CN109161572A - Single stranded circular nucleic acid and its preparation method and application - Google Patents
Single stranded circular nucleic acid and its preparation method and application Download PDFInfo
- Publication number
- CN109161572A CN109161572A CN201810734128.9A CN201810734128A CN109161572A CN 109161572 A CN109161572 A CN 109161572A CN 201810734128 A CN201810734128 A CN 201810734128A CN 109161572 A CN109161572 A CN 109161572A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- linear nucleic
- cyclization
- preparation
- ligase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/26—Preparation of nitrogen-containing carbohydrates
- C12P19/28—N-glycosides
- C12P19/30—Nucleotides
- C12P19/34—Polynucleotides, e.g. nucleic acids, oligoribonucleotides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/532—Closed or circular
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of single stranded circular nucleic acids and its preparation method and application, it is related to technical field of molecular biology, the preparation method of circular nucleic acid provided by the invention, including the linear nucleic acid with terminal hairpin structure after hybridizing with cyclization auxiliary chain, linked enzyme connection is closed both ends, obtains single stranded circular nucleic acid.This method significantly reduces the generation of by-product.With this " terminal hairpin " connection method, make linear nucleic acid under ligase connection, the monocycle cyclization rate in conventional system is up to nearly 100%.Also, most of single nucleic acid strands will form hairpin structure in linked system, so the versatility of preparation method provided by the invention is high.In addition, this method is easy to operate, and it is time-consuming shorter, it can be operated without special experimenter, on the basis of saving manpower and time cost, also have the advantages that universality is wide.
Description
Technical field
The present invention relates to technical field of molecular biology, more particularly, to a kind of single stranded circular nucleic acid and preparation method thereof
And application.
Background technique
Nucleic acid is not only the carrier and a kind of material of Nanostructure fabrication of hereditary information, especially in recent years
Come, nucleic acid machine is designed to for research hotspot, and the shapes such as " cylinder mould ", " chain lock " can be presented in different nucleic acid machines, has
It is possibly used for pharmaceutical carrier, matter transportation, liquid calculating etc..Single stranded circular nucleic acid be it is a kind of by single stranded DNA, RNA or its
The ring-type of his the end to end formation of modification of nucleic acids chain is by structure, since its unique dynamics and Topological property make it in structure
Important function is played when building nano material.In addition, circular nucleic acid is other than it can be used for constructing nano material, it can also be used to
Rolling circle amplification, foodstuff traceability and research of nucleic acid topological structure etc..So can single-stranded linear nucleic acid be cyclized successfully or line
Property nucleic acid cyclisation after can obtain single circular nucleic acid product become current research focus.
Currently, the synthesis of most of single stranded circular nucleic acids is in ligase, cyclization auxiliary chain (with single stranded DNA or RNA
The short chain of 3 ' and 5 ' termini-complementaries) under the action of, the ring (such as Fig. 1 approach 1.) that joins end to end as closure.However, single-stranded loop
The main problem faced in shape nucleic acid preparation process is to be difficult to inhibit the by-product that intermolecular connection generates under high concentration of substrate.
Such as in the reaction system, a plurality of template is single-stranded is connected with each other (such as Fig. 1 approach 2.) under cyclization auxiliary chain effect, is formed
Polymer, i.e., in the higher situation of concentration of connection substrate, intermolecular distance furthers in system, keeps intermolecular collision several
Rate increases, and the collision probability of linear nucleic acid both ends intramolecular is constant, and the intermolecular collision probability difference with intramolecular becomes smaller,
Increasing for intermolecular joint efficiency is eventually led to, polymer yield sharply increases.Recently, high concentration connection can be generated big
The problem of measuring by-product has the pair experiments have shown that during capable of effectively reducing the chain of rings under conditions of low buffer concentration
Product, low buffer are just reduction of reaction efficiency, and intermolecular joint efficiency is made to decline to a great extent, and make the connection of intramolecular
It has the advantage, but it is there are cumbersome, the disadvantages of taking a long time.
Therefore, developing one kind can effectively make linear nucleic acid be connected as circular nucleic acid, and joint efficiency is high, by-product is few,
The preparation method of easy to operate, time-consuming short circular nucleic acid is particularly important.
In view of this, the present invention is specifically proposed.
Summary of the invention
The first purpose of this invention is to provide a kind of preparation method of single stranded circular nucleic acid, to alleviate the prior art
Present in single stranded circular nucleic acid joint efficiency is low, by-product is more or cumbersome, the technical issues of taking a long time.
Second object of the present invention is single stranded circular nucleic acid prepared by the above method.
Third object of the present invention is to provide above-mentioned single stranded circular nucleic acid in building nano material, rolling circle amplification, food
Product trace to the source one of nucleic acid Study on topology or it is a variety of in application.
The present invention provides a kind of preparation method of single stranded circular nucleic acid, the preparation method includes:
Linked enzyme connection is closed the linear nucleic acid both ends after hybridizing with cyclization auxiliary chain, obtains the ring nucleus
Acid；
Wherein, the linear nucleic acid has hairpin structure, and the hairpin structure is located at the linear nucleic acid and the cyclization
Assist the junction of chain；
The cyclization auxiliary chain is complementary with 3 ' ends of the linear nucleic acid and 5 ' ends.
Further, the linear nucleic acid is subjected to Sketch of secondary structure, selects stable hairpin structure as the line
Property nucleic acid and it is described cyclization auxiliary chain junction.
Further, the length of the linear nucleic acid is 40-200nt, preferably 44-200nt, more preferably 54-
200nt。
Further, the T of the hairpin structuremValue is higher than 10-60 DEG C of reaction temperature of connection, and preferably more than connection is anti-
Answer 20-40 DEG C of temperature.
Further, the linear nucleic acid, cyclization auxiliary chain, ligase and connection buffer are mixed into same connection
System is attached reaction；
Preferably, the time of the connection reaction is 1-5 hours；
Preferably, the buffer of the connection reaction is 0.1-1 times of standard buffer solution.
Further, the ligase is the nicking portion that can be connected in double-stranded DNA, double-stranded RNA or DNA-RNA hybridization chain
The ligase divided；
Preferably, the ligase is T4 DNA ligase, T4 RNA ligase, T3 DNA connect enzyme, T7 DNA ligase
Or any one in E.coli DNA ligase.
Further, the concentration of the linear nucleic acid is 1-100 μM, preferably 5-50 μM.
Further, the molar ratio of the linear nucleic acid and the cyclization auxiliary chain is 1:1-5, preferably 1:1-3.
The present invention also provides the circular nucleic acids being prepared using above-mentioned preparation method.
In addition, the present invention also provides above-mentioned circular nucleic acid building nano material, rolling circle amplification, foodstuff traceability or
One of nucleic acid Study on topology or it is a variety of in application.
