of 0.87g/g (FIG. 7). The strain IS5-5G strain 78h produced 136.7G/L of xylitol, the production rate was 1.75G/L, the yield of xylitol to xylose was 1.0G/G (FIG. 8), and the results were all greatly improved compared with the starting strain IS 5-5.

Sequence listing

<110> Zhejiang university

<120> Escherichia coli cyclic adenosine monophosphate receptor protein mutant, gene engineering bacteria and application

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 210

<212> PRT

<213> Escherichia coli (Escherichia coli)

<400> 1

Met Val Leu Gly Lys Pro Gln Thr Asp Pro Thr Leu Glu Trp Phe Leu

1 5 10 15

Ser His Cys His Ile His Lys Tyr Pro Ser Lys Ser Lys Leu Ile His

20 25 30

Gln Gly Glu Lys Ala Glu Thr Leu Tyr Tyr Ile Val Lys Gly Ser Val

35 40 45

Ala Val Leu Ile Lys Asp Glu Glu Gly Lys Glu Met Ile Leu Ser Tyr

50 55 60

Leu Asn Gln Gly Asp Phe Ile Gly Glu Leu Gly Leu Phe Glu Glu Gly

65 70 75 80

Gln Glu Arg Ser Ala Trp Val Arg Ala Lys Thr Ala Cys Glu Val Ala

85 90 95

Glu Ile Ser Tyr Lys Lys Phe Arg Gln Leu Ile Gln Val Asn Pro Asp

100 105 110

Leu Leu Met Arg Leu Ser Ala Gln Met Ala Arg Arg Leu Gln Val Gly

115 120 125

Ser Glu Lys Val Gly Asn Leu Ala Phe Leu Asp Val Thr Gly Arg Ile

130 135 140

Thr Gln Thr Leu Leu Asn Leu Ala Lys Gln Pro Asp Ala Met Thr His

145 150 155 160

Pro Asp Gly Met Gln Ile Lys Ile Thr Arg Gln Glu Ile Gly Gln Ile

165 170 175

Val Gly Cys Ser Arg Glu Thr Val Gly Arg Ile Leu Lys Met Leu Glu

180 185 190

Asp Gln Asn Leu Ile Ser Ala His Gly Lys Thr Ile Val Val Tyr Gly

195 200 205

Thr Arg

210

<210> 2

<211> 633

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 2

atggtgcttg gcaaaccgca aacagacccg actctcgaat ggttcttgtc tcattgccac 60

attcataagt acccatccaa gagcaagctt attcaccagg gtgaaaaagc ggaaacgctg 120

tactacatcg ttaaaggctc tgtggcagtg ctgatcaaag acgaagaggg taaagaaatg 180

atcctctcct atctgaatca gggtgatttt attggcgaac tgggcctgtt tgaagagggc 240

caggaacgta gcgcatgggt acgtgcgaaa accgcctgtg aagtggctga aatttcgtac 300

aaaaaatttc gccaattgat tcaggtaaac ccggacctcc tgatgcgttt gtctgcacag 360

atggcgcgtc gtctgcaagt cggctcagag aaagtgggca atcttgcgtt cctcgacgtg 420

acgggccgca ttactcagac tctgctgaat ctggcaaaac aaccagacgc tatgactcac 480

ccggacggta tgcaaatcaa aattacccgt caggaaattg gtcagattgt cggctgttct 540

cgtgaaaccg tgggacgcat tctgaagatg ctggaagatc agaacctgat ctccgcacac 600

ggtaaaacca tcgtcgttta cggcactcgt taa 633

<210> 3

<211> 633

<212> DNA

<213> Escherichia coli (Escherichia coli)

<400> 3

atggtgcttg gcaaaccgca aacagacccg actctcgaat ggttcttgtc tcattgccac 60

attcataagt acccatccaa gagcaagctt attcaccagg gtgaaaaagc ggaaacgctg 120

tactacatcg ttaaaggctc tgtggcagtg ctgatcaaag acgaagaggg taaagaaatg 180

atcctctcct atctgaatca gggtgatttt attggcgaac tgggcctgtt tgaagagggc 240

caggaacgta gcgcatgggt acgtgcgaaa accgcctgtg aagtggctga aatttcgtac 300

aaaaaatttc gccaattgat tcaggtaaac ccggacattc tgatgcgttt gtctgcacag 360

atggcgcgtc gtctgcaagt cacttcagag aaagtgggca acctggcgtt cctcgacgtg 420

acgggccgca ttgcacagac tctgctgaat ctggcaaaac aaccagacgc tatgactcac 480

ccggacggta tgcaaatcaa aattacccgt caggaaattg gtcagattgt cggctgttct 540

cgtgaaaccg tgggacgcat tctgaagatg ctggaagatc agaacctgat ctccgcacac 600

ggtaaaacca tcgtcgttta cggcactcgt taa 633

<210> 4

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccgtcacgtc gaggaacgcc gttttagagc tagaaatagc aag 43

<210> 5

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggcgttcctc gacgtgacgg actagtatta tacctaggac tgagc 45

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cgccacctct gacttgagcg 20

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cgatgacgcc aactacctct g 21

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gcatggtgct tggcaaaccg c 21

<210> 9

<211> 86

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cccactttct ctgagccgac ttgcagacga cgcgccatct gtgcagacaa acgcatcagg 60

aggtccgggt ttacctgaat caattg 86

<210> 10

<211> 86

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cgtctgcaag tcggctcaga gaaagtgggc aatctggcgt tcctcgacgt gacgggccgc 60

attactcaga ctctgctgaa tctggc 86

<210> 11

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

catgtatccc gccaaactga ggg 23

<210> 12

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gctctggaga aagcttataa cagagg 26

<210> 13

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gtgcccaacg catagatgag caac 24

<210> 14

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

caatccagac cttctctcag gttttagagc tagaaatagc aag 43

<210> 15

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ctgagagaag gtctggattg actagtatta tacctaggac tgagc 45

<210> 16

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cctgcgatgg ttcgtgacgt tgcag 25

<210> 17

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

actcatccat ctcgggatag gcagtacgga taccggcagc 40

<210> 18

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

tccgtactgc ctatcccgag atggatgagt acatccgtaa c 41

<210> 19

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gaactcaacg gcgcaattac cgacaac 27

<210> 20

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ccggtaccgc atcgaggaaa agag 24

<210> 21

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gaaaccgcct ataaagcggt ggatggg 27

Claims

1. A genetically engineered bacterium IS characterized in that 112 th amino acid I of a cyclic adenosine monophosphate receptor protein IS mutated into L, 127 th T IS mutated into G, and 144 th A IS mutated into T by an escherichia coli strain IS 5-5.

2. The use of the genetically engineered bacterium of claim 1 in the production of xylitol.

3. The use according to claim 2, wherein the xylitol-producing material is corn cob hydrolysate which has not been subjected to ion exchange treatment.