CN104593308B

CN104593308B - A kind of genetic engineering bacterium and its construction method and the application in production xylitol

Info

Publication number: CN104593308B
Application number: CN201410750635.3A
Authority: CN
Inventors: 吴绵斌; 苏卜利; 张哲�; 林建平; 杨立荣
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2014-12-09
Filing date: 2014-12-09
Publication date: 2017-07-14
Anticipated expiration: 2034-12-09
Also published as: CN104593308A

Abstract

A kind of application the invention discloses genetic engineering bacterium and its construction method and in production xylitol.The genetic engineering bacterium includes Escherichia coli and is transferred to the expression vector of Escherichia coli, the promoter downstream of the expression vector is inserted with XR genes, the base sequence of XR genes is as shown in SEQ ID No.4, promoter is Trc promoters, 5 ' ends of XR genes carry at least one of the RBS from pET30a, and ptsG, xylA, xylB, ptsF gene in Escherichia coli and are suppressed or knock out.The present invention have selected suitable RBS and promoter by carrying out translation efficiency screening to Xylose reductase gene so that XR genes can obtain high efficient expression at 30 DEG C in genetic engineering bacterium, and be produced without inclusion body；PtsG gene removals glucose effect has been knocked out, xylA, xylB, ptsF gene has been knocked out, has blocked xylose metabolism and xylitol phosphate.

Description

A kind of genetic engineering bacterium and its construction method and the application in production xylitol

Technical field

The invention belongs to genetic engineering and biological technical field, more particularly to a kind of genetic engineering bacterium and its construction method and Application in production xylitol

Background technology

Industrial production xylitol is made mainly under high-temperature and high-pressure conditions with nickel catalysis xylose hydrogenation at present, this work Skill needs condition harsh, and easily causes pollution, so bioanalysis conversion production xylitol is increasingly valued by people.With The microorganism for preparing xylitol in fermentation method is nearly all saccharomycete, existing natural strain, also there is genetic engineering bacterium.Saccharomycete is made There is the advantage of oneself for microbial strain for xylitol production, such as higher sugared concentration is resistant to, to the suppression in hemicellulose hydrolysate Factor repellence processed is stronger, etc..But there is also unavoidable problem, be mainly reflected in：(1) it is main at present to produce xylitol Yeast be candida tropicalis, it has potential pathogenic, is not appropriate for the production of food；(2) yeast is contained in itself Xylose reductase selectivity it is poor, have higher catalytic efficiency to xylose and arabinose, so utilize hemicellulose When cellulose hydrolysate conversion production xylitol, the generation of a large amount of arabites is necessarily had, causes downstream separation difficult, increases Plus production cost；(3) when using other recombination yeasts such as saccharomyces cerevisiae production xylitol, because it does not have the xylose of selectivity Transport protein, xylose absorption rate is compared with slow so production efficiency is relatively low.

Publication No. CN101497904A Chinese patent literature discloses a kind of while producing xylitol and arabinose Method, this method fermented hemicellulose hydrolysate coproduction arabinose and xylitol using Candida, and the technique is conceived to The comprehensive utilization of resource, there is preferable application prospect, but the content of arabinose only has in number hemicellulose hydrolysate big absolutely / 10th or so of Xylose Content, cause arabinose content in fermentation mother liquor not high, and arabinose and xylitol are again A relative complex separation process is needed, the production cost of xylitol can be so added.

Escherichia coli are the most thorough as current research, the most clear bacterial strain of genetic background, and genetic engineering is built using it Bacterium has advantageous condition, and it has condition of culture simple, fast growth, and genetic manipulation is very simple compared to yeast, egg Many advantages, such as expression is high in vain, and U.S. FDA also have approved using e. coli k12 to go out bacterium germination in safety issue The recombinant bacterium of strain is used for the production of biomedical product.But Escherichia coli also have certain defect when expressing protein, i.e., Inclusion body is readily formed at relatively high temperatures.

Publication No. PCT/US2011/021277 United States Patent (USP) carries out fed-batch cultivation using colibacillus engineering strain When, 156g xylitols can be produced using 160g xyloses, concentration reaches 136g/L, and throughput rate is 1.92g/L/h；Utilizing detoxification When hemicellulose hydrolysate afterwards is fermented, 46g xylitols can be produced using 50.6g xyloses, throughput rate is 0.56g/L/ h.Although the research of document report has been the highest level that current recombination bacillus coli produces xylitol, but without abundant Play Escherichia coli fermentation produce xylitol potentiality, its concentration of substrate, production concentration and production efficiency can't and Yeast Phase Match in excellence or beauty.

Due in fermentation process, even if being produced in the early stage without inclusion body, but elapse can also produce inclusion body over time, As albumen is constantly assembled with inclusion body, inactive destination protein can be more and more.It is existing to contain Xylose reductase gene Colibacillus engineering strain, to prevent from producing substantial amounts of inclusion body in fermentation process, need to typically be sent out at a lower temperature Ferment, such as carries out shake flask fermentation at 26 DEG C or so, and ferment tank is carried out at 18 DEG C or so.But the cellar culture temperature of Escherichia coli At 37 DEG C, ferment at such lower temperatures, vitro growth rates will be reduced, while the catalytic efficiency of Xylose reductase also can By low temperature effect.Therefore fermenting and producing of the expression vector at relatively high temperatures without inclusion body generation to xylitol is built For be vital.

The content of the invention

The invention provides a kind of genetic engineering bacterium, xylitol is produced using the genetic engineering bacterium, can be increased substantially Production efficiency, reduces production cost.

A kind of genetic engineering bacterium, including Escherichia coli and be transferred to the expression vectors of Escherichia coli, the expression vector is opened Mover downstream is inserted with Xylose reductase gene, and the base sequence of the Xylose reductase gene is as shown in SEQ ID No.4.

