CN110724728B - Preparation method of circular DNA - Google Patents
Preparation method of circular DNA Download PDFInfo
- Publication number
- CN110724728B CN110724728B CN201910968892.7A CN201910968892A CN110724728B CN 110724728 B CN110724728 B CN 110724728B CN 201910968892 A CN201910968892 A CN 201910968892A CN 110724728 B CN110724728 B CN 110724728B
- Authority
- CN
- China
- Prior art keywords
- reaction
- circular dna
- annealing
- product
- stranded
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/30—Nucleotides
- C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- General Chemical & Material Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The present disclosure provides a preparation method of circular DNA, which specifically includes the steps of: (1) Firstly, synthesizing a single-stranded DNA molecule needing to be looped, and then, carrying out phosphorylation modification on the 5' end of the synthesized single-stranded DNA molecule; (2) Then designing a synthetic guide RNA molecule, wherein the nucleotide sequence of the guide RNA molecule is complementarily paired with the nucleotides at the two ends of the synthetic single-stranded DNA molecule; (3) Annealing the synthesized single-stranded DNA molecules and the guide RNA molecules to obtain an annealed product; (4) Carrying out a connection reaction on the obtained annealing product by using ligase to obtain a connection reaction product; (5) Digesting the non-looped linear nucleotide in the ligation product by using exonuclease; (6) finally recovering the synthesized single-stranded circular DNA molecule. The preparation method is simple and easy to operate, and the cost of materials used in the method is low, so that the cost for preparing the circular DNA is reduced.
Description
Technical Field
The present disclosure relates to the technical field of nucleotides, and in particular relates to a method for preparing circular DNA.
Background
Rolling circle replication (Loop-mediated isothermal amplification, loop-mediated isothermal amplification-LAMP) is a method in which isothermal amplification enzymes with strand displacement capability perform nucleic acid amplification using circular DNA molecules as templates. The method can carry out sequence specific amplification on a trace nucleic acid template compared with PCR (polymerase chain reaction), and is different in that the rolling circle replication process can complete amplification reaction at constant temperature, so that a PCR instrument with accurate temperature control is not needed, the method is a simple and economical nucleic acid amplification method, and single-chain annular DNA molecules with different sequences can generate tandem repeat sequences with different lengths through rolling circle replication. There are a large number of random repeats in natural genes and proteins, which constitute specific motifs, which can dramatically increase the physiological specificity and activity of the biomacromolecule of the candidate gene. Such modules are widely distributed among nucleic acid sequences such as promoters/enhancers to facilitate recognition of target sequences by trans-acting factors, resulting in additive and/or synergistic effects. By constructing a large library of random repeats, it is one of the important strategies to study structure-function relationships in vivo or in vitro. Random repeat sequences of varying length and number of repeats can be prepared by rolling circle replication by preparing single stranded circular DNA molecules.
The single-stranded circular DNA templates commonly used at present mainly comprise single-stranded circular DNA M13mp18 (7249 bp) of viruses and single-stranded circular DNA molecules (sscNA, single strand circular DNA) generated by enzyme ligation reaction, the length of the sscNA molecules is generally 34-120bp, but the single-stranded circular virus DNA M13mp18 is used, the culture process of the viruses is slow and the cost is high, thus the price of the M13mp18 is high, and the Molecular weight (Molecular weight) of the single-stranded M13mp18DNA is large, if the concentration of a substrate is too high, the rolling circle replication reaction is inhibited. In the existing preparation method for producing single-stranded circular DNA molecules by enzyme ligation, DNA (guide DNA) is mostly used as a guide molecule to complete the connection of target sequences, and the method can lead to trace guide DNA molecules remained in the final product, so that subsequent DNA polymerase uses the trace guide DNA molecules as primers to carry out rolling circle replication, thereby causing interference to the analysis of results.
Disclosure of Invention
The purpose of the present disclosure is to provide a method for preparing circular DNA, so as to achieve the purpose of reducing cost.
In order to achieve the above purpose, the technical scheme is as follows:
a preparation method of circular DNA comprises the following specific steps:
(1) Firstly, synthesizing a single-stranded DNA molecule needing to be looped, and then, carrying out phosphorylation modification on the 5' end of the synthesized single-stranded DNA molecule;
(2) Then designing a synthetic guide RNA molecule, wherein the nucleotide sequence of the guide RNA molecule is complementarily paired with the nucleotides at the two ends of the synthetic single-stranded DNA molecule;
(3) Annealing the synthesized single-stranded DNA molecules and the guide RNA molecules to obtain an annealed product;
(4) Carrying out a connection reaction on the obtained annealing product by using ligase to obtain a connection reaction product;
(5) Digesting the non-looped linear nucleotide in the ligation product by using exonuclease;
(6) Finally, the synthesized single-stranded circular DNA molecules are recovered.