The preparation method of circular nucleic acid provided by the invention, including linked enzyme connection make after hybridizing with cyclization auxiliary chain
With hairpin structure linear nucleic acid both ends closure, obtain circular nucleic acid.By the junction of linear nucleic acid and cyclization auxiliary chain
It is designed as hairpin structure, can be guaranteed in linked system, small part hairpin structure is first had and opens and cyclization auxiliary chain link
Cyclization is carried out, so that the molecule that can connect in linked system is remained at the lower level of concentration, makes intramolecular mutual in this way
The advantage of connection is in more apparent status, greatly reduces the generation of by-product.With this " terminal hairpin " connection side
Method makes linear nucleic acid under ligase connection, and the monocycle cyclization rate in conventional system is up to nearly 100%.Also, it is most of
Single nucleic acid strands will form hairpin structure in linked system, so the versatility of preparation method provided by the invention is high.
In addition, this method is easy to operate, and it is time-consuming shorter, it can be operated without special experimenter, save manpower and time
On the basis of cost, also have the advantages that universality is wide.
Detailed description of the invention
It, below will be to tool in order to illustrate more clearly of the specific embodiment of the invention or technical solution in the prior art
Body embodiment or attached drawing needed to be used in the description of the prior art be briefly described, it should be apparent that, it is described below
Attached drawing be some embodiments of the present invention, for those of ordinary skill in the art, what is do not made the creative labor
Under the premise of, it is also possible to obtain other drawings based on these drawings.
Fig. 1 is that the linear nucleic acid provided by the invention for having distal hairpin connects cyclic schematic diagram；
Fig. 2A is the L64 that the embodiment of the present invention 1 provides3-4,24-4Mfold simulation drawing；
Fig. 2 B is the L64 that the embodiment of the present invention 1 provides16-4,37-4Mfold simulation drawing；
Fig. 2 C is influence result ratio of the hair clip position that provides of the embodiment of the present invention 1 to the cyclic purpose product amount of connection
Compared with result figure；
Fig. 3 A is the L74 that the embodiment of the present invention 2 provides3-4,24-4,65-2Linear nucleic acid Mfold simulation drawing；
Fig. 3 B is the L64 that the embodiment of the present invention 2 provides3-4,24-4,55-2Linear nucleic acid Mfold simulation drawing；
Fig. 3 C is the L54 that the embodiment of the present invention 2 provides3-4,24-4,45-2Linear nucleic acid Mfold simulation drawing；
Fig. 3 D is the L44 that the embodiment of the present invention 2 provides14-6,24-4,55-2Linear nucleic acid Mfold simulation drawing；
Fig. 3 E is the L34 that the embodiment of the present invention 2 provides14-6,35-2Linear nucleic acid Mfold simulation drawing；
Fig. 3 F is that the single-stranded connection with terminal hairpin structure for the different length that the embodiment of the present invention 2 provides is compared
Result figure；
Fig. 4 A is the L64 that the embodiment of the present invention 3 provides2-4,23-4,51-2Linear nucleic acid Mfold simulation drawing；
Fig. 4 B is the L64 that the embodiment of the present invention 3 provides3-4,24-4Linear nucleic acid Mfold simulation drawing；
Fig. 4 C is the L64 that the embodiment of the present invention 3 provides4-4,25-4Linear nucleic acid Mfold simulation drawing；
Fig. 4 D is the L64 that the embodiment of the present invention 3 provides5-4,26-4Linear nucleic acid Mfold simulation drawing；
Fig. 4 E is the L64 that the embodiment of the present invention 3 provides6-4,27-4Linear nucleic acid Mfold simulation drawing；
Fig. 4 F is the different link position comparison result figures that the embodiment of the present invention 3 provides；
Fig. 5 A is the L64 that the embodiment of the present invention 4 provides0-4,24-4Linear nucleic acid Mfold simulation drawing；
Fig. 5 B is the L64 that the embodiment of the present invention 4 provides0-6,24-4Linear nucleic acid Mfold simulation drawing；
Fig. 5 C is the L64 that the embodiment of the present invention 4 provides0-7,24-4Linear nucleic acid Mfold simulation drawing；
Fig. 5 D is the L64 that the embodiment of the present invention 4 provides0-7,20-4Linear nucleic acid Mfold simulation drawing；
Fig. 5 E is that connection cyclization of the hair clip for the different stability that the embodiment of the present invention 4 provides in the end of chain compares knot
Fruit figure；
Fig. 6 A is the L64 that the embodiment of the present invention 5 provides3-4,24-4Connection conversion ratio and circular nucleic acid yield statistical chart；
Fig. 6 B is the L64 that the embodiment of the present invention 5 provides16-4,37-4Connection conversion ratio and circular nucleic acid yield statistics
Figure；
Fig. 7 A is the L64 that the embodiment of the present invention 6 provides3-4,24-4High concentration cyclization electrophoretogram；
Fig. 7 B is the L64 that the embodiment of the present invention 6 provides16-4,37-4High concentration cyclization electrophoretogram；
Fig. 8 A is the L that the embodiment of the present invention 7 providesDNALinear nucleic acid Mfold simulation drawing；
Fig. 8 B is the linear nucleic acid L with end hair fastener that the embodiment of the present invention 7 providesDNACyclic electrophoretogram.
Specific embodiment
Technical solution of the present invention is clearly and completely described below in conjunction with embodiment, it is clear that described
Embodiment is a part of the embodiment of the present invention, instead of all the embodiments.Based on the embodiments of the present invention, this field is general
Logical technical staff every other embodiment obtained without making creative work, belongs to protection of the present invention
Range.
The present invention provides a kind of preparation methods of single stranded circular nucleic acid, comprising:
Linked enzyme connection is closed the linear nucleic acid both ends after hybridizing with cyclization auxiliary chain, obtains circular nucleic acid；
Wherein, linear nucleic acid has hairpin structure, which is located at linear nucleic acid and assists hybridizing for chain with cyclization
Place；
Cyclization auxiliary chain is complementary with 3 ' ends of linear nucleic acid and 5 ' ends.
In the present invention, single stranded circular nucleic acid is that linear nucleic acid same chain is end to end, and closure cyclization obtains.
In the present invention, linear nucleic acid is single-stranded linear nucleic acid, and nucleic acid can be DNA, RNA or other modification of nucleic acids；Phase
It answers, the circular nucleic acid being prepared is single stranded circular nucleic acid, and nucleic acid can be DNA, RNA or other modification of nucleic acids.
In the present invention, nucleic acid molecules folded back on itself, number of base is close to each other, base pair complementarity in fold domain,
Reverse is formed hairpin structure.Hybridizing for chain is assisted with cyclization when the hairpin structure of linear nucleic acid is located at linear nucleic acid
When place, in connection reaction process, the linear nucleic acid in linked system needs first to open the hairpin structure of itself, ability
With cyclization auxiliary chain pairing cyclization, having reached makes the molecule that can connect in linked system remain at the lower water of concentration
Flat purpose greatly reduces the generation of by-product so that the advantage for connecting intramolecular is in more apparent status.
Meanwhile the preparation method of circular nucleic acid provided by the invention, most of single nucleic acid strands can in linked system
Hairpin structure is formed, and the selection of link position does not influence the sequence of finally obtained circular nucleic acid, so provided by the invention
The versatility of preparation method is high.In addition, this method is easy to operate, and it is time-consuming shorter, it can be carried out without special experimenter
Operation also has the advantages that universality is wide on the basis of saving manpower and time cost.