The present invention is two codon (initiation codons in NCU08384.1 Xylose reductase gene to NCBI accession number First and third codon after son) same sense mutation is carried out, obtaining has different translation efficiencies (the translation Initiation rate) Xylose reductase gene, and therefrom have chosen the Xylose reductase gene shown in SEQ ID No.4 (its translation efficiency is 6689.5), the gene can obtain high efficient expression under 30 DEG C of higher temperature, and almost not forgive Body is produced.

If the Xylose reductase gene is expressed under the strong promoters such as T7, fermentation process, which proceeded to after the middle and later periods, still to be had More inclusion body is produced, and causes enzyme activity to reduce rapidly.Therefore in the present invention, preferably, the promoter starts for Trc Son, 5 ' ends of the Xylose reductase gene carry ribosome bind site, and the base sequence of the ribosome bind site is：

5’-AGAAGGAGATATACAT-3’。

Experiment finds that under the initiation of the ribosome bind site and Trc promoters, Xylose reductase gene is remained to 30 DEG C higher temperature under obtain high efficient expression, and almost produced without inclusion body.

Preferably, the expression vector is pTrc99a.PTrc99a comes with Trc promoters, it is not necessary to extraly by Trc Promoter is connected in expression vector.

In addition, the present invention is also transformed Escherichia coli, including：

(1) elimination of glucose effect：

Escherichia coli have a strict hierarchical relationship when using sugar, particularly in the presence of having glucose, Utilization of the Escherichia coli to other sugared such as xyloses, arabinose all can be heavily suppressed, that is, there is glucose effect.But wood , it is necessary to which glucose provides reaction required coenzyme as auxiliary substrate during sugared reductase reduction xylose generation xylitol NADPH。

To eliminate in the glucose effect of genetic engineering bacterium of the present invention, the Escherichia coli, glucose phosphotransferase base Because (ptsG) is suppressed or is knocked out.After ptsG is knocked, the utilization speed of glucose is greatly lowered genetic engineering bacterium no matter In low glucose concentrations still under high glucose concentration, xylose and glucose can be utilized simultaneously, and xylose utilizes speed Rate exceedes glucose, and glucose effect is eliminated.

(2) metabolic pathway optimizes：

There is the approach of fermenting xylose in Bacillus coli cells：Xylose generates wooden ketone by xylose isomerase (xylA) Sugar, xylulose generates X 5P in the presence of Xylulokinase (xylB), and X 5P enters phosphopentose Approach is metabolized.Phosphotransferase (ptsF) approach of fructose may also assist in the transhipment of xylitol simultaneously, make xylitol Be phosphorylated while into cell, and the xylitol of phosphorylation is to the toxic effect of cell, thus block xylose metabolism and The phosphorylation of xylitol is particularly important to engineering bacteria Efficient Conversion xylose production xylitol.

Therefore, in the Escherichia coli, at least one of xylose isomerase gene and xylulokinase gene be suppressed or Knock out；In the Escherichia coli, fructose phosphate transferase gene is suppressed or knocked out.

After xylose isomerase gene, xylulokinase gene or fructose phosphate transferase gene are knocked, genetic engineering bacterium Utilization speed to xylose is increased substantially, and significantly increases the throughput rate of xylitol；And the life brought is knocked out by ptsG Long defect has also been substantially achieved recovery.

Present invention also offers the construction method of the genetic engineering bacterium, comprise the following steps：

(1) glucose phosphotransferase gene knockout carrier, xylose isomerase gene knockout carrier, xylulose are built respectively Kinase gene knockout carrier, fructose phosphate transferase gene knockout carrier, and take the conversion of at least one of four kinds of knockout carriers big Enterobacteria competent cell, acquisition has knocked out glucose phosphotransferase gene, xylose isomerase gene, xylulokinase gene With the Escherichia coli of at least one of fructose phosphate transferase gene；

(2) 5 ' Xylose reductase genes of the end with ribosome bind site are connected under pTrc99a Trc promoters Trip, obtains expression vector；

(3) Escherichia coli for obtaining the expression vector step of converting (1), obtain the genetic engineering bacterium.

Present invention also offers the genetic engineering bacterium in the application in production xylitol.

The application includes：

The genetic engineering bacterium is seeded in nutrient solution and cultivated to OD₆₀₀For 0.6~1.0, add derivant and induced Expression, after the completion of isolated and purified from nutrient solution and obtain xylitol.

Preferably, in terms of 1L, the composition of the nutrient solution is：Glucose 30-100g/L, yeast extract 3-8g/L, albumen Peptone 5-10g/L, sodium chloride 2-10g/L, potassium dihydrogen phosphate 6-15g/L, disodium hydrogen phosphate 3-10g/L, ammonium chloride 1-5g/L, sulfuric acid Magnesium 1-3g/L, xylose 80-300g/L；

Or, the composition of the nutrient solution is：Yeast extract 3-8g/L, peptone 5-10g/L, sodium chloride 2-10g/L, phosphoric acid Potassium dihydrogen 6-15g/L, disodium hydrogen phosphate 3-10g/L, ammonium chloride 1-5g/L, magnesium sulfate 1-3g/L, half of the xylose containing 20%-50% 0.1~0.4L/L of cellulosic hydrolysate.

Preferably, in 40~120h of induced expression at 26~30 DEG C.

The genetic engineering bacterium of the present invention can both utilize the nutrient solution using xylose as main component of human configuration, can also It is main material production xylitol using hemicellulose hydrolysate.When producing xylitol using the genetic engineering bacterium, xylose is almost All be converted to xylitol, more than 0.95 gram of conversion ratio (xylitol)/gram (xylose), yield up to 1.4 grams (xylitols)/ More than liters per hour, xylose determining alcohol is up to more than 173 g/l.

Compared with prior art, beneficial effects of the present invention are：

(1) present invention to Xylose reductase gene by carrying out translation efficiency screening, and have selected suitable ribosomes knot Close site and promoter so that Xylose reductase gene can obtain efficient table under 30 DEG C of higher temperature in genetic engineering bacterium Reach, and almost produced without inclusion body；

(2) glucose phosphotransferase gene has been knocked out in genetic engineering bacterium of the invention, after ptsG genes are knocked, base Because the utilization speed of glucose is greatly lowered engineering bacteria, xylose and glucose can be utilized simultaneously, and the utilization of xylose Speed exceedes glucose, on the basis of coenzyme NADP 11 supply is ensured, it is ensured that effective conversion of xylitol；

(3) xylose isomerase gene and/or xylulokinase gene have been knocked out in genetic engineering bacterium of the invention, has blocked bacterium The metabolism of body to xylose in itself, has knocked out fructose phosphate transferase gene, the xylitol phosphate of cell interior is blocked, so that greatly Amplitude improves utilization speed of the genetic engineering bacterium to xylose, and the throughput rate of xylitol is dramatically increased, and knocks out what is brought by ptsG Growth defect has also been substantially achieved recovery.

Brief description of the drawings

Fig. 1 is the construction strategy figure of genetic engineering bacterium of the present invention；

Wherein, Expression system represent expression system, and Promoter represents promoter, and XR represents that xylose is reduced Enzyme, Transcription represents transcription (Strong, Medium, Weak represent that transcriptional level is strong, medium, weak successively), Translation represents translation, and Ribosome represents ribosomes, and Secondary structure represent (mRNA) secondary structure, RBS represents ribosome bind site, and AUG is initiation codon, and Vector represents that (Amp represents amicillin resistance base to carrier Cause, ori represents replicon, and Terminator represents terminator, and Ptrc represents Trc promoters)；Strain improvement tables Show strain improvement, Optimal plasmid represent optimal plasmid, and D-Xylose represents D- xyloses, and xylA represents xylose isomerase, D-Xylulose represents D- xyluloses, and xylB represents Xylulokinase, and D-Xylulose-5-P represents 5- phosphoric acid-xylulose, Glucose represents glucose, and ptsG represents glucose phosphotransferase, and glf represents GLUT, Glucose-6- Phosphate represents G-6-P, and Pyruvate represents pyruvic acid, and Xylitol represents xylitol, and ptsF represents fructose Phosphotransferase；Process improvement represent optimizing fermentation, and Hemicellulosic hydrolysate are represented Hemicellulose hydrolysate, Detoxification detoxifications, Bioreactor represents bioreactor, Crystallization tables Show crystallization；

Fig. 2 a are the plasmid construct schematic diagram for obtaining XR gene clonings into pTRc99a；

Fig. 2 b are the plasmid construct schematic diagram that will be obtained in the XR gene clonings with His-tag labels to pET-30a (+)；

Fig. 2 c are the plasmid construct schematic diagram that will be obtained in the XR gene clonings of different translation efficiencies to pET-30a (+)；

Fig. 2 d are the matter for obtaining the XR gene clonings carried from pET-30a (+) RBS sites into pTRc99a Kernel structure schematic diagram；

Fig. 2 e are the secondary structure for the mRNA that recombinant expression carrier pET-30a-xr is transcribed；

Fig. 2 f are the secondary structure for the mRNA that recombinant expression carrier pTRc99a-xr is transcribed；

Fig. 3 a scheme for the SDS-PAGE of different engineered strains induced expression at 18 DEG C；

Fig. 3 b scheme for the SDS-PAGE of different engineered strains induced expression at 30 DEG C；

In Fig. 3 a and Fig. 3 b, swimming lane 1 is albumen marker, and swimming lane 2 and 3 is respectively engineering bacteria HK005 expression supernatant Precipitation, swimming lane 4 and 5 is respectively engineering bacteria HK006 expression supernatant precipitation, and swimming lane 6 and 7 is respectively engineering bacteria HK007 table Up to supernatant precipitation, swimming lane 8 and 9 is respectively engineering bacteria HK008 expression supernatant precipitation；

Fig. 3 c be engineering bacteria HK004, HK009 at different temperatures induced expression SDS-PAGE figure；

Wherein, swimming lane 1 is albumen marker, and swimming lane 2 and 3 is respectively expression supernatants of the engineering bacteria HK004 at 30 DEG C Precipitation, swimming lane 4 and 5 is respectively expression supernatant precipitations of the engineering bacteria HK009 at 30 DEG C, and swimming lane 6 and 7 is respectively that HK004 exists Expression supernatant precipitation at 18 DEG C, swimming lane 8 and 9 is respectively expression supernatant precipitations of the engineering bacteria HK009 at 18 DEG C；

Fig. 4 is pTRc99a-rbs-xr6600 plasmid map；

Fig. 5 is the nucleic acid electrophoresis figure that different knock-out bacterial strains identify primer amplification；

Wherein, M is DNA Marker, and swimming lane 1 is Escherichia coli W3110 (containing ptsG), and swimming lane 2 is engineering bacteria HK101 (having knocked out ptsG), swimming lane 3 is Escherichia coli W3110 (containing xylA, xylB), and swimming lane 4 is that engineering bacteria HK301 (is knocked out XylA, xylB), swimming lane 5 is Escherichia coli W3110 (containing ptsF), and swimming lane 6 is engineering bacteria HK401 (having knocked out ptsF)；