The reaction conditions of the annealing in the step (3) are as follows: firstly, the reaction is carried out for 5min at 85 ℃ and then the reaction is carried out for 3h at 25 ℃.
The annealing reaction system in the step (3) is a synthesized single-stranded DNA molecule: guide RNA molecule: annealing buffer: the volume ratio of the RNase-free water is 1:2:1:7.
the annealing buffer comprises: 100mM Tris-HCl, 10mM EDTA, and 1M NaCl, the pH of which is 7.5.
The conditions of the step (4) connection reaction are as follows: first, the reaction is carried out at 16℃for 16h and then at 65℃for 20min.
The system of the connection reaction in the step (4) is a connection buffer solution: annealing product: ligase: h 2 The volume ratio of O is 3:1:2.5:30.
the ligase is SplintR ligase or T4 DNA ligase.
The Exonuclease in the step (5) is a mixture of Exonuclease I Exonuclease and T7 Exonuclease.
The reaction system of exonuclease digestion is a ligation product: exonuclease I Exonuclease: the volume ratio of T7 Exoneclease Exonuclease is 7:1:2.
the conditions of the exonuclease digestion in the step (5) are as follows: the reaction was carried out at 25℃for 16h.
The beneficial effects of the present disclosure are: the preparation method of the circular DNA is simple and easy to operate, and the method does not need practical single-stranded circular virus DNA M13mp18, and the rest materials are low in cost, so that the cost for preparing the circular DNA is reduced. Meanwhile, the preparation method of the circular DNA breaks through the limitation of a template sequence, exogenous DNA is not required to be added in the preparation process, RNA molecules synthesized at the tail end of a single-stranded DNA molecule which is formed into a ring according to the requirement are added, interference is reduced, exonuclease is utilized to digest non-ring linear nucleotides, the generation of byproducts is further reduced, the yield of the single-stranded circular DNA is greatly increased, and the single-stranded circular DNA prepared by the preparation method of the circular DNA can be used for detecting whether DNA polymerase has the strand displacement capability or not.
Drawings
FIG. 1 is a gel electrophoresis of the annealed product, the ligated product, and the exonuclease digested product of example 1.
FIG. 2 is a gel electrophoresis chart of the rolling circle replication product of example 2.
FIG. 3 is a gel electrophoresis chart of the product at various extension reaction times of example 3.
FIG. 4 is a graph showing the strand displacement ability of DNA polymerase of example 4.
Detailed Description
The following steps are merely illustrative of the technical solution of the present disclosure, and are not limiting thereof; although the present disclosure has been described in detail with reference to the foregoing steps, one of ordinary skill in the art will appreciate that: the technical scheme recorded in each step can be modified or part or all of the technical characteristics can be replaced equivalently; such modifications and substitutions do not depart from the essence of the corresponding technical solutions from the scope of the technical solutions of the steps of the present disclosure.
Example 1
A preparation method of circular DNA comprises the following specific operation steps:
(1) Firstly, synthesizing a single-stranded DNA molecule needing to form a loop, and then, carrying out phosphorylation modification on the 5' -end of the synthesized single-stranded DNA molecule, wherein the nucleotide sequence of the single-stranded DNA molecule is SEQ ID NO.1:5' -pATTGGTCTACATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCCTACGGATTGACTAGC;
(2) Then designing a synthetic guide RNA molecule, wherein the nucleotide sequence of the guide RNA molecule is complementary paired with two ends of the synthetic single-stranded DNA molecule, and the nucleotide sequence of the guide RNA molecule is SEQ ID NO.2:5'-UAGACCAAU GCAAUCCGUA-3';
(3) Annealing the synthesized single-stranded DNA molecules and guide RNA molecules to obtain annealed products, wherein the annealing reaction system is shown in Table 1,
TABLE 1 annealing reaction System
| Reagent(s) | System of |
| DNA(100uM) | 1uL |
| RNA(100uM) | |
| 10×buffer | 1uL |
| Rnase-free H 2 O | To a total volume of 10ul |
Wherein the 10x annealing buffer comprises: 100mM Tris-HCl (pH 7.5), 10mM EDTA and 1M NaCl, the annealing reaction conditions were: firstly, reacting at 85 ℃ for 5min, then reacting at 25 ℃ for 3h, and carrying out 15% polyacrylamide gel electrophoresis after the reaction is finished, wherein the result is shown in lane 1 of FIG. 1A;
(4) The obtained annealed product was subjected to ligation reaction using a SplingR ligase to obtain a ligation reaction product, wherein the ligation reaction system is shown in Table 2,
TABLE 2 ligation reaction System
Wherein the conditions of the ligation reaction are: 16 ℃ for 16h; terminating the reaction at 65 ℃ for 20min, and performing 15% polyacrylamide gel electrophoresis after the reaction is finished, wherein the result is shown in lane 2 of FIG. 1A;
(5) Digesting the non-cyclic linear nucleotide in the ligation product by using exonuclease, wherein the reaction system of exonuclease digestion is shown in Table 3,
TABLE 3 reaction System for exonuclease digestion
| Reagent(s) | Volume of |
| Ligation reaction products | 7uL |
| Exonuclease I | 1uL |
| T7 gene 6exonuclease | 2ul |
Wherein the reaction conditions are as follows: after the reaction is completed, 15% polyacrylamide gel electrophoresis is performed to detect whether the target product and the linear molecules are completely digested, and the result is shown in FIG. 1B, so that the linear molecules can be seen to be completely digested;
(6) Finally, NEB Monorch is utilized TM PCR&The DNA clearup Kit recovers the synthesized single-stranded circular DNA molecule.