In one preferred embodiment, linear nucleic acid is subjected to Sketch of secondary structure, selects stable hairpin structure
Hybridize place with cyclization auxiliary chain as linear nucleic acid.
It can use computer software and carry out Sketch of secondary structure, such as can be, but be not limited to using Mfold, IDT
Equal softwares carry out Sketch of secondary structure.
It selects to guarantee that hairpin structure is not opened easily as junction at the hair clip with certain stability, reach
The molecule that can connect in linked system is set to remain at the purpose of concentration lower level, so that intramolecular be made to connect
Advantage be in more apparent status, greatly reduce the generation of by-product.
In one preferred embodiment, the length of linear nucleic acid is 40-200nt, such as can be, but be not limited to
40nt, 50nt, 60nt, 80nt, 100nt, 120nt, 150nt, 180nt or 200 nt.Preferably 44-200nt, more preferably
54-200nt。
When the length of linear nucleic acid is 40-200nt, it can guarantee higher cyclic rate.
The length of linear nucleic acid in the present invention is further adjusted and optimized, cyclic rate can be made higher.
In one preferred embodiment, the T of hairpin structuremValue is higher than 10-60 DEG C of reaction temperature of connection, such as can
Think, but be not limited to 10 DEG C, 20 DEG C, 30 DEG C, 40 DEG C, 50 DEG C or 60 DEG C, preferably more than connects 20-40 DEG C of reaction temperature.
As the T of hairpin structuremWhen value is higher than 20-40 DEG C of reaction temperature of connection, it can guarantee higher cyclic rate.
In one preferred embodiment, by improving the gap of intramolecular and intermolecular connection, effectively connection is reduced
Concentration.
According to the relationship between this free energy of jeep and the equilibrium constant:
Δ G=-RTlnK (1)
Known to terminal hairpin structure-raising of Δ G, can reach the concentration of substrate exponentially of high yield (> 85%)
Type increase, according to experimental result primarily determined terminal hairpin structure-Δ G within the scope of 1-4 when, connection by-product
Amount can inhibit significantly, and obtained single stranded circular nucleic acid amount can be substantially improved.
In one preferred embodiment, linear nucleic acid, cyclization auxiliary chain, ligase and connection buffer are mixed
For same linked system, it is attached reaction；
Preferably, the temperature for connecting reaction is 20-40 DEG C, such as can be, but be not limited to 20 DEG C, 22 DEG C, 25 DEG C, 28
DEG C, 30 DEG C, 32 DEG C, 35 DEG C or 37 DEG C or 40 DEG C, preferably 25-37 DEG C；
Preferably, the time for connecting reaction is 1-5 hours, such as can be, but be not limited to 1 hour, 2 hours, 3 hours,
4 hours or 5 hours, preferably 2-4 hours.
Preferably, the buffer of the connection enzyme reaction is 0.1-1 times of standard buffer solution, such as can be, but unlimited
In 0.1 times, 0.2 times, 0.3 times, 0.4 times, 0.5 times, 0.6 times, 0.7 times, 0.8 times, 0.9 times or 1 times.
The condition for connecting reaction in the present invention is further adjusted and optimized, cyclic rate can be made higher.
In one preferred embodiment, ligase is that can connect double-stranded DNA, double-stranded RNA or DNA-RNA to hybridize chain
In notch ligase；
Preferably, the ligase is T4 DNA ligase, T4 RNA ligase, T3 DNA ligase, T7 DNA connection
Any one in enzyme or E.coli DNA ligase.
In one preferred embodiment, the concentration of linear nucleic acid is 1-100 μM, such as can be, but be not limited to 1 μ
M, 10 μM, 20 μM, 30 μM, 40 μM, 50 μM, 60 μM, 70 μM, 80 μM, 90 μM or 100 μM, preferably 5-50 μM.
When the concentration of linear nucleic acid is 1-100 μM, it can guarantee higher cyclic rate.
The concentration of linear nucleic acid in the present invention is further adjusted and optimized, cyclic rate can be made higher.
In one preferred embodiment, the molar ratio of linear nucleic acid and cyclization auxiliary chain is 1:1-5, such as can be with
For, but it is not limited to 1:1,1:2,1:3,1:4 or 1:5, preferably 1:1-3.
When the molar ratio of linear nucleic acid and cyclization auxiliary chain is 1:1-5, it can guarantee higher cyclic rate.
The molar ratio of linear nucleic acid in the present invention and cyclization auxiliary chain is further adjusted and optimized, can be made
Cyclic rate is higher.
The present invention also provides the single stranded circular nucleic acids being prepared using above-mentioned preparation method.
It traces back in addition, the present invention also provides above-mentioned single stranded circular nucleic acids in building nano material, rolling circle amplification, food
One of source or nucleic acid Study on topology or it is a variety of in application.
In order to facilitate it is clearer understand the contents of the present invention, be described in detail as follows now in conjunction with specific embodiment.
Experimental method in following embodiments is unless otherwise specified conventional method.
Unless otherwise instructed, channel is easily purchased to be regular in the equal source of drug and reagent used in the embodiment of the present invention:
Linear nucleic acid and cyclization auxiliary chain are purchased from Suzhou Jin Weizhi Biotechnology Co., Ltd, are artificial synthesized；T4
DNA ligase, T4 RNA ligase are purchased from U.S.'s match Mo Feishier company (Thermo Scientific)；T3 DNA ligase,
E.coli DNA ligase is purchased from New England Biolabs；Other chemical combination articles are purchased from U.S.'s Sigma-Aldrich
(Sigma-Aldrich)。
Embodiment 1
1, raw material
Linear nucleic acid 1 (5 ' → 3 ', L643-4,24-4):
ACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCG CTTTCTTCTCCCCATTTTCGCCGG(5’-
Phosphorylation, length 64nt, SEQ ID NO:1)；
Linear nucleic acid 2 (5 ' → 3 ', L6416-4,37-4):
CCATTTTCGCCGGACCGCTACACTTGCCAGCGCCCTAGCGCCCGC TCCTTTCGCTTTCTTCTCC(5’-
Phosphorylation, length 64nt, SEQ ID NO:2)；
Cyclization auxiliary chain 1 (5 ' → 3 '):
AGCGGTCCGGCG (length 12nt, SEQ ID NO:3)；
Cyclization auxiliary chain 2 (5 ' → 3 '):
AAATGGGGAGAA (length 12nt, SEQ ID NO:4).
Source: artificial synthesized (Suzhou Jin Weizhi Bioisystech Co., Ltd).
Two lines nucleic acid be connected to become its sequence after circular nucleic acid be it is identical, only selected when connecting cyclization
Link position is different.Linear nucleic acid 1 is by junction selection beside hair clip, and linear nucleic acid 2 then selects junction
In the place far from hair clip.
2, it tests
1) connection cyclization
Linear nucleic acid and corresponding cyclization auxiliary chain, ligase and connection buffer are blended in a system, the body
The concentration of linear nucleic acid is 5 μM in system, and the molar ratio of linear nucleic acid and cyclization auxiliary chain is 1:2,10U T4 DNA ligase
(being purchased from Thermo Scientific), 1 × T4 DNA ligase buffer (Ligase Buffer), 20 μ L of total volume；25℃
Under the conditions of connect 1 hour.The sequence for the circular nucleic acid that two lines nucleic acid is formed upon connection be it is identical, only connecting
When the link position that selects it is different.
2) digestion confirms
System after taking a part to connect, and excision enzyme Exonuclease I is added, by the single-stranded removal in system.Enzyme
Cut system: 5 μ L, 1 × Exonuclease I excision enzyme buffer solution of linked system, 5U Exonuclease I, enzyme under the conditions of 37 DEG C
It cuts 1 hour, 10 μ L of total volume.
3) electrophoresis detection
As shown in Fig. 2A, Fig. 2 B and Fig. 2 C.Wherein, Fig. 2A L643-4,24-4Mfold simulation drawing, Fig. 2 B is
L6416-4,37-4Mfold simulation drawing, simulated conditions are [Mg2+]=10mM, 25 DEG C.Reaction system and condition in Fig. 2 C: [line
Property nucleic acid]=5 μM, [cyclization auxiliary chain]=10 μM, 10U T4 DNA ligase, 1 × T4 DNA ligase buffer, 25 DEG C, 1
Hour.Swimming lane 1 is L643-4,24-4, cyclization auxiliary chain and ligase are not added；Swimming lane 2 is L643-4,24-4Cyclization auxiliary chain is added
With the band after T4DNA ligase；Swimming lane 3 is L643-4,24-4Excision enzyme is added after connection cyclization by the item after single-stranded removal
Band；Swimming lane 4 is L6416-4,37-4, cyclization auxiliary chain and ligase are not added；Swimming lane 5 is L6416-4,37-4Cyclization auxiliary chain is added
With the band after T4DNA ligase；Swimming lane 6 is L6416-4,37-4Excision enzyme is added after connection cyclization by the band after single-stranded removal.
Fig. 2 C compares (10% urea for result after the connection cyclization at end of the hair clip in chain and the middle part in chain and digestion
Denaturing acrylamide gel electrophoresis).The results show that when end of the hairpin structure in chain, the yield of the circular nucleic acid generated
It can achieve 93%, and up to 100% after digestion.But when link position is at the place of not hair clip, the ring-type that generates
The yield of nucleic acid only has 45%, is 64% after digestion.It can be seen from the results that when selection has the place of terminal hairpin structure
When being attached, cyclic rate can be obviously improved, and make cyclic yield from 45% to 93%.
Embodiment 2
1, raw material
Linear nucleic acid 1 (5 ' → 3 ', L743-4,24-4,65-2):
ACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTC TTCCCTTCCTTTCTCGCCACGTT
CGCCGG (5 '-phosphorylations, length 74nt, SEQ ID NO:5)；
Linear nucleic acid 2 (5 ' → 3 ', L643-4,24-4,55-2):
ACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTC TTCTCGCCACGTTCGCCGG(5’-
Phosphorylation, length 64nt, SEQ ID NO:6)；
Linear nucleic acid 3 (5 ' → 3 ', L543-4,24-4,45-2):
ACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTC GTTCGCCGG (5 '-phosphorylations, it is long
Degree is 54nt, SEQ ID NO:7)；
Linear nucleic acid 4 (5 ' → 3 ', L4414-6,24-4,55-2):
ACCGCTACACTTGCCAGCGCCCTAGCGCCGCTTTCGTTCGCCGG (5 '-phosphorylations, length 44nt,
SEQ ID NO:8)；
Linear nucleic acid 5 (5 ' → 3 ', L3414-6,35-2):
ACCGCTACACTTGCCAGCGCGCCACGTTCGCCGG (5 '-phosphorylations, length 34nt, SEQ ID NO:
9)；
Cyclization auxiliary chain (5 ' → 3 '):
AGCGGTCCGGCG (length 12nt, SEQ ID NO:10).
Source: artificial synthesized (Suzhou Jin Weizhi Bioisystech Co., Ltd).
2, it tests
1) connection cyclization
Linear nucleic acid and corresponding cyclization auxiliary chain, ligase and connection buffer are blended in a system, the body
The concentration of linear nucleic acid is 5 μM in system, and the molar ratio of linear nucleic acid and cyclization auxiliary chain is 1:2,10U E.coli DNA connection
Enzyme, 1 × E.coli DNA ligase buffer, 40 μ L of total volume；It is connected 2 hours under the conditions of 16 DEG C.Selection has terminal hairpin
The single-stranded of different length be attached.
2) digestion confirms
System after taking a part to connect, and excision enzyme Exonuclease I is added, by the single-stranded removal in system.Enzyme
Cut system: 5 μ L, 1 × Exonuclease I excision enzyme buffer solution of linked system, 5U Exonuclease I, enzyme under the conditions of 37 DEG C
It cuts 1 hour, 10 μ L of total volume.
3) electrophoresis detection
As shown in Fig. 3 A, Fig. 3 B, Fig. 3 C, Fig. 3 D, Fig. 3 E and Fig. 3 F.Wherein, Fig. 3 A is L743-4,24-4,65-2Linear kernel
The Mfold simulation drawing of acid, Fig. 3 B are L643-4,24-4,55-2Linear nucleic acid Mfold simulation drawing, Fig. 3 C be L543-4,24-4,45-2
Linear nucleic acid Mfold simulation drawing, Fig. 3 D be L4414-6,24-4,55-2Linear nucleic acid Mfold simulation drawing, Fig. 3 E is
L3414-6,35-2Linear nucleic acid Mfold simulation drawing, simulated conditions are [Mg2+]=10mM, 25 DEG C.Fig. 3 F reaction system and
Condition: [linear nucleic acid]=5 μM, [cyclization auxiliary chain]=10 μM, 10U E.coli DNA ligase, 1 × E.coli DNA connects
Connect enzyme buffer liquid, 16 DEG C, 2 hours.Swimming lane 1,4,7,10,13 is linear nucleic acid, and cyclization auxiliary chain and ligase are not added；Swimming
Road 2,5,8,11,14 is the band that linear nucleic acid is added after cyclization auxiliary chain and E.coli DNA ligase；Swimming lane 3,6,9,
12,15 be that excision enzyme is added after linear nucleic acid connection is cyclic by the band after single-stranded removal.
Fig. 3 F is that different length linear nucleic acid uses the result of " terminal hairpin " method cyclization to compare that (10% is urea-denatured
Acrylamide gel electrophoresis).The results show that the length of linear nucleic acid is in 54nt or more, with terminal hairpin it is single-stranded at
Ring rate is up to 94% or more, and when the length of linear nucleic acid drops to 44nt or so, cyclic rate can drop to 60% or so.And work as line
When the length of property nucleic acid drops to 34nt, cyclic rate only has 14%.
Embodiment 3
1, raw material
Linear nucleic acid 1 (5 ' → 3 ', L642-4,23-4,51-2):
CCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCT TCTCCCCATTTTCGCCGGA(5’-
Phosphorylation, length 64nt, SEQ ID NO:11)；
Linear nucleic acid 2 (5 ' → 3 ', L643-4,24-4):
ACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTC TTCTCCCCATTTTCGCCGG(5’-
Phosphorylation, length 64nt, SEQ ID NO:12)；
Linear nucleic acid 3 (5 ' → 3 ', L644-4,25-4):
GACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTT CTTCTCCCCATTTTCGCCG(5’-
Phosphorylation, length 64nt, SEQ ID NO:13)；
Linear nucleic acid 4 (5 ' → 3 ', L645-4,26-4):
GGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTT TCTTCTCCCCATTTTCGCC(5’-
Phosphorylation, length 64nt, SEQ ID NO:14)；
Linear nucleic acid 5 (5 ' → 3 ', L646-4,27-4):
CGGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCT TTCTTCTCCCCATTTTCGC(5’-
Phosphorylation, length 64nt, SEQ ID NO:15)；
Cyclization auxiliary chain 1 (5 ' → 3 '):
TAGCGGTCCGGC (length 12nt, SEQ ID NO:16)；
Cyclization auxiliary chain 2 (5 ' → 3 '):
AGCGGTCCGGCG (length 12nt, SEQ ID NO:17)；
Cyclization auxiliary chain 3 (5 ' → 3 '):
GCGGTCCGGCGA (length 12nt, SEQ ID NO:18)；
Cyclization auxiliary chain 4 (5 ' → 3 '):
CGGTCCGGCGAA (length 12nt, SEQ ID NO:19)；
Cyclization auxiliary chain 5 (5 ' → 3 '):
GGTCCGGCGAAA (length 12nt, SEQ ID NO:20).
Source: artificial synthesized (Suzhou Jin Weizhi Bioisystech Co., Ltd).
2, it tests
1) connection cyclization
Linear nucleic acid and corresponding cyclization auxiliary chain, ligase and connection buffer are blended in a system, the body
The concentration of linear nucleic acid is 5 μM in system, and linear nucleic acid and cyclization assist the molar ratio of chain for 1:2,5U T4 DNA ligase, 1
× T4 DNA ligase buffer, 10 μ L of total volume；It is connected 4 hours under the conditions of 25 DEG C.The sequence of two lines nucleic acid upon connection
Column are link position differences that is identical, only selecting in connection.
2) digestion confirms
System after taking a part to connect, and excision enzyme Exonuclease I is added, by the single-stranded removal in system.Enzyme
Cut system: 5 μ L, 1 × Exonuclease I excision enzyme buffer solution of linked system, 5U Exonuclease I, enzyme under the conditions of 37 DEG C
It cuts 1 hour, 10 μ L of total volume.
4) electrophoresis detection
As shown in Fig. 4 A, Fig. 4 B, Fig. 4 C, Fig. 4 D, Fig. 4 E and Fig. 4 F.Wherein, Fig. 4 A is L642-4,23-4,51-2Linear kernel
The Mfold simulation drawing of acid, Fig. 4 B are L643-4,24-4Linear nucleic acid Mfold simulation drawing, Fig. 4 C be L644-4,25-4It is linear
The Mfold mould figure of nucleic acid, Fig. 4 D are L645-4,26-4Linear nucleic acid Mfold simulation drawing, Fig. 4 E be L646-4,27-4Linear kernel
The Mfold simulation drawing of acid, simulated conditions are [Mg2+]=10mM, 25 DEG C.Fig. 4 F reaction system and condition: [linear nucleic acid]=
5 μM, [cyclization auxiliary chain]=10 μM, 10U T4 DNA ligase, 1 × T4 DNA ligase buffer, 25 DEG C, 12 hours.Swimming
Road 1,3,5,7,9 is linear nucleic acid, and cyclization auxiliary chain and ligase are not added；Swimming lane 2,4,6,8,10 is linear nucleic acid addition
Band after cyclization auxiliary chain and T4 DNA ligase.
Fig. 4 F is that the cyclic result of the linear nucleic acid for the different location that hair clip is located at chain end compares that (10% is urea-denatured
Acrylamide gel electrophoresis).The results show that the increase with hair clip from junction base, the yield of circular nucleic acid can be reduced,
When hair clip is the bases longs of 1-3nt with a distance from junction, the yield of circular nucleic acid is 90% or so, when connecting in hair clip
When place's distance is 4,5nt, the yield of circular nucleic acid drops to 70% or so.
Embodiment 4
1, raw material
Linear nucleic acid 1 (5 ' → 3 ', L640-4,24-4):
CGCTACACTTGCCAGCGCCCACTAGCGCCCGCTCCTTTCGCTTTC TTCTCCCCATTTTCGCCGG(5’-
Phosphorylation, length 64nt, SEQ ID NO:21)；
Linear nucleic acid 2 (5 ' → 3 ', L640-6,24-4):
GGCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTC TTCTCCCCATTTTCGCCGG(5’-
Phosphorylation, length 64nt, SEQ ID NO:22)；
Linear nucleic acid 3 (5 ' → 3 ', L640-7,24-4):
GGCGCGCCACTTGCGCGCGCCCTAGCGCCCGCTCCTTTCGCTTTC TTCTCCCCATTTTCGCCGG(5’-
Phosphorylation, length 64nt, SEQ ID NO:23)；
Linear nucleic acid 4 (5 ' → 3 ', L640-7,20-4):
GGCGCGCGAAGCGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCT CCCCATTTTCGCCGG (5 '-phosphoric acid
Change, length 64nt, SEQ ID NO:24)；
Cyclization auxiliary chain 1 (5 ' → 3 '):
GTAGCGCCGGCG (length 12nt, SEQ ID NO:25)；
Cyclization auxiliary chain 2 (5 ' → 3 '):
AGCGCCCCGGCG (length 12nt, SEQ ID NO:26)；
Cyclization auxiliary chain 3 (5 ' → 3 '):
CGCGCCCCGGCG (length 12nt, SEQ ID NO:27).
Source: artificial synthesized (Suzhou Jin Weizhi Bioisystech Co., Ltd).
2, it tests
1) connection cyclization
Linear nucleic acid and corresponding cyclization auxiliary chain, ligase and connection buffer are blended in a system, the body
The concentration of linear nucleic acid is 5 μM in system, and the molar ratio of linear nucleic acid and cyclization auxiliary chain is 1:2,1000U T3 DNA ligase
(being purchased from New England Biolabs), 1 × T3 DNA ligase buffer solution, 20 μ L of total volume；12 are connected under the conditions of 25 DEG C
Hour.Selection is attached with the single-stranded of different length of terminal hairpin.
2) electrophoresis detection
As shown in Fig. 5 A, Fig. 5 B, Fig. 5 C, Fig. 5 D and Fig. 4 E.Wherein, Fig. 5 A is L640-4,24-4Linear nucleic acid Mfold
Simulation, the T of terminal hairpinmValue is 57 DEG C, and Fig. 5 B is L640-6,24-4Linear nucleic acid Mfold simulation drawing, terminal hairpin
TmValue is 73 DEG C, and Fig. 5 C is L640-7,24-4Linear nucleic acid Mfold simulation drawing, the T of terminal hairpinmValue is 85 DEG C, figure
5D is L640-7,20-4Linear nucleic acid Mfold simulation drawing, the T of terminal hairpinmValue is 90 DEG C, and simulated conditions are [Mg2+]
=10mM, 25 DEG C.Fig. 5 E reaction system and condition: [linear nucleic acid]=5 μM, [cyclization auxiliary chain]0=10 μM, 1000U T3
DNA ligase, 1 × T3 DNA ligase buffer, 25 DEG C, 12 hours.Swimming lane 1,3,5,7 is linear nucleic acid, and cyclization is not added
Assist chain and ligase；Swimming lane 2,4,6,8 is the band that linear nucleic acid is added after cyclization auxiliary chain and T3 DNA ligase.
Fig. 5 E is that the cyclic result of the linear nucleic acid of hair clip of the end with different stability compares that (12% is urea-denatured
Acrylamide gel electrophoresis).The results show that working as the T of terminal hairpin structuremRing about at 50-70 DEG C or so, after connection
Shape nucleic acid amount can work as T 90% or somWhen higher than 80 DEG C, cyclic rate can drop to 64% or so.
Embodiment 5
1, raw material
The measurement of rate and cyclic rate is attached with the two lines nucleic acid in case study on implementation 1.
2, it tests
1) connection cyclization
Linear nucleic acid and corresponding cyclization auxiliary chain, ligase and connection buffer are blended in a system, the body
The concentration of linear nucleic acid is 5 μM in system, and linear nucleic acid and cyclization assist the molar ratio of chain for 1:2,10U T4 DNA ligase, 1
× T4DNA ligase buffer solution, 30 μ L of total volume；Under the conditions of 25 DEG C, the Connection Time is respectively 2min, 5min, 10min,
20min, 40min, 1h, 2h, 3h.
2) electrophoresis detection
Fig. 6 A and Fig. 6 B be hair clip end linear nucleic acid and hair clip in the linear nucleic acid different time at middle part at
Ring result compares (12% urea-denatured acrylamide gel electrophoresis).Conversion ratio=(circular nucleic acid+poly by-product)/total
Linear nucleic acid amount, conversion ratio indicate the connection speed of linear nucleic acid；The amount of substrate of cyclic rate=circular nucleic acid/total, cyclic rate table
The cyclic effect of linear nucleic acid.The results show that hair clip is hair in the connection speed of the linear nucleic acid of middle part (end is without hair clip)
It is clipped in 10 times or more of the connection speed of the linear nucleic acid of end.When end is without hair clip, intermolecular collision probability increases, even
It is too fast to connect rate, so amount of by-products steeply rises.The production that end has the linear nucleic acid of hair clip to connect circular nucleic acid after cyclization
For rate up to 90% or more, hair clip is only 45% in the circular nucleic acid yield of the linear nucleic acid at middle part.
Embodiment 6
1, raw material
High concentration connection is carried out with the two lines nucleic acid in case study on implementation 1 to compare.
2, it tests
1) connection cyclization
Linear nucleic acid and corresponding cyclization auxiliary chain, ligase and connection buffer are blended in a system, the body
The concentration of linear nucleic acid is 10 μM, 20 μM, 40 μM, 60 μM, 100 μM in system, and the molar ratio of linear nucleic acid and cyclization auxiliary chain is
1:2,10-50U T4 DNA ligase, 1 × T4 DNA ligase buffer and 0.1 × T4DNA ligase buffer solution, total volume
10μL；Under the conditions of 25 DEG C, the Connection Time is 12 hours.
3) electrophoresis detection
As shown in figures 7 a and 7b, Fig. 7 A is L643-4,24-4High concentration cyclization electrophoretogram, Fig. 7 B be L6416-4,37-4's
High concentration cyclization electrophoretogram.Swimming lane 2-6,9 connections are with 1 × T4 ligase buffer solution；The connection of swimming lane 7,10 is connected with 0.1 × T4
Connect enzyme buffer liquid.
As can be seen that the linear nucleic acid (linear nucleic acid 1) with terminal hairpin is in 100 μM of final concentrations from result figure
The yield of circular nucleic acid is up to 80% or more, and hair clip at this time is in the cyclic rate of the linear nucleic acid (linear nucleic acid 2) at middle part
Have 27%.
Embodiment 7
1, raw material
Linear nucleic acid (5 ' → 3 ', LRNA):
CUGCUGUUGUUCCCUUAUAAUUUCCUCCUCCAUAGUUUCCUUC UGAGUUGUGUU (5 '-phosphorylations, it is long
Degree is 54nt, SEQ ID NO:28)；
Cyclization auxiliary chain (5 ' → 3 '):
AACAGCAGAACACAAC (length 16nt, SEQ ID NO:29)；
Source: artificial synthesized (Suzhou Jin Weizhi Bioisystech Co., Ltd).
2, it tests
1) connection cyclization
Linear nucleic acid and corresponding cyclization auxiliary chain, ligase and connection buffer are blended in a system, the body
The concentration of linear nucleic acid is 1 μM in system, and linear nucleic acid and cyclization assist the molar ratio of chain for 1:2,5U T4 RNA ligase, 1
× T4 RNA ligase buffer, 20 μ L of total volume；It is connected 12 hours under the conditions of 37 DEG C.
2) electrophoresis detection
As shown in Figure 8 A and 8 B.Wherein, Fig. 8 A is LRNAMfold simulation drawing, simulated conditions are [Mg2+]=10mM,
37℃.Reaction system and condition in Fig. 8 B: [linear nucleic acid]=1 μM, [cyclization auxiliary chain]=2 μM, 5U T4 RNA ligase,
1 × T4 RNA ligase buffer, 37 DEG C, 12 hours.Swimming lane 1 is LRNA, cyclization auxiliary chain and ligase are not added；Swimming lane 2
For LRNABand after cyclization auxiliary chain and T4RNA ligase is added；
Fig. 8 B is cyclic result (the 12% urea-denatured acrylamide gel electricity for the RNA chain that hairpin structure is located at end
Swimming).The results show that when hairpin structure is located at the end of RNA chain, after connection its cyclic rate up to 90% or more (swimming lane 2),
Illustrate that terminal hairpin structure also remarkably promotes effect for the connection cyclization of RNA chain.
Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention., rather than its limitations；
Although present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that: its
It is still possible to modify the technical solutions described in the foregoing embodiments, or special to some or all of technologies
Sign is equivalently replaced；And these are modified or replaceed, various embodiments of the present invention that it does not separate the essence of the corresponding technical solution
The range of technical solution.
SEQUENCE LISTING
<110>Chinese Marine University
<120>single stranded circular nucleic acid and its preparation method and application
<160> 29
<170> PatentIn version 3.5
<210> 1
<211> 64
<212> DNA
<213>artificial sequence
<400> 1
accgctacac ttgccagcgc cctagcgccc gctcctttcg ctttcttctc cccattttcg 60
ccgg 64
<210> 2
<211> 64
<212> DNA
<213>artificial sequence
<400> 2
ccattttcgc cggaccgcta cacttgccag cgccctagcg cccgctcctt tcgctttctt 60
ctcc 64
<210> 3
<211> 12
<212> DNA
<213>artificial sequence
<400> 3
agcggtccgg cg 12
<210> 4
<211> 12
<212> DNA
<213>artificial sequence
<400> 4
aaatggggag aa 12
<210> 5
<211> 74
<212> DNA
<213>artificial sequence
<400> 5
accgctacac ttgccagcgc cctagcgccc gctcctttcg ctttcttccc ttcctttctc 60
gccacgttcg ccgg 74
<210> 6
<211> 64
<212> DNA
<213>artificial sequence
<400> 6
accgctacac ttgccagcgc cctagcgccc gctcctttcg ctttcttctc gccacgttcg 60
ccgg 64
<210> 7
<211> 54
<212> DNA
<213>artificial sequence
<400> 7
accgctacac ttgccagcgc cctagcgccc gctcctttcg ctttcgttcg ccgg 54
<210> 8
<211> 44
<212> DNA
<213>artificial sequence
<400> 8
accgctacac ttgccagcgc cctagcgccg ctttcgttcg ccgg 44
<210> 9
<211> 34
<212> DNA
<213>artificial sequence
<400> 9
accgctacac ttgccagcgc gccacgttcg ccgg 34
<210> 10
<211> 12
<212> DNA
<213>artificial sequence
<400> 10
agcggtccgg cg 12
<210> 11
<211> 64
<212> DNA
<213>artificial sequence
<400> 11
ccgctacact tgccagcgcc ctagcgcccg ctcctttcgc tttcttctcc ccattttcgc 60
cgga 64
<210> 12
<211> 64
<212> DNA
<213>artificial sequence
<400> 12
accgctacac ttgccagcgc cctagcgccc gctcctttcg ctttcttctc cccattttcg 60
ccgg 64
<210> 13
<211> 64
<212> DNA
<213>artificial sequence
<400> 13
gaccgctaca cttgccagcg ccctagcgcc cgctcctttc gctttcttct ccccattttc 60
gccg 64
<210> 14
<211> 64
<212> DNA
<213>artificial sequence
<400> 14
ggaccgctac acttgccagc gccctagcgc ccgctccttt cgctttcttc tccccatttt 60
cgcc 64
<210> 15
<211> 64
<212> DNA
<213>artificial sequence
<400> 15
cggaccgcta cacttgccag cgccctagcg cccgctcctt tcgctttctt ctccccattt 60
tcgc 64
<210> 16
<211> 12
<212> DNA
<213>artificial sequence
<400> 16
tagcggtccg gc 12
<210> 17
<211> 12
<212> DNA
<213>artificial sequence
<400> 17
agcggtccgg cg 12
<210> 18
<211> 12
<212> DNA
<213>artificial sequence
<400> 18
gcggtccggc ga 12
<210> 19
<211> 12
<212> DNA
<213>artificial sequence
<400> 19
cggtccggcg aa 12
<210> 20
<211> 12
<212> DNA
<213>artificial sequence
<400> 20
ggtccggcga aa 12
<210> 21
<211> 64
<212> DNA
<213>artificial sequence
<400> 21
cgctacactt gccagcgccc actagcgccc gctcctttcg ctttcttctc cccattttcg 60
ccgg 64
<210> 22
<211> 64
<212> DNA
<213>artificial sequence
<400> 22
ggcgctacac ttgccagcgc cctagcgccc gctcctttcg ctttcttctc cccattttcg 60
ccgg 64
<210> 23
<211> 64
<212> DNA
<213>artificial sequence
<400> 23
ggcgcgccac ttgcgcgcgc cctagcgccc gctcctttcg ctttcttctc cccattttcg 60
ccgg 64
<210> 24
<211> 60
<212> DNA
<213>artificial sequence
<400> 24
ggcgcgcgaa gcgcgcccta gcgcccgctc ctttcgcttt cttctcccca ttttcgccgg 60
<210> 25
<211> 12
<212> DNA
<213>artificial sequence
<400> 25
gtagcgccgg cg 12
<210> 26
<211> 12
<212> DNA
<213>artificial sequence
<400> 26
agcgccccgg cg 12
<210> 27
<211> 12
<212> DNA
<213>artificial sequence
<400> 27
cgcgccccgg cg 12
<210> 28
<211> 54
<212> RNA
<213>artificial sequence
<400> 28
cugcuguugu ucccuuauaa uuuccuccuc cauaguuucc uucugaguug uguu 54
<210> 29
<211> 16
<212> DNA
<213>artificial sequence
<400> 29
aacagcagaa cacaac 16
Claims (10)
1. a kind of preparation method of single stranded circular nucleic acid, which is characterized in that the preparation method includes:
Linked enzyme connection is closed the linear nucleic acid both ends after hybridizing with cyclization auxiliary chain, obtains the single stranded circular nucleic acid；
Wherein, the linear nucleic acid has hairpin structure, and the hairpin structure is located at the linear nucleic acid and the cyclization assists
At the hybridization of chain；
The cyclization auxiliary chain is complementary with 3 ' ends of the linear nucleic acid and 5 ' ends.
2. preparation method according to claim 1, which is characterized in that the linear nucleic acid is subjected to Sketch of secondary structure,
It selects at hybridization of the stable hairpin structure as the linear nucleic acid.
3. preparation method according to claim 1, which is characterized in that the length of the linear nucleic acid is 40-200nt, excellent
It is selected as 44-200nt, more preferably 54-200nt.
4. preparation method according to claim 1, which is characterized in that the T of the hairpin structuremValue is higher than connection reaction temperature
10-60 DEG C of degree preferably more than connects 20-40 DEG C of reaction temperature.
5. preparation method according to claim 1-4, which is characterized in that assist the linear nucleic acid, cyclization
Chain, ligase and connection buffer are mixed into same linked system, are attached reaction；
Preferably, the time of the connection reaction is 1-5 hours；
Preferably, the buffer of the connection enzyme reaction is 0.1-1 times of standard buffer solution.
6. preparation method according to claim 5, which is characterized in that the ligase is that can connect double-stranded DNA, double-strand
The ligase of notch in RNA or DNA-RNA hybridization chain；
Preferably, the ligase be T4 DNA ligase, T4 RNA ligase, T3 DNA ligase, T7 DNA ligase or
Any one in E.coli DNA ligase.
7. preparation method according to claim 5, which is characterized in that the concentration of the linear nucleic acid is 1-100 μM, preferably
It is 5-50 μM.
8. preparation method according to claim 5, which is characterized in that the linear nucleic acid rubs with the cyclization auxiliary chain
You are than being 1:1-5, preferably 1:1-3.
9. the single stranded circular nucleic acid being prepared using the described in any item preparation methods of claim 1-8.
10. single stranded circular nucleic acid as claimed in claim 9 is opened up in building nano material, rolling circle amplification, foodstuff traceability or nucleic acid
Flutter one of structural research or it is a variety of in application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810734128.9A CN109161572B (en) | 2018-07-05 | 2018-07-05 | Single-stranded circular nucleic acid, and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810734128.9A CN109161572B (en) | 2018-07-05 | 2018-07-05 | Single-stranded circular nucleic acid, and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109161572A true CN109161572A (en) | 2019-01-08 |
| CN109161572B CN109161572B (en) | 2021-11-12 |
Family
ID=64897383
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810734128.9A Active CN109161572B (en) | 2018-07-05 | 2018-07-05 | Single-stranded circular nucleic acid, and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109161572B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110724728A (en) * | 2019-10-12 | 2020-01-24 | 深圳清华大学研究院 | Preparation method of circular DNA |
| CN111321143A (en) * | 2020-02-16 | 2020-06-23 | 中国海洋大学 | Method for preparing circular RNA |
| CN111793619A (en) * | 2020-06-04 | 2020-10-20 | 中国海洋大学 | Preparation method of single-stranded circular DNA |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005010159A2 (en) * | 2003-07-17 | 2005-02-03 | Children's Hospital Medical Center | Rolling circle amplification of micro-rna samples |
| CN101238221A (en) * | 2005-04-12 | 2008-08-06 | 现场Rcp公司 | Methods for production of oligonucleotides |
| CN104212791A (en) * | 2013-06-03 | 2014-12-17 | 无锡青兰生物科技有限公司 | Nucleic acid synthesis method based on bidirectional isothermal extension |
| CN104919057A (en) * | 2012-11-14 | 2015-09-16 | 欧凌科公司 | Localised rca-based amplification method |
| CN105392901A (en) * | 2013-07-26 | 2016-03-09 | 通用电气公司 | Ligase-assisted nucleic acid circularization and amplification |
| CN107267499A (en) * | 2017-06-22 | 2017-10-20 | 中国海洋大学 | Prepare cyclic DNA or RNA method |
| CN107663530A (en) * | 2017-11-10 | 2018-02-06 | 中国海洋大学 | A kind of single-chain nucleic acid detection kit, method and its application |
| CN108060191A (en) * | 2017-11-07 | 2018-05-22 | 深圳华大基因科技有限公司 | A kind of method, library constructing method and the kit of double stranded nucleic acid fragment adjunction head |
| WO2018119402A1 (en) * | 2016-12-23 | 2018-06-28 | Visterra, Inc. | Binding polypeptides and methods of making the same |
-
2018
- 2018-07-05 CN CN201810734128.9A patent/CN109161572B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005010159A2 (en) * | 2003-07-17 | 2005-02-03 | Children's Hospital Medical Center | Rolling circle amplification of micro-rna samples |
| CN101238221A (en) * | 2005-04-12 | 2008-08-06 | 现场Rcp公司 | Methods for production of oligonucleotides |
| CN104919057A (en) * | 2012-11-14 | 2015-09-16 | 欧凌科公司 | Localised rca-based amplification method |
| CN104212791A (en) * | 2013-06-03 | 2014-12-17 | 无锡青兰生物科技有限公司 | Nucleic acid synthesis method based on bidirectional isothermal extension |
| CN105392901A (en) * | 2013-07-26 | 2016-03-09 | 通用电气公司 | Ligase-assisted nucleic acid circularization and amplification |
| WO2018119402A1 (en) * | 2016-12-23 | 2018-06-28 | Visterra, Inc. | Binding polypeptides and methods of making the same |
| CN107267499A (en) * | 2017-06-22 | 2017-10-20 | 中国海洋大学 | Prepare cyclic DNA or RNA method |
| CN108060191A (en) * | 2017-11-07 | 2018-05-22 | 深圳华大基因科技有限公司 | A kind of method, library constructing method and the kit of double stranded nucleic acid fragment adjunction head |
| CN107663530A (en) * | 2017-11-10 | 2018-02-06 | 中国海洋大学 | A kind of single-chain nucleic acid detection kit, method and its application |
Non-Patent Citations (4)
| Title |
|---|
| DAVID BIKARD等: "Folded DNA in action: Hairpin formation and biological functions in prokaryotes", 《MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS》 * |
| KUHN H等: "Template-independent ligation of single-stranded DNA by T4 DNA ligase", 《FEBS JOURNAL》 * |
| RAN AN等: "High efficient preparation of single-stranded DNA rings by T4 ligase at abnormally low Mg(II) concentration", 《NUCLEIC ACIDS RESEARCH》 * |
| 范慧君等: "DNA模板中发卡结构对定量PCR扩增的影响", 《生物技术》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110724728A (en) * | 2019-10-12 | 2020-01-24 | 深圳清华大学研究院 | Preparation method of circular DNA |
| CN110724728B (en) * | 2019-10-12 | 2023-06-06 | 深圳清华大学研究院 | Preparation method of circular DNA |
| CN111321143A (en) * | 2020-02-16 | 2020-06-23 | 中国海洋大学 | Method for preparing circular RNA |
| CN111793619A (en) * | 2020-06-04 | 2020-10-20 | 中国海洋大学 | Preparation method of single-stranded circular DNA |
| CN111793619B (en) * | 2020-06-04 | 2022-01-07 | 中国海洋大学 | Preparation method of single-stranded circular DNA |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109161572B (en) | 2021-11-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109161572A (en) | Single stranded circular nucleic acid and its preparation method and application | |
| CN104164488B (en) | A kind of nucleic acid constant-temperature amplification method that single primer causes | |
| CN103789435A (en) | Cascading isothermal amplification based miRNA fluorescence detection kit and miRNA fluorescence detection method | |
| JP2019509015A (en) | Improved adapters, methods, and compositions for double-stranded sequencing | |
| CN104212791B (en) | A kind of nucleic acid synthesis methods extended based on two-way isothermal | |
| EP2484687A3 (en) | Methods and compositions for seamless cloning of nucleic acid molecules | |
| JPH06510669A (en) | Nucleic acid extension assay | |
| CN106282173B (en) | In cloned, transgenic biology at exogenous origin gene integrator site flanking sequence method | |
| JP2020536525A (en) | A method for concentrating the probe and the target region to which it is applied for high-throughput sequencing | |
| CN107904667A (en) | A kind of new methylate builds storehouse kit and its application | |
| JP2023519953A (en) | Class 2 type II CRISPR system | |
| CN104560905B (en) | A kind of thioether monooxygenase and its synthesis application from pseudomonad | |
| CN109355290B (en) | Plant circular RNA expression frame and application thereof | |
| WO2002029006A3 (en) | Methods for parallel measurement of genetic variations | |
| CN110724728B (en) | Preparation method of circular DNA | |
| Darlix et al. | Nucleotide sequence and structure of cytoplasmic 5S RNA and 5.8 S RNA of Chlamydomonas reinhardii | |
| US9695417B2 (en) | Method for large-scale synthesis of long-chain nucleic acid molecule | |
| CN101550449B (en) | Method for analyzing diversity of biological enzyme genes in compost | |
| CN109706233A (en) | A kind of amplification technique of complexity long-fragment nucleic acid sequence | |
| CN104357438B (en) | DNA assembling and cloning method | |
| CN104212827A (en) | Quick molecular cloning method independent of bioengineering enzyme | |
| CN107312788A (en) | A kind of construction method of TALE repetitive sequences carrier | |
| CN108517369B (en) | Method for improving accuracy of fungus community detection by using carbon-based nano material | |
| Aupeix et al. | Binding of chemically-modified oligonucleotides to the double-stranded stem of an RNA hairpin | |
| CN111434771A (en) | Plasmid construction method for self-recombination of linearized vector |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |