CN109706233A - A kind of amplification technique of complexity long-fragment nucleic acid sequence - Google Patents
A kind of amplification technique of complexity long-fragment nucleic acid sequence Download PDFInfo
- Publication number
- CN109706233A CN109706233A CN201811617607.9A CN201811617607A CN109706233A CN 109706233 A CN109706233 A CN 109706233A CN 201811617607 A CN201811617607 A CN 201811617607A CN 109706233 A CN109706233 A CN 109706233A
- Authority
- CN
- China
- Prior art keywords
- amplification
- primer
- pcr
- long
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a kind of amplification techniques of complicated long-fragment nucleic acid sequence, pass through the G/C content design primer according to target sequence, the Tm value of primer is adjusted simultaneously, by renaturation and extends operation while carrying out, it is reduced to two-step method amplification, improve the amplification success rate of complicated long-fragment nucleic acid sequence, the DNA long fragment sequence of especially amplifiable secondary structure complexity out.Amplification method of the invention can be completed using common PCR instrument, is suitable for most of Long fragment PCR amplification, can amplify the DNA long fragment sequence that G/C content is up to 60%, specificity is stronger, and amplification efficiency is high, easy to operate.
Description
Technical field
The invention belongs to molecular biology fields, further belong to enrichment purpose product technical field, and in particular to one
The amplification technique of the complicated long-fragment nucleic acid sequence of kind.
Background technique
Polymerase chain reaction (PCR) is the Protocols in Molecular Biology of external enzyme' s catalysis specific DNA fragment, to be amplified
DNA fragmentation is by the oligonucleotides strand primer complementary with its sequence as starting point, and the basic principle of round pcr is similar to DNA's
Natural reproduction process, specificity depend on the Oligonucleolide primers complementary with target sequence both ends.PCR is by being denaturalized, and -- annealing -- prolongs
Stretch three fundamental reaction steps to constitute: the 1. denaturation of template DNA: template DNA is heated to 93 DEG C or so after a certain period of time, makes mould
Plate DNA double chain or the double-stranded DNA formed through PCR amplification dissociate, and make single-stranded, are that lower whorl is anti-so that it is in conjunction with primer
It should prepare；2. the annealing (renaturation) of template DNA and primer: for the heated denaturation of template DNA at after single-stranded, temperature is down to 55 DEG C of left sides
The right side, the primer complementary series pairing single-stranded with template DNA are combined；3. the extension of primer: DNA profiling -- primer conjugate is 72
DEG C, under the action of archaeal dna polymerase (such as Taq DNA polymerase), using dNTP as reaction raw materials, target sequence is template, by base complementrity
Pairing and semi-conservative replication principle synthesize a new semi-conservative replication chain complementary with template DNA chain.Through denaturation, anneals, prolongs
The multiple circulation for stretching three-step reaction, keeps specific DNA fragmentation quantitatively in exponential increase.PCR is special as a kind of in vitro
Different DNA replication dna, maximum feature is that a large amount of specific gene segment can be obtained in the short time.
It can not be substituted in the effect of biological field, DNA long fragment (referring generally to 3Kb or more).Pass through common extraction
Method, it is difficult to extract DNA long fragment.Even if DNA long fragment can be extracted, even microorganism full length DNA, at present
Sequencing technologies are difficult to realize overall length sequencing, and are sequenced and certain sample size is needed just to be able to satisfy sequencing demands, if original extraction
Amount of DNA it is less, it is very difficult to carry out long segment Enrichment Amplification, i.e., it is enabled to obtain many original materials and carry out DNA extraction, protect
Card can obtain enough DNA long fragments and meet sequencing requirement, then sequencing cost is high there exists a further problem in that extraction cost is high,
Limit many research and application, the correlative study of sample be more especially difficult to, rare.Therefore, Ren Menkai
Long-chain PCR (long PCR) technology is had issued, obtains a large amount of DNA long fragment to expand.
Regular-PCR can be easier to amplify the segment of 3Kb, it can be difficult to expanding longer segment, especially 10Kb or more
Segment.The amplification rate for the polymerase being commonly used is 1Kb/min, when using long segment sequence as template, buffering
Liquid can be exposed under high temperature for a long time, and be unable to maintain that the stability of its pH value to damage template and product DNA；It is followed in PCR
The high-temperature denaturation stage of ring, the denaturation of length dna molecule have difficulties, once denaturation will not exclusively block complete amplification, obtain
To the segment of different length, the failure of long-chain PCR is eventually led to；Commonly used heat-resisting polymerase such as Taq lacks editing function,
Will appear more base mismatch in DNA long fragment template amplification influences accuracy.Non-specific amplification refers to primer and template
The not exclusively amplification of specific binding initiation, and the probability that DNA long fragment sequence is not fully integrated is higher, i.e. long-chain PCR
When non-specific amplification probability can be higher, many nonspecific products will be generated.
Also many studies have shown thats tackle the amplification of complicated DNA long fragment sequence, appropriate adjustment PCR condition can be with
Improve as a result, such as adding reinforcing agent, optimization template DNA amount and Mg2+Concentration etc..However the effect of reinforcing agent is unpredictable, no
It can guarantee the validity for improving the DNA cloning with a large amount of secondary structures；It is reported that the DNA of high concentration can inhibit high GC
The amplification of sequence；Mg2+Concentration is too low to will affect PCR efficiency, and Mg2+Excessive concentration will lead to many non-specific amplifications again.
The world Fan Baochang, Yang Peiying long-chain round pcr progress [J] laboratory medicine magazine, 2003,24 (3): 148-
150. introduce by using special archaeal dna polymerase, optimize to single reaction system, the expansion of long segment also may be implemented
Increase.TAKARA claims specific archaeal dna polymerase (Takara LA Taq archaeal dna polymerase and the PrimeSTAR GXL developed using it
Archaeal dna polymerase https: //www.takarabio.com/products/pcr/long-range-pcr) it can expand and be grown
Up to the long segment of 48Kb, including the sequence with AT repetitive sequence, high GC content.But it is found during specific experimental implementation
Its amplification is unsatisfactory, is only applicable to the DNA long fragment amplification of G/C content lower (not higher than 40%), and for G/C content
Higher DNA long fragment amplification often fails.
The influence of PCR amplification efficiency subject nucleotide composition and template DNA sequence, the long segment of high GC content (being greater than 40%)
The amplification of DNA is always a difficult point of round pcr, and main cause has:
1) template is rich in GC residue, and GC residue concentrated area is easy to fold formation complexity since intermolecular force is stronger
Secondary structure, cause in amplification procedure DNA long fragment denaturation and renaturation difficult, and nucleic acid polymerase is needed to be in high for a long time
Temperature state, enzymatic activity is impacted, therefore amplification efficiency is low；
2) amplimer in the high area GC due between base active force it is relatively strong, have it is very high formed itself or intersect
The incomplete denaturation of the ability of dimer, template molecule and oligonucleotides strand primer and renaturation, will lead to archaeal dna polymerase along mould
The progress of plate molecule is hindered, and generates more short-movie section；
3) DNA long fragment sequence is easy to appear non-specific amplification due to the complexity of sequence, occurs many non-specific
Product；
4) nucleic acid polymerase amplification when there are certain error probability, will appear in DNA long fragment template amplification compared with
More base mismatch influences accuracy.
Predictably the amplification efficiency of long-chain PCR is low, and since archaeal dna polymerase is obstructed, will lead to final production
Purpose DNA long fragment content is few in object and reaction product in include more short-movie section.Therefore, complicated DNA long fragment, especially
It is that the DNA sequence dna of 10Kb or more is difficult Successful amplification.How existing DNA long fragment amplification present in deficiency, research and development one are overcome
The method that kind is capable of quickly specific amplified complexity DNA long fragment is very important.
Summary of the invention
It is an object of the invention to overcome the deficiencies of the prior art and provide a kind of amplification skills of complicated long-fragment nucleic acid sequence
Art.
The technical solution used in the present invention is:
A kind of amplimer design method of long-fragment nucleic acid sequence, wherein amplimer sequence meets following condition:
The length of primer is 26~32bp；
The G/C content of primer is 43~61% and is no more than 8% with the difference of the G/C content of target sequence；
Tm value is 64~68 DEG C；
Same base is continuously no more than 5, and there can be no 3 two or more consecutive identical bases；
It is not A that last 3 bases, which are not all C, G and the last one base,.
As the further improvement of above-mentioned amplimer design method, Tm value is calculated using nearest neighbor algorithm.
A kind of amplification method of long-fragment nucleic acid sequence, includes the following steps:
1) it designs and synthesizes to obtain amplimer by above-mentioned method；
2) template sequence is prepared；
3) primer, template, dNTP are reacted to obtain PCR reaction system with PCR buffer, polymerase, water, amplification is grown
Fragment nucleic acid sequence renaturation and extends while carrying out in amplification procedure.
As the further improvement of above-mentioned amplification method, the elongating temperature of PCR is primer Tm ± 4 DEG C.
As the further improvement of above-mentioned amplification method, extension of time=target sequence length/1000 ± 4min of PCR.
As the further improvement of above-mentioned amplification method, in PCR reaction system, Mg2+Ion concentration is controlled in 10~20mM.
As the further improvement of above-mentioned amplification method, contain DMSO and glycine betaine in PCR reaction system.
As the further improvement of above-mentioned amplification method, the dosage of DMSO stands alone as 1~1.5 μ L/50 in PCR reaction system
μ L reaction system；The dosage of glycine betaine stands alone as 1.2~2 μ L/50 μ L reaction systems.
As the further improvement of above-mentioned amplification method, template OD value 260/280 is that 1.8~2.0, OD value 230/260 is
1.8~2.0,
As the further improvement of above-mentioned amplification method, the concentration of template is 50ng~100ng/50 μ L reaction system.
As the further improvement of above-mentioned amplification method, the length of long-fragment nucleic acid is 8.5Kb~20Kb；G/C content is 35
~60%.
The beneficial effects of the present invention are:
Primer design method of the invention can greatly improve the amplification success rate of long-fragment nucleic acid sequence.
Long-fragment nucleic acid sequence amplification method of the invention creatively breaks through traditional three-step approach during PCR amplification,
By renaturation and extend operation while carrying out, is reduced to two-step method amplification, can surprisingly amplify the lengthy motion picture that normal PCR is difficult to expand
Segment DNA sequence, the DNA long fragment sequence of especially amplifiable secondary structure complexity out, and specificity is stronger, amplification efficiency is high.
Long-fragment nucleic acid sequence amplification method of the invention can amplify the DNA long fragment sequence that G/C content is up to 60%
Column, and high specificity, amplification efficiency are high.
Long-fragment nucleic acid sequence amplification method of the invention can be completed using common PCR instrument, be suitable for most of
Long fragment PCR amplification, and it is easy to operate.
Detailed description of the invention
Fig. 1 is the DNA quality inspection figure that DNA extraction kit is extracted；
Fig. 2 is the gel electrophoresis figure of embodiment 1PCR product；
Fig. 3 is 2100 testing result figure of the library embodiment 1PacBio；
Fig. 4 is the sequencing result comparative analysis result of sequencing library；
Fig. 5 is the gel electrophoresis figure of embodiment 2PCR product；
Fig. 6 is 2100 testing result figure of the library embodiment 2PacBio；
Fig. 7 is the gel electrophoresis figure of comparative example 1PCR product；
Fig. 8 is the gel electrophoresis figure of comparative example 2PCR product；
Fig. 9 is the gel electrophoresis figure of embodiment 1, embodiment 3 and comparative example 3PCR product；
Figure 10 is the gel electrophoresis figure of embodiment 1, comparative example 4PCR product；
Figure 11 is the gel electrophoresis figure of comparative example 5PCR product.
Specific embodiment
A kind of amplimer design method of long-fragment nucleic acid sequence, wherein amplimer sequence meets following condition:
The length of primer is 26~32bp；
The G/C content of primer is 43~61% and is no more than 8% with the difference of the G/C content of target sequence；
Tm value is 64~68 DEG C；
Same base is continuously no more than 5, and there can be no 3 two or more consecutive identical bases；
It is not A that last 3 bases, which are not all C, G and the last one base,.
In the present invention, the DNA sequence of long-fragment nucleic acid sequence particularly including 8Kb~25Kb, especially 8.5Kb~20Kb
Column.
As the further improvement of above-mentioned amplimer design method, Tm value is calculated using nearest neighbor algorithm.Generally recognize
The design of primer is had no significant effect for the calculation method of Tm value, but inventors be surprised to learn that, it is calculated using nearest neighbor algorithm
The primer of Tm value design can make long-fragment nucleic acid sequence obtain better amplification.
A kind of amplification method of long-fragment nucleic acid sequence, includes the following steps:
1) it designs and synthesizes to obtain amplimer by above-mentioned method；
2) template sequence is prepared；
3) primer, template, dNTP are reacted to obtain PCR reaction system with PCR buffer, polymerase, water, amplification is grown
Fragment nucleic acid sequence renaturation and extends while carrying out in amplification procedure.
In the present invention, the DNA sequence of long-fragment nucleic acid sequence particularly including 8Kb~25Kb, especially 8.5Kb~20Kb
Column.
The preparation process of template sequence can be used reverse transcriptase and convert DNA sequence dna for RNA sequence.
As the further improvement of above-mentioned amplification method, the elongating temperature of PCR is primer Tm ± 4 DEG C.
Specific extension of time can carry out adjustment appropriate according to amplification situation.As the further of above-mentioned amplification method
It improves, extension of time=target sequence length/1000 ± 4min of PCR.
By adjusting Mg2+The dosage of ion, DMSO and glycine betaine can further suppress non-specific amplification.
As the further improvement of above-mentioned amplification method, in PCR reaction system, Mg2+Ion concentration is controlled in 10~20mM.
As the further improvement of above-mentioned amplification method, contain DMSO and glycine betaine in PCR reaction system.
As the further improvement of above-mentioned amplification method, the dosage of DMSO stands alone as 1~1.5 μ L/50 in PCR reaction system
μ L reaction system；The dosage of glycine betaine stands alone as 1.2~2 μ L/50 μ L reaction systems.
Its specific dosage carries out certain adjustment according to specific expanding effect, to obtain optimal expanding effect.Make
Used time, Mg2+Ion, DMSO and glycine betaine add in PCR buffer preferably as the component of PCR buffer.
The template of high-purity is more advantageous to Successful amplification long-fragment nucleic acid sequence, as further changing for above-mentioned amplification method
Into, template OD value 260/280 is that 1.8~2.0, OD value 230/260 is 1.8~2.0,
As the further improvement of above-mentioned amplification method, the concentration of template is 50ng~100ng/50 μ L reaction system.This
Sample can surprisingly improve the success rate of amplification.
As the further improvement of above-mentioned amplification method, the length of long-fragment nucleic acid is 8.5Kb~20Kb；G/C content is 35
~60%.
Below with reference to embodiment, technical solution of the present invention is further illustrated.
Embodiment 1:
Design of primers: downloading HBA gene order from database, carries out design of primers, amplified production using online software
Length 10.7Kb, G/C content 58%, chromosome location: > chr16:205936~> chr16:216718.
It is as follows to design obtained primer:
Template preparation: after obtaining blood sample to be measured (ensure blood sample saves qualified, no haemolysis), take 200ul blood sample according to
QIAGEN whole blood DNA extracts kit extracts DNA, and quality inspection is qualified, sees Fig. 1, the single no degradation of genomic DNA band is spare；
Determine amplification system and PCR system: amplification system and PCR system are as follows:
| Component | Volume μ L |
| Polymerase(5U) | 0.5 |
| PCR Buffer(2×) | 25 |
| dNTP(10mM) | 8 |
| Primer F | 1 |
| Primer R | 1 |
| DNA profiling (100ng/ μ L) | 1 |
| H2O | 13.5 |
| Final | 50 |
PCR condition is as follows:
The detection of PCR product
After reaction, reaction product is detected PCR using 0.75% agarose gel electrophoresis, as the result is shown purpose item
With single and bright, glue figure using the automatic bale cutting instrument of Blue Pinpin as shown in Fig. 2, carry out the recycling of target fragment later.
Long fragment PCR product quality inspection: concentration, segment, purity are carried out using Nanodrop, Qbuit, agarose gel electrophoresis
Detection carries out PacBio library construction after detection is qualified.
PacBio library construction: library construction carries out library using Nanodrop, Qbuit, 2100 instruments after terminating
Concentration, segment, purity detecting, it is ensured that library band is single and 2100 results in purpose band peak type it is very narrow, Fig. 3 is PacBio text
2100 testing result figure of library.
Sequencing with data analyze: the sequencing library of above-mentioned preparation is sequenced in PacBio microarray dataset, lower machine it
Mass filter is carried out to data afterwards, is then compared, result such as Fig. 4 is analyzed, the region that amplified production compares is certain
For the amplification region of design.
Embodiment 2:
Design of primers: downloading HBA gene order from database, carries out design of primers, amplified production using online software
Length is 20.6Kb, G/C content 57.5%, chromosome location: > chr16:204464~> chr16:225129.
It is as follows to design obtained primer:
| Primer sequence | SEQ ID NO.: | Tm value | GC% | |
| Forward primer F2 | CCACTTACCGCGTAATGCGCCAAT | 3 | 64.6℃ | 54.2 |
| Reverse primer R2 | TCTCATTTCCCCTCCCTGTCTGC | 4 | 63.6℃ | 56.5 |
Template preparation: after obtaining blood sample to be measured (ensure blood sample saves qualified, no haemolysis), take 200ul blood sample according to
QIAGEN whole blood DNA extracts kit extracts DNA, and quality inspection is qualified, spare；
Determine amplification system and PCR system: amplification system and PCR system are as follows:
| Component | Volume μ L |
| Polymerase(5U) | 0.5 |
| PCR Buffer(2×) | 25 |
| dNTP(10mM) | 8 |
| Primer F | 1 |
| Primer R | 1 |
| DNA profiling (100ng/ μ L) | 1 |
| H2O | 13.5 |
| Final | 50 |
PCR condition is as follows:
The detection of PCR product
After reaction, reaction product is detected PCR using 0.75% agarose gel electrophoresis, as the result is shown purpose item
With single and bright, glue figure using the automatic bale cutting instrument of Blue Pinpin as shown in figure 5, carry out the recycling of target fragment later.
Long fragment PCR product quality inspection: concentration, segment, purity are carried out using Nanodrop, Qbuit, agarose gel electrophoresis
Detection carries out PacBio library construction after detection is qualified.
PacBio library construction: library construction uses Nanodrop, Qbuit, agarose gel electrophoresis to text after terminating
Library carries out concentration, segment, purity detecting, it is ensured that library band is single and 2100 results in purpose band peak type it is very narrow, Fig. 6 is
The library PacBio Ago-Gel testing result figure.
Sequencing with data analyze: the sequencing library of above-mentioned preparation is sequenced in PacBio microarray dataset, lower machine it
Mass filter is carried out to data afterwards, is then compared, result such as Fig. 3 is analyzed, the region that amplified production compares is certain
For the amplification region of design.
Embodiment 3:
The target sequence of amplification, primer sequence, PCR reaction system and embodiment 1 are completely the same, the difference is that PCR
Ductility temperature be 63 DEG C, specific PCR program is as follows:
Comparative example 1:
Design of primers: downloading HBA gene order from database, carries out design of primers using online software, 2 pairs of design is drawn
Object, primer pair 1: amplified production length be 9.3Kb, G/C content 53.3%, chromosome location: > chr16:204490~> chr16:
213877
| Primer sequence | SEQ ID NO.: | Tm value | GC% | |
| Forward primer F ' 1 | ACCAATGAACGAAGCAGCGTCC | 5 | 64.4 | 54.5 |
| Reverse primer R ' 1 | GTGCAACTCCTAATCGTTCCCTCC | 6 | 62.7 | 54.2 |
Commercial reagent box, it is as follows using system
| Component | Volume (ul) |
| NF H2O | 21 |
| Polymerse MIX*2 | 25 |
| Forward Primer(10um) | 1 |
| Reverse Primer(10um) | 1 |
| DNA(100ng/μL) | 2 |
| Total volume | 50ul |
PCR condition
Amplified production is detected using 1% agarose gel electrophoresis, as a result sees Fig. 7, and primer pair 1 uses commercial reagent box
Amplification obtains having many small non-specific segments in product.
Comparative example 2:
The target sequence of amplification, primer sequence, PCR reaction system and embodiment 1 are completely the same, the difference is that PCR
Condition is 3 conventional footworks, specific as follows:
Amplified production is detected using 1% agarose gel electrophoresis, as a result as shown in Figure 8.Electrophoresis result shows, 3 steps
Method has non-specific, is because in low-temperature annealing, primer non-specific binding, falling off and extending not in time in extension causes.
Comparative example 3:
The target sequence of amplification, primer sequence, PCR reaction system and embodiment 1 are completely the same, the difference is that PCR
Ductility temperature be 60 DEG C, specific PCR program is as follows:
The amplified production of embodiment 1, embodiment 3 and comparative example 3 is detected using 1% agarose gel electrophoresis, as a result
See Fig. 9, it is seen that 3 kinds of annealing temperatures have purpose band 10.7kb, and 63 DEG C and 60 DEG C are extended with lesser non-specific band,
And the total amount of purpose band compared with 65 DEG C extend it is low, mainly compared under low temperature thermal oxidation, primer has a possibility that bigger and base
Because organize other regions formed it is partially double stranded, when primer 3 ' hold with genome other positions non-specific binding when be possible to cause
Extend amplification, to generate nonspecific products.
Comparative example 4: influence of the primer length to amplification.
Choose the primer of same position, primer pair 3 is shorter 4 than the primer pair of embodiment 1 difference, 5bp, primer pair 3 it is detailed
Information is as follows:
| Primer sequence | SEQ ID NO.: | Tm value | GC% | |
| Forward primer F3 | GGTGGAAGGAAGCTCCTGCAAGT | 7 | 64.9℃ | 56.5 |
| Reverse primer R3 | AGCACAGGGCTCAGCGGTATT | 8 | 65.6℃ | 57.1 |
For PCR system with embodiment 1, specific PCR condition is as follows:
Amplified production is detected using 1% agarose gel electrophoresis, the result is shown in Figure 10, it is seen that be easier when primer is shorter
Non-specific band is formed, because of primer more shorter easier combination complementary with the generation of other regions of genome, to cause extension
Non-specific band is caused to generate.
Comparative example 5: primer and influence of the product G/C content difference to amplification
4 pairs of primers are to carry out design of primers to chromosome location > chr16:205936~> chr16:216718 and expand below
Increase,
Primer pair 2: amplified production length is 10.7kb, amplified production G/C content 58%, primer pair 2 and purpose amplified production
G/C content differs 4.2% (primer pair of embodiment 1).
Primer pair 4: amplified production length is 10.7kb, and amplified production G/C content 58.2%, primer pair 4 and purpose amplification produce
Object G/C content differs 0.2%, 0.5% respectively.
Primer pair 5: amplified production length is 10.7kb, G/C content 58%.Primer pair 5 and purpose amplified production G/C content
8%, 6% is differed respectively.
Primer pair 6: amplified production length is 10.7kb, amplified production G/C content 58%, primer pair 2 and purpose amplified production
G/C content difference 11.8%, 8%.
PCR system, PCR condition are the same as embodiment 1.
Amplified production is detected using 1% Ago-Gel, the result is shown in Figure 11, it is seen that primer pair 2, primer pair 4 and is drawn
Object has purpose amplified product band to 5.The Product yields of primer pair 2 and primer pair 4 are higher, and band is single, and primer pair 5
There is more nonspecific small fragment, and non-specific fragment purpose band is too close, is difficult by later period Piece Selection
Reason.6 amplified production of primer pair is the band of a piece of disperse, no purpose master tape, amplification failure.
SEQUENCE LISTING
<110>Co., Ltd, Guangzhou essence section medical test institute
<120>a kind of amplification technique of complicated long-fragment nucleic acid sequence
<130> L-PCR
<160> 14
<170> PatentIn version 3.5
<210> 1
<211> 26
<212> DNA
<213>artificial primer
<400> 1
aaggtggaag gaagctcctg caagtc 26
<210> 2
<211> 26
<212> DNA
<213>artificial primer
<400> 2
agcacagggc tcagcggtat ttttcg 26
<210> 3
<211> 24
<212> DNA
<213>artificial primer
<400> 3
ccacttaccg cgtaatgcgc caat 24
<210> 4
<211> 23
<212> DNA
<213>artificial primer
<400> 4
tctcatttcc cctccctgtc tgc 23
<210> 5
<211> 22
<212> DNA
<213>artificial primer
<400> 5
accaatgaac gaagcagcgt cc 22
<210> 6
<211> 24
<212> DNA
<213>artificial primer
<400> 6
gtgcaactcc taatcgttcc ctcc 24
<210> 7
<211> 23
<212> DNA
<213>artificial primer
<400> 7
ggtggaagga agctcctgca agt 23
<210> 8
<211> 21
<212> DNA
<213>artificial primer
<400> 8
agcacagggc tcagcggtat t 21
<210> 9
<211> 26
<212> DNA
<213>artificial primer
<400> 9
tgaaggccac cctggccaac atagag 26
<210> 10
<211> 26
<212> DNA
<213>artificial primer
<400> 10
ggggcgcatt tgagagttct aggagg 26
<210> 11
<211> 26
<212> DNA
<213>artificial primer
<400> 11
gctcctgcaa gtctgactct ctacat 26
<210> 12
<211> 25
<212> DNA
<213>artificial primer
<400> 12
tcagcggtat ttttcggtca gcacc 25
<210> 13
<211> 26
<212> DNA
<213>artificial primer
<400> 13
cctgcaagtc tgactctcta catagt 26
<210> 14
<211> 26
<212> DNA
<213>artificial primer
<400> 14
aaacactgga ttagcagctg caggag 26
Claims (10)
1. a kind of amplimer design method of long-fragment nucleic acid sequence, wherein amplimer sequence meets following condition:
The length of primer is 26~32bp；
The G/C content of primer is 43~61% and is no more than 8% with the difference of the G/C content of target sequence；
Tm value is 64~68 DEG C；
Same base is continuously no more than 5, and there can be no 3 two or more consecutive identical bases；
It is not A that last 3 bases, which are not all C, G and the last one base,.