Example 2
Rolling circle replication experiments were performed using the single-stranded circular DNA molecules (sscNA) prepared in example 1, which were performed as follows: first, designing a primer sequence, wherein the primer DNA sequence is SEQ ID NO.3:5'-aTAGACCAAT GCAATCCGTAc-3'; then annealing reaction is carried out, and finally extension reaction is carried out by selecting Phi29DNA polymerase.
The system of the annealing reaction is shown in table 4:
TABLE 4 Rolling circle replication annealing reaction System
Wherein the 10x annealing buffer comprises: 100mM Tris-HCl (pH 7.5), 10mM EDTA and 1M NaCl, annealing reaction conditions were: 85 ℃ for 5min;25 ℃ for 3h.
A system in which an extension reaction was performed using Phi29DNA polymerase (Phi 29 DNAP), and then a control group was set, the system being as shown in table 5:
TABLE 5 Rolling circle replication extension reaction System
Wherein Phi29DNA polymerase, available from NEB under the accession number M0269S; the extension reaction conditions were 30℃for 30min.
After the reaction, detecting the extension product by adopting alkaline agarose gel electrophoresis, wherein the conditions of the alkaline agarose gel electrophoresis are 3V/CM for 3h. The buffer for the alkaline agarose gel electrophoresis is: 10x alkaline agarose electrophoresis buffer or 6 x alkaline gel loading buffer, wherein the 10x alkaline agarose electrophoresis buffer comprises: 500mM NaOH and 10mM EDTA; the 6 x alkaline gel loading buffer comprises: 300mM NaOH,6mM EDTA,18% (m/V) Ficoll-400 (Pharmacia), 0.15% (m/V) bromocresol green and 0.25% (m/V) xylene cyanogen. After electrophoresis, the agarose gel is soaked in SYBR Gold dye liquor, and slowly and horizontally oscillated for about 20min; and then detected using an Azure Biosystems imager. As a result, as shown in FIG. 2, the control group (lane 1) had no extension product, while the experimental group (lane 2) produced an extension product of more than 48.5kbp, demonstrating that the DNA prepared in example 1 was circular DNA.
Example 3
The single-stranded circular DNA molecules prepared in example 1 are used as templates to generate serial repeated sequences with different sizes, different extension reaction times (0, 5, 10, 20 and 30 min) are set according to the rolling circle replication method in example 2, and serial repeated sequences with different lengths and concentrations can be generated, wherein the annealing reaction system is shown in table 4 in example 2, and the annealing reaction conditions are as follows: 85 ℃ for 5min;25 ℃ for 3h; the system of the extension reaction is the experimental group system shown in table 5 in example 2, and the results are shown in fig. 3, wherein the reaction time in lanes 3-7 is 0, 5, 10, 20 and 30min, respectively, and it can be seen that the length and concentration of the extension product are continuously increased along with the extension time.
Example 4
Using the single-stranded circular DNA molecule prepared in example 1 as a template, it was possible to examine whether the DNA polymerase had strand displacement ability or not by the rolling circle replication method in example 2 based on the polymerization ability of the DNA polymerase, wherein the annealing reaction system was as shown in Table 4 of example 2, and the annealing reaction conditions were: 85 ℃ for 5min;25 ℃ for 3h; wherein the extension reaction system is as in Table 6:
TABLE 6 extension reaction System for detecting strand displacement ability of DNA polymerase
Wherein Phi29DNA polymerase, available from NEB under the accession number M0269S; the extension reaction conditions were 30℃for 30min.