Fig. 6 a are wild type E.coli K-12W3110 fermentation results figure；

Fig. 6 b are engineering bacteria HK102 fermentation results figure；

Fig. 6 c are engineering bacteria HK302 fermentation results figure；

Fig. 6 d are engineering bacteria HK402 fermentation results figure；

Wherein, Concentration (g/L) represents concentration (g/L), and Time (h) represents fermentation time (h)；

Fig. 7 a are the fermentation results figure that engineering bacteria HK402 produces xylitol in shaking flask using hemicellulose hydrolyzate；

Fig. 7 b are the fermentation results figure that engineering bacteria HK402 utilizes pure sugared batch fermentation in 5L fermentation tanks；

Fig. 7 c are the fermentation results figure that engineering bacteria HK402 utilizes pure sugared fed batch fermentation in 15L fermentation tanks；

Fig. 7 d are the fermentation results figure that engineering bacteria HK402 is fermented in 5L fermentation tanks using hemicellulose hydrolysate；

Wherein, Arabinose represents arabinose, and Arabinitol represents arabite, Enzyme activity (10³U/L enzyme activity (10) is represented³U/L)；

Fig. 8 is the standard curve of muscovado (glucose, xylose, arabinose, each 10g/L of xylitol)；

Wherein, peak 1 represents glucose (7.455 represent appearance time, similarly hereinafter), and peak 2 represents xylose, and peak 3 represents Arabic Sugar, peak 4 represents xylitol；

Fig. 9 is each in zymotic fluid when engineering bacteria HK402 is started using the fermentation culture induced expression of the xylose containing 100g/L The concentration of sugar；Wherein, peak 3 represents glucose, and peak 4 represents xylose.

Embodiment

The present invention is described in further detail with reference to the accompanying drawings and detailed description.

The construction strategy of the present embodiment genetic engineering bacterium is as shown in figure 1, specific building process includes：

1st, the screening of suitable for translation efficiency gene

According to NCBI accession number NCU08384.1, the fully synthetic Xylose reductase gene (XR) from Neuraspora crassa.

Using the Xylose reductase gene of above-mentioned synthesis as template, same sense mutation primer is designed, there is two grades of difference to obtain The mRNA of structure, and then screen the XR same sense mutation genes with suitable for translation efficiency.

Wherein, the sense primer of first pair of same sense mutation primer is M-XR3700-P1：

5’-GGAATTCCATATGGTACCGGCTATCAAGCTCAACTC-3 ' (underscore part is NdeI restriction enzyme sites)；

The sense primer of second pair of same sense mutation primer is M-XR5500-P1：

5’-GGAATTCCATATGGTACCGGCAATCAAGCTCAACTC-3’；

The sense primer of 3rd pair of same sense mutation primer is M-XR6600-P1：

5’-GGAATTCCATATGGTGCCTGCGATCAAGCTCAACTC-3’；

The sense primer of 4th pair of same sense mutation primer is M-XR9600-P1：

5’-GGAATTCCATATGGTTCCTGCGATCAAGCTCAACTC-3’；

The anti-sense primer of four pairs of same sense mutation primers is XR-P4：

5’-CCGGAATTCCTAACCGAAAATCCAGAGGTTCTC-3 ' (underscore part is EcoRI restriction enzyme sites)；

Four pairs of same sense mutation primers expand acquisition XR same sense mutation genes respectively：M-XR3700 (SEQ ID No.2, wherein, First codon GTT sports GTA after initiation codon, and second codon CCT sports CCG), M-XR5500 (SEQ ID No.3, wherein, first codon GTT sports GTA after initiation codon, and second codon CCT sports CCG, the Three codon GCT sport GCA), M-XR6600 (SEQ ID No.4, wherein, first codon GTT after initiation codon Be mutated GTG, the 3rd codon GCT sport GCG), M-XR9600 (SEQ ID No.5, wherein, the 3rd codon GCT dashes forward It is changed into GCG).

The Xylose reductase gene of use sense primer XR-P3 and anti-sense primer XR-P4 amplifications simultaneously (SEQ ID No.1, not Mutation), XR-P3 base sequence is：

5’-GGAATTCCATATGGTTCCTGCTATCAAGCTCAA-3’。

PCR reaction systems are 50 μ L, wherein the μ L of PrimerSTAR Max DNA Polymerase 25, upstream and downstream primer (10 μM) each 1.5 μ L, template ((50ng/ml) 1 μ L, ddH₂O 21μL；

PCR response procedures are：95 DEG C of pre-degeneration 2min；98 DEG C of denaturation 10s, Tm annealing 15s, 72 DEG C extend 5s/kb, 30 Circulation；72 DEG C of extension 5min, 4 DEG C of insulations.

Calculate the translation efficiency (being shown in Table 1) of different XR same sense mutations genes respectively using RBS Calculator v1.1.

After PCR primer is verified correctly through electrophoresis, glue reclaim purifying, and using NdeI and EcoRI to Xylose reductase gene (XR), with histidine-tagged Xylose reductase gene (XR-His-tag), M-XR3700, M-XR5500, M-XR6600, M- XR9600 distinguishes digestion with pET-30a (+) carrier, is connected after digestion with T4 ligases, respectively construction recombination plasmid；And will restructuring Plasmid converts the bacterium colony grown on competent escherichia coli cell DH5 α, picking ampicillin plate, extracts plasmid, through digestion After identification and sequencing, it will verify that correct recombinant plasmid is respectively designated as：pET-30a-xr、pET-30a-tag-xr、pET- 30a-xr3700, pET-30a-xr5500, pET-30a-xr6600, pET-30a-xr9500, BL21 (DE3) is transferred to by plasmid, Build containing corresponding recombinant plasmid genetic engineering bacterium, be respectively designated as HK003, HK004, HK005, HK006, HK007, HK008。

XR gene clonings are entered in pTrc99a, pBAD24 simultaneously, corresponding genetic engineering bacterium HK001, HK002 is built, made For control.The structure of each recombinant plasmid is as shown in Fig. 2 a, 2b, 2c, 2d, 2e, 2f.

By each genetic engineering bacterium it is activated after be inoculated in LB (5gl^-1Yeast extract, 10gl^-1Peptone, and 10gl^-1NaCl) train Support in base, cultivated at 18 DEG C, 30 DEG C cell is collected by centrifugation after the completion of 15h, culture respectively, use kaliumphosphate buffer (pH 7.4) it is resuspended, adjustment cell suspension OD₆₀₀Born of the same parents are broken after to 2.0, xylose is detected using absorbance methods of the NADPH at 340nm respectively The enzyme activity of reductase, testing result is shown in Table 1 and Fig. 3.

The enzyme activity and expressing quantity of each genetic engineering bacterium of table 1 induced expression at different temperatures

Note：a：The base sequence of each target gene, b：TIR represents translation efficiency, c：Thalline cultivates what is obtained at 30 DEG C Protein content, d：ND represents not detect, e：Genetic engineering bacterium HK007 is cultivated to 30h, f：SEQ ID No.7 are that 5 ' ends carry RBS SEQ the ID No.4, RBS of sequence base sequence are AGAAGGAGATATACAT.

Relatively low from the translation efficiency of table 1 and Fig. 3, XR gene in pTrc99a and pBAD24, target gene does not have Expression either expression quantity is very low.

When using pET-30a as expression vector, when translation efficiency is relatively low, target gene do not express either expression quantity very Low, when translation efficiency is improved, expression quantity has a certain amount of increase under low temperature (18 DEG C), but at relatively high temperatures (30 DEG C), with The increase of translation efficiency, the amount of inclusion body is also accordingly increased, particularly existed with histidine-tagged target gene There are a large amount of inclusion bodys to produce under higher temperature, inclusion body, which is produced, can be greatly reduced active destination protein；Serve as interpreter effect When rate is 6689.5, inclusion body is nearly free under genetic engineering bacterium high temperature, so it is follow-up test that M-XR 6600 is made in selection Target gene.

Also, due to pET-30a (+) carrier promoter be T7 strong promoters, when genetic engineering bacterium HK007 cultivate to During 30h (middle and later periods), still there are many inclusion bodys to produce, cause enzyme activity to reduce rapidly, it is therefore desirable to select suitable promoter.

2nd, the optimization in promoter and RBS sites

Design primer XR-P1 and XR-P2 amplification M-XR：

XR-P1：5’-CCGGAATTC(underscore part is EcoRI digestions position to ATGGTTCCTGCTATCAAGCTCAA-3 ' Point)；

XR-P2：5’-CCCAAGCTT(underscore part is HindIII digestions to CTAACCGAAAATCCAGAGGTTCTC-3 ' Site)；

PCR reaction systems response procedures are ibid.

After PCR primer is verified correctly through electrophoresis, glue reclaim purifying is cloned into carrier pTrc99a Trc promoters downstream, Recombinant vector is converted to the bacterium colony grown on competent escherichia coli cell DH5 α, picking ammonia benzyl flat board, plasmid is extracted, through digestion After identification, it will verify that correct recombinant plasmid is named as pTrc99a-xr, plasmid is transferred into BL21 (DE3) builds containing corresponding weight The genetic engineering bacterium of group plasmid is named as HK001.

Genetic engineering bacterium HK001 enzyme activity and expressing quantity is detected using above-mentioned identical method.But testing result shows Show, M-XR is not expressed.

Therefore, using pET-30a-xr6600 as template, further design primer XR-RBS-P1 and XR-RBS-P2, is expanded Increase：

XR-RBS-P1：5’-CCGGAATTCCCCCTCTAGAAATAATTTTG-3’；

XR-RBS-P2：5’-TGGAAGCTTCTAACCGAAAATCCAGAG-3’；

PCR reaction systems response procedures are ibid.

After PCR primer is verified correctly through electrophoresis, glue reclaim purifying is cloned into carrier pTrc99a Trc promoters downstream, Recombinant vector is converted to the bacterium colony grown on E. coli competent DH5 α, picking ammonia benzyl flat board, plasmid is extracted, is identified through digestion Afterwards, it will verify that correct recombinant plasmid is named as pTrc99a-rbs-xr6600 (plasmid map is shown in Fig. 4), plasmid be transferred to W3110 builds the genetic engineering bacterium containing corresponding recombinant plasmid and is named as HK009.

As can be seen from Table 1, using the RBS sites from carrier pET-30a (+), M-XR 6600 is obtained on pTrc99a Effective expression was obtained, induced expression incomplete at low temperature obtains higher expression at high temperature, and without inclusion body production It is raw so that genetic engineering bacterium HK009 is more suitable for fermenting at relatively high temperatures.

3rd, the knockout of Host Strains metabolic pathway key gene

Gene knockout basic step knocks out system (Datsenko and Wanner, 2010) according to the RED/ET of standard and entered OK, it is specific as follows：

(1) knockout of ptsG genes

1. the clone with ptsG homology arm Cm genes

Using plasmid pKD3 as template, using primer Del-ptsG-P1 and Del-ptsG-P2, (this upstream and downstream primer 5 ' end contains Have the homology arm of 50bp ptsG upstream and downstream) expanded, obtain the chloramphenicol resistance gene (Cm) that FRT sites are contained at two ends：

Del-ptsG-P1：

5’-ATGTTTAAGAATGCATTTGCTAACCTGCAAAAGGTCGGTAAATCGCTGATGGAGCGATTGTGTAGG CTGGA-3’；

Del-ptsG-P2：

5’-TTAGTGGTTACGGATGTACTCATCCATCTCGGTTTTCAGGTTATCGGATTTACTTAACGGCTGACA TGGGA-3’；

PCR reaction systems response procedures are ibid.

Amplified production carries out DNA gel electrophoretic analysis, and gel extraction carries the nucleic acid fragment of correct target stripe.

2. the induction of Red recombination systems and the preparation of competent cell

The Escherichia coli W3110 for having pKD46 will be converted, in 30 DEG C of overnight incubations；Next day is with 1：50 are seeded to 100mLLB trainings Support base (ampicillin concentration is 50mg/mL), 30 DEG C of cultures to OD₆₀₀When=0.25, L-arabinose is added to 5mmol/L, Induce 1h (OD₆₀₀No more than 0.6), give full expression to tri- albumen of Exo, Bet and Gam on pKD46.Precooling on ice 10min, 4000r/min, 4 DEG C of centrifugation 10min, abandon culture medium；With 10% glycerine centrifuge washing of precooling 3 times, 100 times of concentration into 1mL competent cell, often μ L of pipe 100.

3. electricity conversion

Obtained band ptsG homology arm Cm genetic fragments about 500ng addition competent cells will be cloned, mix, be transferred to In 0.2cm electric shock cups, electricity conversion is made with Bio-Rad electroporations.Electric shock condition：200 Ω, 25 μ F, shock voltage 2.5kV, electric shock Time is 4~5ms, 1mL LB fluid nutrient mediums is rapidly added after electric shock, 150r/min, 37 DEG C of culture 1h are applied to chlorine mould afterwards Plain flat board (chloramphenicol concentration is 34 μ g/mL)；The Chloramphenicol-resistant clones grown are identified after culture 12h with PCR methods.

4. FLP site specific recombinations

PCP20 is transferred to after Chloramphenicol-resistant clones, 30 DEG C of culture 8h, 42 DEG C are brought up to overnight, thermal induction FLP recombinases Expression, plasmid is also gradually lost.Bacterium solution is dipped with oese plate is drawn on antibiotic-free culture medium, chosen the single bacterium drop point grown and arrive On chlorampenicol resistant flat board and on the corresponding flat board without antibiotic, what is do not grown is that chloramphenicol resistance gene is heavy by FLP Group enzyme is deleted.Reflected with identification primer ptsG-check1 and the ptsG-check2 clone for making the disappearance of PCR chloramphenicol resistances Determine (see Fig. 5).

ptsG-check1：5’-CACCCATACTCAGGAGCACTCTCA-3’；

ptsG-check2：5’-CCTTAGTCTCCCCAACGTCTTACG-3’；

PCR reaction systems and response procedures are ibid.It will identify that the clone designation that correct ptsG has been knocked is HK101。

(2) knockout of xylA and xylB genes

1. the clone of the Cm genes with xylA upstreams homology arm and xylB downstreams homology arm

Using W3110 genomes as template, expanded using primer Del-xylA-P1 and Del-xylA-P2, obtain xylA The upstream homology arm of gene：

Del-xylA-P1：5’-GGTCACCAACGACTTTAATTTTTCC-3’；

Del-xylA-P2：

5’-GACGTGTAATGCTGCAATCTATTGAACTCCATAATCAGGTAATGCC-3’；

PCR reaction systems and response procedures are ibid.

Using plasmid pKD3 as template, expanded using primer xylAB-FRT-P1 and xylAB-FRT-P2, obtain Cm bases Cause：

xylAB-FRT-P1：

5’-ACCTGATTATGGAGTTCAATAGATTGCAGCATTACACGTCTTGA-3’；

xylAB-FRT-P2：

5’-GGTCAGGCAGGGGATAACGTGCAATTTTCAGTGACACAGGAACA-3’；

PCR reaction systems and response procedures are ibid.

Using W3110 genomes as template, expanded using primer Del-xylB-P1 and Del-xylB-P2, obtain xylB The downstream homology arm of gene：

Del-xylB-P1：

5’-CCTGTGTCACTGAAAATTGCACGTTATCCCCTGCCTGACC-3’；

Del-xylB-P2：5’-GCACCGCTACTGCACCAAAC-3’；

PCR reaction systems and response procedures are ibid.

Downstream homology arm using the upstream homology arm, Cm genes, xylB genes of xylA genes utilizes primer Del- as template XylA-P1, Del-xylB-P2 carry out over-lap PCR, obtain the Cm genes with xylA upstreams homology arm and xylB downstreams homology arm；

PCR reaction systems and response procedures are ibid.

The Escherichia coli HK101 for having pKD46 will be converted, in 30 DEG C of overnight incubations；Next day is with 1：50 are seeded to 100mLLB trainings Support base (ampicillin concentration is 50mg/mL), 30 DEG C of cultures to OD₆₀₀When=0.25, L-arabinose is added to 5mmol/L, Induce 1h (OD₆₀₀No more than 0.6), give full expression to tri- albumen of Exo, Bet and Gam on pKD46.Precooling on ice 10min, 4000r/min, 4 DEG C of centrifugation 10min, abandon culture medium；With 10% glycerine centrifuge washing of precooling 3 times, 100 times of concentration into 1mL competent cell, often μ L of pipe 100.

3. -4. utilize with " in the knockout of (1) ptsG genes 3. -4. " identical method, acquisition knocked out xylA, xylB and The clone that chlorampenicol resistant disappears, is identified (see Fig. 5) using primer Del-xylA-P1 and Del-xylB-P2.PCR reacts System and response procedures are ibid.It will identify that the clone designation that correct ptsG has been knocked is HK301.