2. primer design method according to claim 1, it is characterised in that: Tm value is calculated using nearest neighbor algorithm.
3. a kind of amplification method of long-fragment nucleic acid sequence, includes the following steps:
1) method according to claim 1 designs and synthesizes to obtain amplimer；
2) template sequence is prepared；
3) primer, template, dNTP are reacted to obtain PCR reaction system with PCR buffer, polymerase, water, amplification obtains long segment
Nucleic acid sequence renaturation and extends while carrying out in amplification procedure.
4. amplification method according to claim 3, it is characterised in that: template OD value 260/280 is 1.8~2.0, OD value
230/260 is 1.8~2.0, and preferred template concentrations are 50ng~100ng/50 μ L reaction system.
5. amplification method according to claim 3, it is characterised in that: in PCR reaction system, Mg2+Ion concentration control exists
10~20mM.
6. according to the described in any item amplification methods of claim 3~5, it is characterised in that: in PCR reaction system containing DMSO and
Glycine betaine.
7. amplification method according to claim 6, it is characterised in that: in PCR reaction system the dosage of DMSO stand alone as 1~
1.5 μ L/50 μ L reaction systems；The dosage of glycine betaine stands alone as 1.2~2 μ L/50 μ L reaction systems.
8. according to the described in any item amplification methods of claim 3~5, it is characterised in that: the elongating temperature of PCR is primer Tm
±4℃。
9. according to the described in any item amplification methods of claim 3~5, it is characterised in that: extension of time=target sequence of PCR
Length/1000 ± 4min.
10. according to the described in any item amplification methods of claim 3~5, it is characterised in that: the length of long-fragment nucleic acid is
8.5Kb~20Kb；G/C content is 35~60%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811617607.9A CN109706233A (en) | 2018-12-28 | 2018-12-28 | A kind of amplification technique of complexity long-fragment nucleic acid sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811617607.9A CN109706233A (en) | 2018-12-28 | 2018-12-28 | A kind of amplification technique of complexity long-fragment nucleic acid sequence |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109706233A true CN109706233A (en) | 2019-05-03 |
Family
ID=66258829
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811617607.9A Pending CN109706233A (en) | 2018-12-28 | 2018-12-28 | A kind of amplification technique of complexity long-fragment nucleic acid sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109706233A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111154820A (en) * | 2020-01-13 | 2020-05-15 | 上海韦翰斯生物医药科技有限公司 | Method for reducing nucleic acid amplification replication slip rate |
| CN112342289A (en) * | 2020-11-04 | 2021-02-09 | 广州精科医学检验所有限公司 | Primer group for enriching thalassemia genes by long-fragment PCR (polymerase chain reaction) and application of primer group |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101643762A (en) * | 2009-09-02 | 2010-02-10 | 陈依军 | PCR amplification system and PCR amplification method for high GC content gene |
| CN105754992A (en) * | 2016-04-05 | 2016-07-13 | 南昌大学 | Method for conducting efficient PCR amplification on long-fragment target sequence |
| CN107254541A (en) * | 2017-08-03 | 2017-10-17 | 广州万德基因医学科技有限公司 | Storehouse primer pond and application are built for expanding the NGS of multiple targets in cfDNA samples |
-
2018
- 2018-12-28 CN CN201811617607.9A patent/CN109706233A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101643762A (en) * | 2009-09-02 | 2010-02-10 | 陈依军 | PCR amplification system and PCR amplification method for high GC content gene |
| CN105754992A (en) * | 2016-04-05 | 2016-07-13 | 南昌大学 | Method for conducting efficient PCR amplification on long-fragment target sequence |
| CN107254541A (en) * | 2017-08-03 | 2017-10-17 | 广州万德基因医学科技有限公司 | Storehouse primer pond and application are built for expanding the NGS of multiple targets in cfDNA samples |
Non-Patent Citations (7)
| Title |
|---|
| HAIYING JIA等: "Long-range PCR in next-generation sequencing: comparison of six enzymes and evaluation on the MiSeq sequencer", 《SCIENTIFIC REPORTS》 * |
| MARION PHYLIPSEN等: "A new alpha(0)-thalassemia deletion found in a Dutch family (--(AW))", 《BLOOD CELLS MOL DIS.》 * |
| NOURI BEN ZAKOUR等: "GenoFrag: software to design primers optimized for whole genome scanning by long-range PCR amplification", 《NUCLEIC ACIDS RESEARCH》 * |
| Q LIU，S S SOMMER: "Subcycling-PCR for multiplex long-distance amplification of regions with high and low GC content: application to the inversion hotspot in the factor VIII gene", 《BIOTECHNIQUES》 * |
| SUZANNE CHENG等: "Long PCR", 《NATURE》 * |
| 李莉艳: "PCR扩增高GC含量DNA序列的引物设计策略", 《万方数据知识服务平台》 * |
| 楚雍烈，陈静宏，王治伦: "《医用生物信息学概论》", 30 October 2005 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111154820A (en) * | 2020-01-13 | 2020-05-15 | 上海韦翰斯生物医药科技有限公司 | Method for reducing nucleic acid amplification replication slip rate |
| CN112342289A (en) * | 2020-11-04 | 2021-02-09 | 广州精科医学检验所有限公司 | Primer group for enriching thalassemia genes by long-fragment PCR (polymerase chain reaction) and application of primer group |
| CN112342289B (en) * | 2020-11-04 | 2023-08-15 | 广州精科医学检验所有限公司 | Primer group for enriching thalassemia genes by long-fragment PCR and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2467479B1 (en) | Compositions and methods for intramolecular nucleic acid rearrangement | |
| EP3252174B1 (en) | Compositions, methods, systems and kits for target nucleic acid enrichment | |
| JP6894501B2 (en) | Isothermal nucleic acid self-amplification method | |
| US10683498B2 (en) | Methods for generating circular DNA from circular RNA | |
| KR20210029845A (en) | Ligase-assisted nucleic acid circularization and amplification | |
| EP1871897A2 (en) | Methods for production of oligonucleotides | |
| AU2016255570B2 (en) | Compositions and methods for constructing strand specific cDNA libraries | |
| CN110446783A (en) | The duplication of cyclic DNA or amplification method | |
| CN105452480B (en) | DNA amplification via scissor-like structures (DASL) | |
| JPH06510669A (en) | Nucleic acid extension assay | |
| US20170362623A1 (en) | Amplification of nucleic acids | |
| JP2023002557A (en) | Single primer to dual primer amplicon switching | |
| CN112941635A (en) | Second-generation sequencing library building kit and method for improving library conversion rate | |
| CN109706233A (en) | A kind of amplification technique of complexity long-fragment nucleic acid sequence | |
| JP3972106B2 (en) | Genome library production method and genome library produced by the same method | |
| CN110724728B (en) | Preparation method of circular DNA | |
| CN107083427B (en) | DNA ligase mediated DNA amplification technology | |
| JP7333171B2 (en) | RNA detection method, RNA detection nucleic acid and RNA detection kit | |
| JP5129498B2 (en) | Nucleic acid cloning method | |
| JP2023506631A (en) | NGS library preparation using covalently closed nucleic acid molecule ends | |
| CN110577981A (en) | Molecular beacon based on artificial simulation nucleic acid | |
| CN105603055B (en) | Multiplex polymerase chain reaction method and application thereof | |
| CN109971825B (en) | Method for rapidly preparing Sangge sequencing template | |
| JP2007325534A (en) | METHOD FOR ISOTHERMAL AMPLIFICATION OF NUCLEIC ACID UTILIZING RecA PROTEIN | |
| JP2023543602A (en) | Targeted sequence addition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20190503 |
|
| RJ01 | Rejection of invention patent application after publication |