The results of gel electrophoresis of the products produced by the reaction system are shown in FIG. 4, wherein lane 1 is a blank group without adding DNA polymerase, lane 2 is a Phi29DNA polymerase extension product, lane 3 is E.coli DNA Pol I, large (Klenow) fragment, and it can be seen from FIG. 4 that DNA polymerase with strand displacement capability can perform rolling circle replication by using circular DNA molecules to generate Large fragment single-stranded DNA products; the DNA polymerase without strand displacement capability cannot generate corresponding products, so that the method of using single-stranded circular DNA molecules as templates and the polymerization capability of the DNA polymerase can be used for rapidly and simply identifying whether the unknown DNA polymerase has strand displacement capability.
SEQUENCE LISTING
<110> Shenzhen Qinghua university institute; an Xuyuan Biotechnology (Shenzhen) Co., ltd
<120> method for producing circular DNA
<130> 2019.10.12
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 69
<212> DNA
<213> Synthesis
<400> 1
attggtctac atgcatgcat gcatgcatgc atgcatgcat gcatgcatgc atgcatgcct 60
acggattgc 69
<210> 2
<211> 19
<212> RNA
<213> Synthesis
<400> 2
uagaccaaug caauccgua 19
<210> 3
<211> 21
<212> DNA
<213> Synthesis
<400> 3
atagaccaat gcaatccgta c 21
Claims (8)
1. The preparation method of the circular DNA is characterized by comprising the following specific steps of:
(1) Firstly, synthesizing a single-stranded DNA molecule needing to be looped, and then, carrying out phosphorylation modification on the 5' end of the synthesized single-stranded DNA molecule;
(2) Then designing a synthetic guide RNA molecule, wherein the nucleotide sequence of the guide RNA molecule is complementarily paired with the nucleotides at the two ends of the synthetic single-stranded DNA molecule;
(3) Annealing the synthesized single-stranded DNA molecules and the guide RNA molecules to obtain an annealed product;
(4) Carrying out a ligation reaction on the obtained annealed product by utilizing SplingR ligase or T4 DNA ligase to obtain a ligation product;
(5) Digesting the non-circular linear nucleotides in the ligation product using a mixture of exoenzyme I and T7 exoenzyme;
(6) Finally, the synthesized single-stranded circular DNA molecules are recovered.
2. The method for producing circular DNA according to claim 1, wherein the annealing reaction conditions in the step (3) are: firstly, the reaction is carried out for 5min at 85 ℃ and then the reaction is carried out for 3h at 25 ℃.
3. The method for producing circular DNA according to claim 1, wherein the annealing reaction system in the step (3) is a synthetic single-stranded DNA molecule: guide RNA molecule: annealing buffer: the volume ratio of the RNase-free water is 1:2:1:7.
4. the method for producing circular DNA according to claim 3, wherein the annealing buffer comprises: 100mM Tris-HCl, 10mM EDTA, and 1M NaCl, the pH of which is 7.5.
5. The method for producing circular DNA according to claim 1, wherein the conditions for the ligation reaction in the step (4) are as follows: first, the reaction is carried out at 16℃for 16h and then at 65℃for 20min.
6. The method of claim 1, wherein the ligation reaction system in step (4) is a ligation buffer: annealing product: ligase: h 2 The volume ratio of O is 3:1:2.5:30.
7. the method for producing circular DNA according to claim 1, wherein the reaction system of the exonuclease digestion in the step (5) is a ligation product: exonuclease I Exonuclease: the volume ratio of T7 Exoneclease Exonuclease is 7:1:2.
8. the method for producing circular DNA according to claim 1, wherein the conditions for exonuclease digestion in step (5) are: the reaction was carried out at 25℃for 16h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910968892.7A CN110724728B (en) | 2019-10-12 | 2019-10-12 | Preparation method of circular DNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910968892.7A CN110724728B (en) | 2019-10-12 | 2019-10-12 | Preparation method of circular DNA |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110724728A CN110724728A (en) | 2020-01-24 |
| CN110724728B true CN110724728B (en) | 2023-06-06 |
Family
ID=69220095
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910968892.7A Active CN110724728B (en) | 2019-10-12 | 2019-10-12 | Preparation method of circular DNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110724728B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111321143B (en) * | 2020-02-16 | 2021-09-17 | 中国海洋大学 | Method for preparing circular RNA |
| CN111793619B (en) * | 2020-06-04 | 2022-01-07 | 中国海洋大学 | Preparation method of single-stranded circular DNA |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010094040A1 (en) * | 2009-02-16 | 2010-08-19 | Epicentre Technologies Corporation | Template-independent ligation of single-stranded dna |
| CN107267499A (en) * | 2017-06-22 | 2017-10-20 | 中国海洋大学 | Prepare cyclic DNA or RNA method |
| CN108251424A (en) * | 2017-12-19 | 2018-07-06 | 天利康（天津）科技有限公司 | A kind of single stranded circle RNA and DNA and its preparation method and application |
| CN109161572A (en) * | 2018-07-05 | 2019-01-08 | 中国海洋大学 | Single stranded circular nucleic acid and its preparation method and application |
-
2019
- 2019-10-12 CN CN201910968892.7A patent/CN110724728B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010094040A1 (en) * | 2009-02-16 | 2010-08-19 | Epicentre Technologies Corporation | Template-independent ligation of single-stranded dna |
| CN107267499A (en) * | 2017-06-22 | 2017-10-20 | 中国海洋大学 | Prepare cyclic DNA or RNA method |
| CN108251424A (en) * | 2017-12-19 | 2018-07-06 | 天利康（天津）科技有限公司 | A kind of single stranded circle RNA and DNA and its preparation method and application |
| CN109161572A (en) * | 2018-07-05 | 2019-01-08 | 中国海洋大学 | Single stranded circular nucleic acid and its preparation method and application |
Non-Patent Citations (3)
| Title |
|---|
| Avenues Toward microRNA Detection In Vitro: A Review of Technical Advances and Challenges;Chu-shu Zhu等;《Computational and Structural Biotechnology Journal》;20190620;第17卷;第904-916页 * |
| 新型功能核酸探针和等温信号放大策略的研究及分析应用;庄君阳;《中国博士学位论文全文数据库 工程科技Ⅰ辑》;20180515;全文 * |
| 曹墨菊.植物生物技术概论.《植物生物技术概论》.中国农业大学出版社,2014,第284页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110724728A (en) | 2020-01-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105121655B (en) | Novel ligase activity | |
| JP6894501B2 (en) | Isothermal nucleic acid self-amplification method | |
| US9255291B2 (en) | Oligonucleotide ligation methods for improving data quality and throughput using massively parallel sequencing | |
| EP3388519A1 (en) | Vesicular adaptor and uses thereof in nucleic acid library construction and sequencing | |
| US10683498B2 (en) | Methods for generating circular DNA from circular RNA | |
| US11761037B1 (en) | Probe and method of enriching target region applicable to high-throughput sequencing using the same | |
| CN104726549B (en) | Novel nicking enzyme-based double-stranded nucleic acid isothermal amplification detection method | |
| US20110287490A1 (en) | Gene synthesis by convergent assembly of oligonucleotide subsets | |
| US11591646B2 (en) | Small RNA detection method based on small RNA primed xenosensor module amplification | |
| CN110724728B (en) | Preparation method of circular DNA | |
| US20140128292A1 (en) | Methods for improving ligation steps to minimize bias during production of libraries for massively parallel sequencing | |
| CN113943764B (en) | Method for preparing double-stranded RNA | |
| CN109706226B (en) | Method for rapidly detecting miRNA based on asymmetric PCR and LAMP cyclic amplification reaction | |
| WO2017215517A1 (en) | Method for removing 5' and 3' linker connection by-products in sequencing library construction | |
| US9695417B2 (en) | Method for large-scale synthesis of long-chain nucleic acid molecule | |
| CN115873928B (en) | Rolling circle amplification method based on double-chain-ring template and application thereof | |
| JP2022515085A (en) | Single-stranded DNA synthesis method | |
| CN110818757A (en) | Nucleotide analogs and method for screening DNA polymerase | |
| CN109706233A (en) | A kind of amplification technique of complexity long-fragment nucleic acid sequence | |
| JP7333171B2 (en) | RNA detection method, RNA detection nucleic acid and RNA detection kit | |
| CN116179652A (en) | Method for detecting trace nucleic acid based on LAMP (loop-mediated isothermal amplification) combined with Cas13a nuclease and application | |
| WO2018232594A1 (en) | Pcr primer pair and application thereof | |
| JP5129498B2 (en) | Nucleic acid cloning method | |
| WO2021088189A1 (en) | Oligonucleotide library isothermal amplification method for dna data storage | |
| JP7127023B2 (en) | Nucleic Acid Detection Method, Nucleic Acid Detection Primer, and Nucleic Acid Detection Kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |