CN107267499A - Prepare cyclic DNA or RNA method - Google Patents
Prepare cyclic DNA or RNA method Download PDFInfo
- Publication number
- CN107267499A CN107267499A CN201710479312.9A CN201710479312A CN107267499A CN 107267499 A CN107267499 A CN 107267499A CN 201710479312 A CN201710479312 A CN 201710479312A CN 107267499 A CN107267499 A CN 107267499A
- Authority
- CN
- China
- Prior art keywords
- dna
- loop chain
- rna
- ligase
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
Landscapes
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention belongs to nucleic acid field, and in particular to a kind of preparation method of high concentration cyclic DNA or RNA.Comprise the following steps：The buffer solution of auxiliary template DNA (lower to be referred to as splint) needed for annulation, ligase, ligase is hybridly prepared into initial system；By the buffer of single stranded DNA or RNA (under be referred to as into loop chain) and ligase into annex solution；At interval of certain time, a certain amount of annex solution containing into loop chain is added into initial system, every time addition it is new into after loop chain, the concentration in system into loop chain increases by 0.1 5 μM, is so repeated several times；After last time is added containing the annex solution into loop chain, then react 2 15h；Splint and the concentration mol ratio into loop chain are (1 10) in system:1.Method is simple to operation, is not required to exacting terms, and can realize superelevation under loop chain concentration (>=10 μM), prepared by the high yield of cyclic DNA or RNA rings.
Description
Technical field
The invention belongs to nucleic acid field, and in particular to a kind of preparation method of cyclic DNA or RNA.
Background technology
Nanometer technology is a kind of the new of controllable nano-scale structures or machinery to be built up using molecule or atom
Technology.Nucleic acid turns into the common used material in nanometer technology because of characteristics such as its sequence programmability, ease for operation and self assemblies.With
The fast development of nucleic acid self-assembled nanometer technology, cyclic DNA or RNA interlocking are increasingly becoming in nucleic acid nano technology except two dimension
With another important branch outside three dimensional DNA paper folding.This cause cyclic DNA or RNA characteristic and its topological structure feature gradually into
For focus of concern.In addition, to the research of cyclic DNA or RNA property and topological structure also with DNAzyme and
The research such as RNAzyme catalysis characteristics, rolling circle amplification is closely related.
However, the common issue that these researchs face is how to obtain substantial amounts of single cyclic DNA or RNA.
Common cyclic method be DNA profiling chain auxiliary enzyme process connection cyclization, i.e., by one with DNA or RNA into loop chain two ends all
Complementary short chain DNA profiling will be connected to form cyclic DNA by ligase by into the end to end of loop chain into the two ends of loop chain
Or RNA (Fig. 1).But in ringed systems, single stranded DNA or RNA also can while intramolecular connects to form unimolecule ring
There is intermolecular connection, formed by a plurality of DNA or RNA single strand end to end larger polymolecular is linear or cyclic DNA
Or RNA (lower to be referred to as macromolecular accessory substance), so as to substantially reduce the yield of unimolecule ring.Also, as DNA or RNA single strand are dense
The rise of degree, the ratio regular meeting of accessory substance is sharply increased, and substantially reduces monocyclic DNA or RNA yield.It is reported that with ring-type
DNA in the experiment of research object, it is most of be all by under conditions of low concentration substrate (≤0.5 μM) prepare cyclic DNA,
To reduce generation (J.Am.Chem.Soc., the 2008,130,10882-10883 of accessory substance；Nat.Commun.,2016,7.).
But, later stage cumbersome concentration and purification step is so accomplished by obtain single cyclic DNA, and yield is relatively low.Therefore, control
The cyclization process of DNA or RNA chains processed simultaneously improves the yield of unimolecule ring and becomes particularly important.
Obviously, if cyclic DNA under high concentration substrate or RNA yield can be improved or even almost no coupling product is obtained
Cyclic DNA or RNA will be such that it studies and using greatly simplifying, and detailed research can be not only carried out to its topological structure, also may be used
Substantial amounts of research material is provided for the research such as cyclic DNA or RNA interlockings and rolling circle amplification.
The content of the invention
Sharply increased for macromolecular accessory substance present in DNA or RNA annulation process with the increase of concentration of substrate,
Single cyclic DNA or RNA low yield, the problem of post-processing steps are cumbersome, the invention provides a kind of cyclic DNA or RNA
Preparation method, DNA profiling chain aid in enzyme process connection cyclization during, can reduce or prevent higher concentration single stranded DNA or
The generation of macromolecular accessory substance in RNA annulation process, improves the yield of DNA circle or RNA rings.
The technical solution adopted by the present invention is as follows：
1. a kind of prepare cyclic DNA or RNA method, it is characterised in that comprises the following steps：
Step one, by the auxiliary template DNA (lower to be referred to as splint) needed for annulation, ligase and connection enzyme reaction
Buffer solution is hybridly prepared into initial system；By the single stranded DNA or RNA (under be referred to as into loop chain) of 3 ' or 5 ' end phosphorylation modifications
In a kind of and above-mentioned buffer into annex solution；
Step 2, adds a certain amount of annex solution into initial system, addition into loop chain by splint formation ring-types
Molecule, certain interval of time after existing major part in system is cyclic into loop chain, adds annex solution, addition is new every time again
Into after loop chain, the concentration in system into loop chain increases 0.1-5 μM, is so repeated several times；
Step 3, after last time is added containing the annex solution into loop chain, then reacts 2-15h；
In initial system splint molar concentration with into the ratio between molar concentration of loop chain be (1-10):1.