(3) knockout of ptsF genes

Using W3110 genomes as template, expanded, obtained using primer Del-ptsF-up-P1 and Del-ptsF-up-P2 Obtain the upstream homology arm of ptsF genes：

Del-ptsF-up-P1：5’-TGAATAAATTCACCGTGCTGTGC-3’；

Del-ptsF-up-P2：

5’-GACGTGTAATGCTGCAATCTTAAAAGGTGTGTTACAGGGCAGAAA-3’；

PCR reaction systems and response procedures are ibid.

Using plasmid pKD3 as template, expanded using primer ptsF-FRT-P1 and ptsF-FRT-P2, obtain Cm genes：

ptsF-FRT-P1：

5’-GCCCTGTAACACACCTTTTAAGATTGCAGCATTACACGTCTTGA-3’；

ptsF-FRT-P2：

5’-CTGACAGCAGGAGAGGCATAGCAATTTTCAGTGACACAGGAACA-3’；

PCR reaction systems and response procedures are ibid.

Using W3110 genomes as template, expanded, obtained using primer Del-ptsF-do-P1 and Del-ptsF-do-P2 Obtain the downstream homology arm of ptsF genes：

Del-ptsF-do-P1：

5’-CCTGTGTCACTGAAAATTGCTATGCCTCTCCTGCTGTCAGTTAAAA-3’；

Del-ptsF-do-P2：5’-CGTGGCCAAAGTATTAAAAGACCTG-3’；

The Escherichia coli HK301 for having pKD46 will be converted, in 30 DEG C of overnight incubations；Next day is with 1：50 are seeded to 100mLLB trainings Support base (ampicillin concentration is 50mg/mL), 30 DEG C of cultures to OD₆₀₀When=0.25, L-arabinose is added to 5mmol/L, Induce 1h (OD₆₀₀No more than 0.6), give full expression to tri- albumen of Exo, Bet and Gam on pKD46.Precooling on ice 10min, 4000r/min, 4 DEG C of centrifugation 10min, abandon culture medium；With 10% glycerine centrifuge washing of precooling 3 times, 100 times of concentration into 1mL competent cell, often μ L of pipe 100.

3. -4. utilize with " in the knockout of (1) ptsG genes 3. -4. " identical method, acquisition knocked out xylA, xylB and The clone that chlorampenicol resistant disappears, is identified (see Fig. 5) using primer Del-ptsF-up-P1 and Del-ptsF-do-P2. PCR reaction systems and response procedures are ibid.It will identify that the clone designation that correct ptsG has been knocked is HK401.

3rd, the structure of genetic engineering bacterium

By recombinant expression carrier pTrc99a-rbs-xr6600 respectively electricity conversion competent escherichia coli cell W3110, The bacterium colony grown on HK101, HK301, HK401, picking ampicillin plate, is extracted after plasmid, sequencing, and checking is correct Positive colony names engineering bacteria HK009, HK102, HK302, HK402 respectively.

4th, the detection of expression of each engineering bacteria

Engineering bacteria HK009, HK102, HK302, HK402 are inoculated in improvement M9 culture medium (1L culture mediums overnight by 2% In the Na containing 4~6g₂HPO₄, 2~5g KH₂PO₄, 1~2g NH₄Cl, 1~5g NaCl, 1~5mMMgSO₄, 1~5mM CaCl₂, 2~10g/L yeast extracts) in, in culture at 30 DEG C.The fermentation character of each engineering bacteria is investigated, result such as Fig. 6 a, 6b, 6c, 6d is investigated It is shown.

From Fig. 6 a, engineering bacteria HK009 Host Strains are wild type E.coli K-12W3110, and it is during the fermentation Show obvious glucose effect；

From Fig. 6 b, the engineering bacteria HK102 of glucose phosphotransferase has been knocked out, although utilize xylose and glucose Speed is all also slow, but can utilize xylose and glucose simultaneously；

From Fig. 6 c, the engineering bacteria HK302 of xylose isomerase and Xylulokinase is further knocked out, it is to xylose The throughput rate of wear rate and xylitol is all significantly improved；

From Fig. 6 d, the engineering bacteria HK402 of fructose phosphate transferase is further knocked out, its wear rate to xylose All it is further improved with the throughput rate of xylitol, the wear rate of xylose is up to 0.598g/L/h, xylitol Throughput rate is up to 0.61g/L/h.

The utilizing works bacterium HK402 of embodiment 2 produces the example of xylitol

1st, engineering bacteria produces xylitol using corncob hemicellulose hydrolysate

In order to which can the engineering bacteria that verify structure be shaken using hemicellulose hydrolysis production xylitol with engineering bacteria HK402 Bottle fermentation (250ml, liquid amount is 50ml).

(1) engineering bacteria HK402 is inoculated with seed culture medium overnight by 2%, in cultivating 8h at 30 DEG C, obtains seed Liquid；

The formula of seed culture medium and fermentation medium is：In 1L culture mediums, containing 4~6g Na₂HPO₄, 2~5g KH₂PO₄, 1~2g NH₄Cl, 1~5g NaCl, 1~5mM MgSO₄, 1~5mM CaCl₂, 2~10g/L yeast extract.

(2) it is 20%-50% to be carried out being concentrated into Xylose Content with Rotary Evaporators by hemicellulose hydrolysate, after concentration Hemicellulose hydrolysate sterilizing after add in sterilized fermentation medium, it is 2% to make in fermentation medium xylose end content, Glucose is added again to its final concentration of 1%, acquisition fermentation culture；

(3) seed liquor is seeded in fermentation culture by 2%, in being cultivated at 30 DEG C to OD₆₀₀During for 0.6-1.0, addition 0.05~0.5mM IPTG, in induced expression at 30 DEG C.

Fermentation characters of the engineering bacteria HK402 in corncob hemicellulose hydrolysate is investigated, Fig. 7 a are seen.

From Fig. 7 a, engineering bacteria HK402 effectively can produce xylitol, and cell growth using hemicellulose hydrolysate It is not suppressed.

2nd, recombination engineering utilizes pure sugared batch fermentation

The formula of seed culture medium and fermentation medium is：In 1L culture mediums, containing 4~6g Na₂HPO₄, 2~5g KH₂PO₄, 1~2g NH₄Cl, 1~5g NaCl, 1~5mM MgSO₄, 1~5mM CaCl₂, 10~20g/L peptones, 2~8g/L Yeast extract.

(2) seed liquor is seeded in the 5L fermentation tanks equipped with 2L fermentation mediums by 10%, in cultivated at 30 DEG C to OD₆₀₀For 5~15 when, xylose is added into zymotic fluid to final concentration of 100g/L, addition glucose to final concentration of 50g/L, together 0.05~0.5mM of Shi Tianjia IPTG, in induced expression at 30 DEG C.

Muscovado solution (glucose, xylose, arabinose, each 10g/L of xylitol) is prepared, using Dionex UltiMate3000 efficient liquid phase systems, Corona Charged Aerosol detectors, Aminex HPX-87C (7.8mm × 300mm) sugared post, mobile phase is pure water (0.8mL min^-1, 76 DEG C) and obtain standard curve (see Fig. 8)；When induced expression starts, adopt With the content of each main matter in same method detection zymotic fluid, testing result is shown in Fig. 9.

Fermentation characters of the engineering bacteria HK402 in pure sugared zymotic fluid is investigated, Fig. 7 b are seen.

From Fig. 7 b, engineering bacteria HK402 can quick Bioconversion of D-xylose To Produce Xylitol, in zymotic fluid, xylitol is final Concentration can reach 118g/L, and production efficiency is 1.74g/L, while higher Xylose reductase enzyme activity can be obtained, up to 3.86 ten thousand U/L zymotic fluids.

3rd, recombination engineering utilizes pure sugared fed batch fermentation

(1)-(2) same to part 2 " engineering bacteria utilizes pure sugared batch fermentation " (fermentation is carried out in 15L fermentation tanks), is luring It is respectively 80g/L and 40g/L that expression, which is led, to xylose and glucose to final concentration is added during 37h in addition, investigates engineering bacteria HK402's Fermentation character, is shown in Fig. 7 c.

From Fig. 7 c, by the fermentation of 110 hours, engineering bacteria HK402 can consume all sugar, xylitol in zymotic fluid Ultimate density reaches 172.4g/L.

4th, engineering bacteria utilizes hemicellulose hydrolysate batch fermentation

(1)-(2) same to part 2 " engineering bacteria utilize pure sugared batch fermentation ", but step (2) induced expression added when starting Glucose and the hemicellulose hydrolysate containing 43% xylose, xylose is final concentration of in zymotic fluid when starting induced expression 143.79g/L, the final concentration of 80g/L of glucose.

Engineering bacteria HK402 fermentation character is investigated, Fig. 7 d are seen.

From Fig. 7 d, in 5L fermentation tanks, engineering bacteria HK402 equally can effectively convert the wood in hemicellulose hydrolysate Sugar production xylitol, xylose determining alcohol reaches 150g/L, and production efficiency reaches 1.4g/L/h, and this is currently with Bacterial Transformation half The maximum concentration and highest production efficiency of cellulosic hydrolysate production xylitol.

Claims

1. a kind of genetic engineering bacterium, including Escherichia coli and the expression vector for being transferred to Escherichia coli, it is characterised in that the expression The promoter downstream of carrier is inserted with Xylose reductase gene, the base sequence such as SEQ ID of the Xylose reductase gene Shown in No.4, in the Escherichia coli, fructose phosphate transferase gene is suppressed or knocked out.

2. genetic engineering bacterium as claimed in claim 1, it is characterised in that the promoter is Trc promoters, and the xylose is also 5 ' ends of nitroreductase gene carry ribosome bind site, and the base sequence of the ribosome bind site is：

5’-AGAAGGAGATATACAT-3’。

3. genetic engineering bacterium as claimed in claim 1, it is characterised in that the expression vector is pTrc99a.

4. genetic engineering bacterium as claimed in claim 1, it is characterised in that in the Escherichia coli, glucose phosphotransferase Gene is suppressed or knocked out.

5. genetic engineering bacterium as claimed in claim 1, it is characterised in that in the Escherichia coli, xylose isomerase gene and At least one of xylulokinase gene is suppressed or knocked out.

6. the construction method of genetic engineering bacterium as described in Claims 1 to 5 is any, it is characterised in that comprise the following steps：

(1) glucose phosphotransferase gene knockout carrier, xylose isomerase gene knockout carrier, Xylulokinase are built respectively Gene knockout carrier, fructose phosphate transferase gene knockout carrier, and take in four kinds of knockout carriers at least fructose phosphate transferase Gene knockout carrier one kind conversion competent escherichia coli cell, obtains the large intestine bar at least knocking out fructose phosphate transferase gene Bacterium；

(2) 5 ' Xylose reductase genes of the end with ribosome bind site are connected to pTrc99a Trc promoters downstream, obtained Obtain expression vector；

7. application of the genetic engineering bacterium in production xylitol as described in Claims 1 to 5 is any.

8. application as claimed in claim 7, it is characterised in that including：

The genetic engineering bacterium is seeded in nutrient solution and cultivated to OD₆₀₀For 0.6~1.0, addition derivant progress induction table Reach, after the completion of isolated and purified from nutrient solution and obtain xylitol.

9. application as claimed in claim 8, it is characterised in that in 40~120h of induced expression at 26~30 DEG C.