Further, the interval time added twice between annex solution in step 2 is 10-60min.
Further, reaction terminate ring molecule in rear final system, into loop chain and accessory substance total concentration for 1 μM-
30μM。
Further, the length 25-200nt into loop chain.
Further, the concentration in described annex solution into loop chain is 1-100 μM.
Further, the ligase described in step one hybridizes chain for that can connect double-stranded DNA, double-stranded RNA or DNA-RNA
In notch ligase.
Further, the ligase described in step one is T4DNA Ligase, T4RNA Ligase, Taq DNA
Any one in Ligase, T3DNA Ligase, T7DNA Ligase, E.coli DNA Ligase.
Further, the buffer concentration of the connection enzyme reaction is 0.1~1 times of normal concentration.
Further, the buffer solution composition of the connection enzyme reaction is 20-40mM Tris-HCl (25 DEG C of pH7-8),
10mM MgCl2,DTT,0.5-1mM ATP。
Further, the buffer solution composition of the connection enzyme reaction is 30mM Tris-HCl (8.0 25 DEG C of pH), 4mM
MgCl2, 1mM DTT,26μM NAD+。
DNA in the present invention both includes the single stranded DNA that RNA sequence is embedded with single stranded DNA, in addition to strand into loop chain.
In initial system, splint is 1 with the mol ratio into loop chain:1-10:1, splint is less than single stranded DNA or RNA
When, a plurality of DNA or RNA chains share a splint, can promote the generation of macromolecular accessory substance, when splint is excessive, one into
Loop chain two ends can influence the efficiency of connection with two splint.The species and concentration of described buffer solution need to be adapted to connect accordingly
The reaction of enzyme is connect, and contains the coenzyme such as the ion and ATP needed for ligase.
A certain amount of annex solution containing into loop chain is added into initial system, makes it cyclic at low concentrations, when in system
Existing major part into loop chain cyclization after add it is new into loop chain, so that the concentration in system into loop chain is remained at
Relatively low level, and the purpose to form high concentration cyclic DNA or RNA is reached, the method is referred to as successive addition method.
The interval time for adding annex solution is 10-60min, and the time is too short, be insufficient to allow in system existing major part into
Loop chain cyclization, overlong time can increase the duration of experiment；Every time addition it is new into after loop chain, into the concentration of loop chain in system
0.1-5 μM of increase, increase concentration is too high make it that macromolecular accessory substance is more, and increase concentration is too low, causes what is finally given
The concentration of DNA or RNA rings is too low.The addition number of times of annex solution is selected according to actual conditions, is usually added into number of times for 2-30 times.
Into length >=25nt of loop chain, preferably 30-100nt.If can be due to DNA or RNA rigid mistake if too short into loop chain
Cyclization is difficult by force, and for longer DNA or RNA chains, macromolecular accessory substance itself is less, it is not necessary to use this method.
, it is necessary to purify when very high to the purity requirement of cyclic DNA or RNA.The purification process includes：Glue is cut with PAGE
Reclaim, HPLC purifying, or not cyclized DNA or RNA is removed with excision enzyme, phenol-chloroform extracts removing protein, then dense with ethanol precipitation
Gel extraction is directly used in contracting, with enriching and purifying cyclic DNA or RNA.
Relative to existing once-through method cyclization, the present invention prepares cyclic DNA or RNA method is simple to operation, is not required to severe
The condition at quarter, and superelevation can be realized under loop chain concentration (>=10 μM), it is prepared by the high yield of cyclic DNA or RNA rings.Therefore can
Experiment material to provide abundance by the research of research object of cyclic DNA or RNA for nanostructured or rolling circle amplification etc..This
Outside, for some single stranded DNAs or RNA for being easier to cyclization, this method can also almost prevent the generation of macromolecular accessory substance, directly
To the higher single cyclic DNA or RNA of concentration, therefore follow-up needs the purification steps such as simple alcohol precipitation just to can be used directly,
It enormously simplify cyclic DNA or RNA preparation process.
Brief description of the drawings
The cyclic schematic diagram of enzyme process connection and macromolecular accessory substance schematic diagram of Fig. 1 DNA profilings chain auxiliary；
The operation chart of Fig. 2 successive addition methods；
Fig. 3 embodiments 1 once into it is around-France to various concentrations into loop chain cyclic result figure；
Fig. 4 embodiments 1 are once into around-France and successive addition method results contrast figure；
The digestion result figure for the DNA circle that Fig. 5 embodiments 1 are generated；
Fig. 6 embodiments 2 are once into around-France and successive addition method results contrast figure；
Fig. 7 embodiments 3 are once into around-France and successive addition method results contrast figure；
Fig. 8 embodiments 4 are once into around-France and successive addition method results contrast figure；
Fig. 9 embodiments 5 are once into around-France and successive addition method results contrast figure；
Figure 10 embodiments 6 are once into around-France and successive addition method results contrast figure；
Figure 11 embodiments 7 are once into around-France and successive addition method results contrast figure；
Figure 12 embodiments 8 are once into around-France and successive addition method results contrast figure.
Embodiment
The present invention is described in further details with reference to specific embodiment and accompanying drawing.
What following embodiments were used is purchased from Suzhou Jin Weizhi bio tech ltd into loop chain and auxiliary template DNA,
To be artificial synthesized；T4DNA ligase and 10 × T4ligase buffer are purchased from U.S. match Mo Feishier company (Thermo
Scientific)；Other chemical combination articles for use are purchased from U.S.'s Sigma-Aldrich (Sigma-Aldrich).
Embodiment 1
1) raw material
Into loop chain (5 ' → 3 ')：TCAGTGTTTTTTTCGTCGATTGCAGTAACTCCCCACAACCTCTTTTT
(5 '-phosphorylation, length is 66nt, SEQ ID NO to CGATGCTTTTTTTGTGCGA：1)
Restriction enzyme site T containing Taq I on into loop chain↓CGA, therefore the shape for determining DNA circle can be subsequently tested by digestion
Into.
splint(5’→3’)：CACTGATCGCAC (length is 12nt, SEQ ID NO：2)
Source：Artificial synthesized (Suzhou Jin Weizhi bio tech ltd)
2) cyclization is connected
Once-through method cyclization：It will be disposably added into loop chain in reaction system, during original state, into the dense of loop chain in system
Spend for 10 μM or 30 μM, the mol ratio into loop chain and splint is 1:2,2.5U T4DNA Ligase/ μM into loop chain, 1 ×
T4 DNA ligases buffer solution (Ligase Buffer), the μ L of cumulative volume 20；8h is connected under the conditions of 20 DEG C.
1 × T4DNA Ligase Buffer are constituted：40mM Tris-HCl(pH7.8@25℃),10mM MgCl2,10mM
DTT, 0.5mM ATP。
Successive addition method cyclization：
By auxiliary template DNA (lower to be referred to as splint), ligase and the buffer solution for connecting enzyme reaction needed for annulation
Initial system is hybridly prepared into, the initial system is containing 40 μM of splint, 1 × T4DNA Ligase Buffer, 50U T4DNA
Ligase, cumulative volume is 20 μ L.Prepare containing 20 μM into loop chain, 1 × T4DNA Ligase Buffer annex solution, cumulative volume is
20μL.Under the conditions of 20 DEG C of warm bath, add 2 μ L annex solutions into initial system, addition into loop chain by splint formation ring-types
Molecule, is spaced existing major part in 15min, system and, into loop chain cyclization, annex solution is added again, so add 10 times repeatedly
Afterwards, 8h is connected under the conditions of 20 DEG C.
Initial system and annex solution are prepared with reference to the above method.The initial system is containing 120 μM of splint, 1 × T4DNA
Ligase Buffer, 100U T4DNA Ligase, cumulative volume is 20 μ L.Annex solution contains 60 μM into loop chain, 1 × T4DNA
Ligase Buffer, cumulative volume is 20 μ L.Under the conditions of 20 DEG C of warm bath, 2 μ L annex solutions are added into initial system, are spaced
Existing major part adds annex solution again into loop chain cyclization in 15min, system, after so adding 10 times repeatedly, 20 DEG C of conditions
8 h of lower connection.
3) electrophoresis detection
11% urea-denatured polyacrylamide gel electrophoresis detection is carried out to the cyclic result under different Single stranded DNA concentrations,
And the yield of DNA circle is quantified by band brightness using Image Lab softwares.Fig. 3 for various concentrations single stranded DNAs into
Ring result.As a result show, compared to single stranded DNA, the electrophoretic velocity of DNA circle is substantially slack-off, illustrate that coupled reaction is completed.In addition,
The concentration of single stranded DNA is higher, and the yield of DNA circle is lower, and macromolecular accessory substance is more.
Fig. 4 is the comparison that cyclization and once-through method cyclization are carried out using successive addition method.As a result show, successive addition method can be with
Substantially reduce the generation of accessory substance.When the concentration of single stranded DNA is 10 μM, the yield of the cyclic DNA circle of once-through method is used for 56%,
Using successive addition method, the yield of DNA circle brings up to 89%；When the concentration of single stranded DNA is 30 μM, using once-through method DNA circle
Yield be 27%, using successive addition method, the yield of DNA circle brings up to 64%.
4) purifying confirms with digestion
DNA circle is purified by gel extraction, and has obtained single DNA circle band (Fig. 5) after purification.To be true
The band recognized is DNA circle, uses restriction endonuclease FastdigestTMTaq I carry out digestion to DNA circle.Digestion system： 1μM
DNA circle, the complementary strand of 1 μM of ring, 1 × Fastdigest after purificationTMBuffer, 1FDU FastdigestTMTaq I, it is overall
20 μ L of product；65 DEG C of digestion 30min.Fig. 5 results show that the electrophoretic band after digestion is single and position is consistent with single stranded DNA, says
The bright obtained DNA that purifies is DNA circle really.
Embodiment 2
1) raw material
Into loop chain A (5 ' → 3 ')：TAAGACACGTTGAGTTACATGAGCATCGTTCACAGCTCTATAGT GGCCTATT
(5 '-phosphorylation, length is 52nt, SEQ ID NO：3)
splint A(5’→3’)：(length is 14nt, SEQ ID NO to GTCTTAAATAGGCC：4)
Into loop chain B (5 ' → 3 ')：GAATTAACGACTTAGAGCTGTGCTTCTCCAGTAATTTTTTTTTT TTAGTCTC
(5 '-phosphorylation, length is 52nt, SEQ ID NO：5)
splint B(5’→3’)：(length is 12nt, SEQ ID NO to TAATTCGAGACT：6)
Source：Artificial synthesized (Suzhou Jin Weizhi bio tech ltd)
2) cyclization is connected
Once-through method cyclization：To disposably be added in system and be reacted into loop chain, during the system original state containing 5 μM into
Loop chain DNA, 5 μM of splint, 10U T4DNA Ligase, 2 × T4DNA Ligase Buffer, the μ L of cumulative volume 20；16 DEG C of companies
Meet 4h.
1 × T4DNA Ligase Buffer are constituted：40mM Tris-HCl(pH7.8@25℃),10mM MgCl2,10mM
DTT, 0.5mM ATP。
Successive addition method cyclization：The successive addition method of reference implementation example 1, prepares initial system and annex solution.Initial system contains
10 μM of splint, 2 × T4DNA Ligase Buffer, 20U T4DNA Ligase, cumulative volume are 20 μ L.Annex solution contains 10 μM
Into loop chain, 2 × T4DNA Ligase Buffer, cumulative volume is 20 μ L.Under the conditions of 16 DEG C of warm bath, every 20min to initial system
4 μ L annex solutions of middle addition, after adding 5 times, 16 DEG C of connection 4h.
3) electrophoresis detection
Fig. 6 is comparison (the 12% urea-denatured polyacrylamide that cyclization and once-through method cyclization are carried out using successive addition method
Gel electrophoresis).As a result show, equal length but two different cyclic yields into loop chain of sequence are different greatly.Once-through method into
During ring, the yield into loop chain A is 17%, is far smaller than into loop chain B cyclic yield (62%).But all may be used by successive addition method
To substantially reduce two generations into the accessory substance of loop chain, the cyclic yield for making into loop chain A and B is respectively increased to 90% He
92%.
Embodiment 3
1) raw material
Into loop chain (5 ' → 3 ')：AACCGTGCGTGCGTGCGGATCAACTAATACGACTCATCATAA (5 '-phosphorylation,
Length is 42nt, SEQ ID NO：7)
splint(5’→3’)：(length is 12nt, SEQ ID NO to ACGGTTTTATGA：8)
Source：Artificial synthesized (Suzhou Jin Weizhi bio tech ltd)
2) cyclization is connected
Once-through method cyclization：It will be disposably added into loop chain in reaction system, 4 μM are contained during the system original state into loop chain
DNA, 20 μM of splint, 10U T4DNA Ligase, 0.5 × T4DNA Ligase Buffer, the μ L of cumulative volume 20；22 DEG C of conditions
Lower connection 8h.
1 × T4DNA Ligase Buffer are constituted：40mM Tris-HCl(pH7.8@25℃),10mM MgCl2,10mM
DTT, 0.5mM ATP。
Successive addition method cyclization：The preparation process of the successive addition method of reference implementation example 1, prepares initial system and annex solution.
The initial system is containing 40 μM of splint, and 0.5 × T4DNA Ligase Buffer, 40U T4DNA Ligase, cumulative volume is 20 μ
L.The annex solution is containing 8 μM into loop chain, and 0.5 × T4DNA Ligase Buffer, cumulative volume is 20 μ L.Under the conditions of 22 DEG C of warm bath, often
2 μ L annex solutions are added into initial system every 15min, after adding 10 times, 22 DEG C of connection 8h.
3) electrophoresis detection
Fig. 7 is that using the comparison cyclic with once-through method of successive addition method progress cyclization, (15% is urea-denatured into loop chain by 42nt
Polyacrylamide gel electrophoresis).As a result show, successive addition method can substantially reduce the generation of accessory substance, make the yield of DNA circle
Improved from 27% to 70%.
Embodiment 4
1) raw material
Into loop chain (5 ' → 3 ')：ACAACGAAAGTAGCAGAAAUACAGGTATCTAGGCTAGCT (5 '-phosphorylation, it is long
Spend for 39nt, SEQ ID NO：9)
Underscore part is RNA sequence
splint(5’→3’)：(length is 13nt, SEQ ID NO to CGTTGTAGCTAGC：10)
Source：Artificial synthesized (Suzhou Jin Weizhi bio tech ltd)
2) cyclization is connected
Once-through method cyclization：It will be disposably added into loop chain in reaction system, containing 10 μM of cyclization during the system original state
Chain DNA, 20 μM of splint, 20U T4DNA Ligase, 0.1 × T4DNA Ligase Buffer, the μ L of cumulative volume 20；25℃
Under the conditions of connect 12h.
1 × T4DNA Ligase Buffer are constituted：40mM Tris-HCl(pH7.8@25℃),10mM MgCl2,10mM
DTT, 0.5mM ATP。
Successive addition method cyclization：The preparation process of the successive addition method of reference implementation example 1, prepares initial system and annex solution.
The initial system is containing 40 μM of splint, and 0.1 × T4DNA Ligase Buffer, 80U T4DNA Ligase, cumulative volume is 20 μ
L.Annex solution is containing 20 μM into loop chain, and 0.1 × T4DNA Ligase Buffer, cumulative volume is 20 μ L.Under the conditions of 25 DEG C of warm bath, often
2 μ L annex solutions are added into initial system every 30min, after adding 10 times, 25 DEG C of connection 12h.
3) electrophoresis detection
Fig. 8 is that using the comparison cyclic with once-through method of successive addition method progress cyclization, (10% is urea-denatured into loop chain by 39nt
Polyacrylamide gel electrophoresis).As a result show, annulation is had no effect on containing part RNA sequence in DNA, and gradually
Addition method can substantially reduce the generation of accessory substance, the yield of DNA circle is improved from 1% to 47%.
Embodiment 5
1) raw material
Into loop chain (5 ' → 3 ')：UCUGGACCGGUCGAUGUAUGUCUUGCACACGUGUACUCUUAAGC
(5 '-phosphorylation, length is 65nt, SEQ ID NO to AACAGUUACUGCGACGUGAAA：11)
This into loop chain be RNA sequence
splint(5’→3’)：(length is 16nt, SEQ ID NO to GGTCCAGATTTCACGT：12)
Source：Artificial synthesized (Suzhou Jin Weizhi bio tech ltd)
2) cyclization is connected
Once-through method cyclization：It will be disposably added into loop chain in reaction system, 1 μM is contained during the system original state into loop chain
DNA, 2 μM of splint, 10U T4RNA Ligase, 1 × T4RNA Ligase Buffer, the μ L of cumulative volume 20；37 DEG C of connection 2h.
1 × T4RNA Ligase Buffer are constituted：50mM Tris-HCl(pH7.5@25℃),10mM MgCl2,10mM
DTT, 1mM ATP。
Successive addition method cyclization：The preparation process of the successive addition method of reference implementation example 1, prepares initial system and annex solution.
Initial system is containing 4 μM of splint, and 1 × T4RNA Ligase Buffer, 4U T4RNA Ligase, cumulative volume is 20 μ L.Addition
Liquid is containing 2 μM into loop chain, and 1 × T4RNA Ligase Buffer, cumulative volume is 20 μ L.Under the conditions of 37 DEG C of warm bath, every 15min to
2 μ L annex solutions are added in initial system, after adding 10 times, 37 DEG C of connection 2h.
3) electrophoresis detection
Fig. 9 is comparison (15% urea that 65nt RNA carry out cyclization and once-through method cyclization into loop chain using successive addition method
Denaturing polyacrylamide gel electrophoresis).As a result show, it is secondary in annulation process that successive addition method can substantially reduce single stranded RNA
The generation of product, makes the yields of RNA rings be improved from 68% to close to 100%.But successive addition method cyclization still has some substrates
Residue, the later stage can cut off single stranded RNA to obtain purer RNA rings by using excision enzyme.
Embodiment 6
1) raw material
Into loop chain A (5 ' → 3 ')：CACCTCGCTTTCAACTTACAATGCGTGCGTGCGGTCTAATACGAC
(5 '-phosphorylation, length is 74nt, SEQ ID NO to TCACTATAAATCGAACATCAGCAAACGGA：13)
splint A(5’→3’)：(length is 12nt, SEQ ID NO to GAGGTGTCCGTT：14)
Into loop chain B (5 ' → 3 ')：TCCGTTTGCTGATGTTCGATTTATAGTGAGTCGTATTAGACCGCA
(5 '-phosphorylation, length is 74nt, SEQ ID NO to CGCACGCATTGTA AGTTGAAAGCGAGGTG：15)
splint B(5’→3’)：(length is 12nt, SEQ ID NO to AACGGACACCTC：16)
Source：Artificial synthesized (Suzhou Jin Weizhi bio tech ltd)
2) cyclization is connected
Once-through method cyclization：It will be disposably added into loop chain in reaction system, 2 μM are contained during the system original state into loop chain
DNA, 2 μM of splint, 5U T4DNA Ligase, 0.2 × T4DNA Ligase Buffer, the μ L of cumulative volume 20；30 DEG C of connections
2h。
1 × T4DNA Ligase Buffer are constituted：40mM Tris-HCl(pH7.8@25℃),10mM MgCl2,10mM
DTT, 0.5mM ATP。
Successive addition method cyclization condition：The preparation process of the successive addition method of reference implementation example 1, prepares initial system and addition
Liquid.Initial system is containing 4 μM of splint, and 0.2 × T4DNA Ligase Buffer, 20U T4DNA Ligase, cumulative volume is 20 μ
L.Annex solution is containing 4 μM into loop chain, and 0.2 × T4DNA Ligase Buffer, cumulative volume is 20 μ L.Under the conditions of 30 DEG C of warm bath, every
15min adds 1 μ L annex solutions into initial system, after adding 20 times, 30 DEG C of connection 2h.
3) electrophoresis detection
Figure 10 is comparison (the 10% urea-denatured polyacrylamide that cyclization and once-through method cyclization are carried out using successive addition method
Gel electrophoresis).As a result show, the generation of accessory substance can be suppressed by successive addition method into loop chain A and into loop chain B, respectively
Cyclic yield is improved to close to 100% from 82% and 38%, so as to obtain single DNA circle band, therefore product be not required to through
Cross purifying or just can be used directly by simple alcohol precipitation.
Embodiment 7
1) raw material
Into loop chain (5 ' → 3 ')：TCAGTGTTTTTTCAGTAACTCCCCACAACCTCTTTTTCGATGCAAAA
(5 '-phosphorylation, length is 59nt, SEQ ID NO to AAAATATGTGCGA：17)
splint(5’→3’)：(length is 12nt, SEQ ID NO to CACTGATCGCAC：18)
Source：Artificial synthesized (Suzhou Jin Weizhi bio tech ltd)
2) cyclization is connected
Once-through method cyclization：It will be disposably added into loop chain in reaction system, 1 μM is contained during the system original state into loop chain
DNA, 10 μM of splint, 5U E.coli DNA Ligase, 1 × E.coli DNA Ligase Buffer, the μ L of cumulative volume 20；
16 DEG C of connection 2h.
1 × E.coli DNA Ligase Buffer are constituted：30mM Tris-HCl(pH 8.0@25℃),4mM MgCl2,
1mM DTT,26μM NAD+。
Successive addition method cyclization：The preparation process of the successive addition method of reference implementation example 1, prepares initial system and annex solution.
Initial system is overall containing 20 μM of splint, 1 × E.coli DNA Ligase Buffer, 10U E.coli DNA Ligase
Product is 40 μ L.Annex solution is containing 2 μM into loop chain, and 1 × E.coli DNA Ligase Buffer, cumulative volume is 40 μ L.16 DEG C of warm bath
Under the conditions of, 2 μ L annex solutions are added into initial system every 20min, after adding 20 times, 16 DEG C of connection 2h.
3) electrophoresis detection
Figure 11 is comparison (the 12% urea-denatured polyacrylamide that cyclization and once-through method cyclization are carried out using successive addition method
Gel electrophoresis).As a result show, the yield of once-through method cyclization is 69%, and successive addition method can almost completely inhibit accessory substance
Produce, so that single DNA circle band (yield close to 100%) is obtained, therefore product is not required to by purifying or by simple
Alcohol precipitation just can be used directly.
Embodiment 8
1) raw material
Into loop chain (5 ' → 3 ')：TCCGTTTGCTGATGTTCGATTTATAGTGAGTCGTATTAGACCGCA
(5 '-phosphorylation, length is 74nt, SEQ ID NO to CGCACGCATTGTA AGTTGAAAGCGAGGTG：19)
splint(5’→3’)：(length is 18nt, SEQ ID NO to GCAAACGGACACCTCGCT：20)
Source：Artificial synthesized (Suzhou Jin Weizhi bio tech ltd)
2) cyclization is connected
Once-through method cyclization：It will be disposably added into loop chain in reaction system, 1 μM is contained during the system original state into loop chain
DNA, 2 μM of splint, 5U Taq DNA Ligase, 1 × Taq DNA Ligase Buffer, the μ L of cumulative volume 20；55 DEG C of connections
2h。
1 × Taq DNA Ligase Buffer are constituted：20mM Tris-HCl(pH 7.6@25℃),25mM KAc,10mM
Mg(Ac)2, 10mM DTT, 1mM NAD and 0.1%Triton X-100.
Successive addition method cyclization：The preparation process of the successive addition method of reference implementation example 1, prepares initial system and annex solution.
Initial system is containing 4 μM of splint, and 1 × Taq DNA Ligase Buffer, 10U Taq DNA Ligase, cumulative volume is 40 μ
L.Annex solution is containing 2 μM into loop chain, and 1 × Taq DNA Ligase Buffer, cumulative volume is 40 μ L.Under the conditions of 55 DEG C of warm bath, every
20min adds 2 μ L annex solutions into initial system, after adding 20 times, 16 DEG C of connection 2h.
3) electrophoresis detection
Figure 12 is comparison (the 8% urea-denatured polyacrylamide that cyclization and once-through method cyclization are carried out using successive addition method
Gel electrophoresis).As a result show, successive addition method can significantly inhibit the generation of cyclic accessory substance, by the yield of DNA circle from 64%
Bring up to 88%.Unreacted substrate in product, can be removed by exonuclease digestion.
Embodiment described above is only that the preferred embodiment of the present invention is described, not to the scope of the present invention
It is defined, on the premise of design spirit of the present invention is not departed from, those of ordinary skill in the art are to technical scheme
In the various modifications made and improvement, the protection domain that claims of the present invention determination all should be fallen into.
SEQUENCE LISTING
<110>Chinese Marine University
<120>Prepare cyclic DNA or RNA method
<130> 2017
<160> 20
<210> 1
<211> 66
<212> DNA
<213>Artificial sequence
<220>
<223>5'- phosphorylations
<400> 1
TCAGTGTTTT TTTCGTCGAT TGCAGTAACT CCCCACAACC TCTTTTT CGA TGCTTTTTTT 60
GTGCGA 66
<210> 2
<211> 12
<212> DNA
<213>Artificial sequence
<220>
<223>Template strand
<400> 2
CACTGATCGC AC 12
<210> 3
<211> 52
<212> DNA
<213>Artificial sequence
<220>
<223>5'- phosphorylations
<400> 3
TAAGACACGT TGAGTTACAT GAGCATCGTT CACAGCTCTA TAGTGGCCTA TT 52
<210> 4
<211> 14
<212> DNA
<213>Artificial sequence
<220>
<223>Template strand
<400> 4
GTCTTAAATA GGCC 14
<210> 5
<211> 52
<212> DNA
<213>Artificial sequence
<220>
<223>5'- phosphorylations
<400> 5
GAATTAACGA CTTAGAGCTG TGCTTCTCCA GTAATTTTTT TTTTTTAGTC TC 52
<210> 6
<211> 12
<212> DNA
<213>Artificial sequence
<220>
<223>Template strand
<400> 6
TAATTCGAGA CT 12
<210> 7
<211> 42
<212> DNA
<213>Artificial sequence
<220>
<223>5'- phosphorylations
<400> 7
AACCGTGCGT GCGTGCGGAT CAACTAATAC GACTCATCAT AA 42
<210> 8
<211> 12
<212> DNA
<213>Artificial sequence
<220>
<223>Template strand
<400> 8
ACGGTTTTAT GA 12
<210> 9
<211> 39
<212> DNA
<213>Artificial sequence
<220>
<223>5'- phosphorylations
<400> 9
ACAACGAAAG TAGCAGAAAU ACAGGTATCT AGGCTAGCT 39
<210> 10
<211> 13
<212> DNA
<213>Artificial sequence
<220>
<223>Template strand
<400> 10
CGTTGTAGCT AGC 13
<210> 11
<211> 65
<212> RNA
<213>Artificial sequence
<220>
<223>5'- phosphorylations
<400> 11
UCUGGACCGG UCGAUGUAUG UCUUGCACAC GUGUACUCUU AAGCAACAGU UACUGCGACG 60
UGAAA 65
<210> 12
<211> 16
<212> DNA
<213>Artificial sequence
<220>
<223>Template strand
<400> 12
GGTCCAGATT TCACGT 16
<210> 13
<211> 74
<212> DNA
<213>Artificial sequence
<220>
<223>5'- phosphorylations
<400> 13
CACCTCGCTT TCAACTTACA ATGCGTGCGT GCGGTCTAAT ACGACTCACT ATAAATCGAA 60
CATCAGCAAA CGGA 74
<210> 14
<211> 12
<212> DNA
<213>Artificial sequence
<220>
<223>Template strand
<400> 14
GAGGTGTCCG TT 12
<210> 15
<211> 74
<212> DNA
<213>Artificial sequence
<220>
<223>5'- phosphorylations
<400> 15
TCCGTTTGCT GATGTTCGAT TTATAGTGAG TCGTATTAGA CCGCACGCAC GCATTGTAAG 60
TTGAAAGCGA GGTG 74
<210> 16
<211> 12
<212> DNA
<213>Artificial sequence
<220>
<223>Template strand
<400> 16
AACGGACACC TC 12
<210> 17
<211> 59
<212> DNA
<213>Artificial sequence
<220>
<223>5'- phosphorylations
<400> 17
TCAGTGTTTT TTCAGTAACT CCCCACAACC TCTTTTTCGA TGCAAAAAAA ATATGTGCGA 59
<210> 18
<211> 12
<212> DNA
<213>Artificial sequence
<220>
<223>Template strand
<400> 18
CACTGATCGCAC
<210> 19
<211> 74
<212> DNA
<213>Artificial sequence
<220>
<223>5'- phosphorylations
<400> 19
TCCGTTTGCT GATGTTCGAT TTATAGTGAG TCGTATTAGA CCGCACGCAC GCATTGTAAG 60
TTGAAAGCGA GGTG 74
<210> 20
<211> 18
<212> DNA
<213>Artificial sequence
<220>
<223>Template strand
<400> 20
GCAAACGGAC ACCTCGCT 18
Claims (10)
1. a kind of prepare cyclic DNA or RNA method, it is characterised in that comprises the following steps：
Step one, by auxiliary template DNA (lower to be referred to as splint), ligase and the buffering for connecting enzyme reaction needed for annulation
Liquid is hybridly prepared into initial system；By one in the single stranded DNA or RNA (under be referred to as into loop chain) of 3 ' or 5 ' end phosphorylation modifications
Kind and above-mentioned buffer into annex solution；
Step 2, adds a certain amount of annex solution into initial system, addition into loop chain by splint formation ring molecules,
Certain interval of time, after existing major part in system is cyclic into loop chain, adds annex solution, new cyclization is added every time again
After chain, the concentration in system into loop chain increases 0.1-5 μM, is so repeated several times；
Step 3, after last time is added containing the annex solution into loop chain, then reacts 2-15h；
In initial system splint molar concentration with into the ratio between molar concentration of loop chain be (1-10):1.
2. according to claim 1 prepare cyclic DNA or RNA method, it is characterised in that adds and adds twice in step 2
Interval time between liquid feeding is 10-60min.
3. according to claim 1 prepare cyclic DNA or RNA method, it is characterised in that reaction final system after terminating
In ring molecule, into loop chain and accessory substance total concentration be 1 μM -30 μM.
4. according to claim 1 prepare cyclic DNA or RNA method, it is characterised in that the length into loop chain
25-200nt。
5. according to claim 1 prepare cyclic DNA or RNA method, it is characterised in that cyclic in described annex solution
The concentration of chain is 1-100 μM.
6. prepare cyclic DNA or RNA method according to claim any one of 1-5, it is characterised in that institute in step one
The ligase stated is that can connect the ligase of double-stranded DNA, double-stranded RNA or the notch in DNA-RNA hybridization chains.
7. according to claim 6 prepare cyclic DNA or RNA method, it is characterised in that the connection described in step one
Enzyme is T4DNA Ligase, T4RNA Ligase, Taq DNA Ligase, T3DNA Ligase, T7DNA Ligase, E.coli
Any one in DNA Ligase.
8. prepare cyclic DNA or RNA method according to claim any one of 1-5, it is characterised in that the ligase
The buffer concentration of reaction is 0.1-1 times of normal concentration.
9. according to claim 8 prepare cyclic DNA or RNA method, it is characterised in that the connection enzyme reaction it is slow
Fliud flushing composition is 20-40mM Tris-HCl (25 DEG C of pH7-8@), 10mM MgCl2,DTT,0.5-1mM ATP。
10. according to claim 8 prepare cyclic DNA or RNA method, it is characterised in that the connection enzyme reaction
Buffer solution composition is 30mM Tris-HCl (25 DEG C of 8.0@of pH), 4mM MgCl2,1mM DTT,26μM NAD+。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710479312.9A CN107267499B (en) | 2017-06-22 | 2017-06-22 | Method for preparing circular DNA or RNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710479312.9A CN107267499B (en) | 2017-06-22 | 2017-06-22 | Method for preparing circular DNA or RNA |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107267499A true CN107267499A (en) | 2017-10-20 |
| CN107267499B CN107267499B (en) | 2020-09-04 |
Family
ID=60068189
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710479312.9A Active CN107267499B (en) | 2017-06-22 | 2017-06-22 | Method for preparing circular DNA or RNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107267499B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109161572A (en) * | 2018-07-05 | 2019-01-08 | 中国海洋大学 | Single stranded circular nucleic acid and its preparation method and application |
| CN110724728A (en) * | 2019-10-12 | 2020-01-24 | 深圳清华大学研究院 | Preparation method of circular DNA |
| CN111793619A (en) * | 2020-06-04 | 2020-10-20 | 中国海洋大学 | Preparation method of single-stranded circular DNA |
| CN112662659A (en) * | 2019-10-15 | 2021-04-16 | 武汉核圣生物技术有限公司 | Universal mRNA in-vitro cyclization method |
| WO2023115786A1 (en) * | 2021-12-20 | 2023-06-29 | 中国海洋大学 | Method for preparing double-stranded rna |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624165A (en) * | 2016-01-05 | 2016-06-01 | 山东大学 | Cascade amplifying-strategy biomolecule detecting method based on self-locking aptamer probe |
| CN106591294A (en) * | 2016-12-30 | 2017-04-26 | 中山大学 | One-tube reaction type DNA molecule clone splicing method |
| CN106754883A (en) * | 2016-12-30 | 2017-05-31 | 中山大学 | An a kind of step, seamless, non-homogeneous, multiple clips gene splicing remodeling method and its kit |
-
2017
- 2017-06-22 CN CN201710479312.9A patent/CN107267499B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624165A (en) * | 2016-01-05 | 2016-06-01 | 山东大学 | Cascade amplifying-strategy biomolecule detecting method based on self-locking aptamer probe |
| CN106591294A (en) * | 2016-12-30 | 2017-04-26 | 中山大学 | One-tube reaction type DNA molecule clone splicing method |
| CN106754883A (en) * | 2016-12-30 | 2017-05-31 | 中山大学 | An a kind of step, seamless, non-homogeneous, multiple clips gene splicing remodeling method and its kit |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109161572A (en) * | 2018-07-05 | 2019-01-08 | 中国海洋大学 | Single stranded circular nucleic acid and its preparation method and application |
| CN110724728A (en) * | 2019-10-12 | 2020-01-24 | 深圳清华大学研究院 | Preparation method of circular DNA |
| CN110724728B (en) * | 2019-10-12 | 2023-06-06 | 深圳清华大学研究院 | Preparation method of circular DNA |
| CN112662659A (en) * | 2019-10-15 | 2021-04-16 | 武汉核圣生物技术有限公司 | Universal mRNA in-vitro cyclization method |
| CN111793619A (en) * | 2020-06-04 | 2020-10-20 | 中国海洋大学 | Preparation method of single-stranded circular DNA |
| CN111793619B (en) * | 2020-06-04 | 2022-01-07 | 中国海洋大学 | Preparation method of single-stranded circular DNA |
| WO2023115786A1 (en) * | 2021-12-20 | 2023-06-29 | 中国海洋大学 | Method for preparing double-stranded rna |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107267499B (en) | 2020-09-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107267499A (en) | Prepare cyclic DNA or RNA method | |
| Bahal et al. | Sequence-unrestricted, Watson-Crick recognition of double helical B-DNA by (R)-MiniPEG-γPNAs | |
| EP2678430B1 (en) | Use of template switching for dna synthesis | |
| WO2010117804A3 (en) | Mostly natural dna sequencing by synthesis | |
| CN107119043B (en) | Method for removing non-target RNA in RNA sample | |
| CN111321143B (en) | Method for preparing circular RNA | |
| WO2023115786A1 (en) | Method for preparing double-stranded rna | |
| CN106282173B (en) | In cloned, transgenic biology at exogenous origin gene integrator site flanking sequence method | |
| CN106928185B (en) | A kind of Ai Le replaces the preparation method of Buddhist nun | |
| CN102534004B (en) | Preparation method for probe used for multiplex ligation-dependent probe amplification (MLPA) | |
| CN103773757B (en) | A kind of method utilizing graphene quantum dot aggregation polymerase chain reaction | |
| CN105420225A (en) | Iodine dissociation type gene cloning method based on sulfo-modifiers | |
| AU2022273530A1 (en) | Modified mrna, modified non-coding rna, and uses thereof | |
| WO2021109302A1 (en) | Method for preparing near-infrared light control-based crispr-cas13a system and application thereof | |
| CN101935670A (en) | Method for constructing RNA (Ribonucleic Acid) interference vector by directly annealing multi-primers | |
| WO2024093962A1 (en) | Use of compact editing tool ebcas12a in gene editing | |
| CN105505972B (en) | A method of DNA ligase joint efficiency is improved using polyethyleneimine | |
| CN114075595B (en) | Methylation detection compositions, kits, and methods | |
| CN115807048B (en) | Method for preparing double-stranded RNA | |
| CN101134973A (en) | Optimized method for long-fragment nucleic acid polymerase chain reaction expanding based on nano metallic particles | |
| CN102220363A (en) | Method for constructing T vector | |
| DE10328813B4 (en) | Method for the investigation of cytosine methylations in DNA sequences using triplex-forming oligomers | |
| CN114426960A (en) | PDA @ CRISPR/Cas9/sgHMGA2NPs complex, preparation method and application | |
| CN105886494A (en) | Kit for amplifying influenza virus A whole genome as well as preparation method and application thereof | |
| Hornblower et al. | Minding your caps and tails—Considerations for functional mRNA synthesis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |