CN110446783A

CN110446783A - The duplication of cyclic DNA or amplification method

Info

Publication number: CN110446783A
Application number: CN201880018564.4A
Authority: CN
Inventors: 末次正幸; 奈良圣亚
Original assignee: Kiyoshi Okazaki
Current assignee: Kiyoshi Okazaki
Priority date: 2017-02-28
Filing date: 2018-02-28
Publication date: 2019-11-12
Also published as: JP6960684B2; RU2752611C2; AU2018228154A1; US20240018561A1; KR20190123287A; US20200115727A1; EP3591051A4; IL268944A; RU2019130498A3; CA3054881A1; KR102491725B1; JPWO2018159669A1; US11685940B2; BR112019017657A2; RU2019130498A; WO2018159669A1; EP3591051A1; SG11201907899TA

Abstract

A kind of method that can be replicated in cell free system or expand cyclic DNA, particularly long-chain cyclic DNA is provided.Enzyme group below is being used specifically, providing: (1) being catalyzed the first enzyme group of the duplication of cyclic DNA；(2) the second enzyme group of 2 sisters' cyclic DNAs of catenane is reacted and is synthetically formed in the connection of catalysis Okazaki fragments；(3) duplication of third enzyme group or amplification for being catalyzed the separation reaction of 2 sisters' cyclic DNAs inhibit the generation of the DNA polymer as by-product method when having the cyclic DNA of replication initiation sequence (origin of chromosome (oriC)).In addition, also offer includes method the step of importing oriC into cyclic DNA using transposons.

Description

The duplication of cyclic DNA or amplification method

Technical field

The present invention relates to the duplication of cyclic DNA or amplification methods.More specifically, being related to can be in cell free system efficiently The method of ground duplication or amplification cyclic DNA.The invention additionally relates to the functional box for being used to prepare cyclic DNA can be used as to utilize Nucleic acid.

Background technique

The DNA clone technology on the basis as biotech development is the ring for making the cutting stickup by DNA fragmentation and preparing The intracellular method that with plasmid form is expanded of the shape DNA in Escherichia coli etc..Expand using using the DNA clone technology of cell When increasing cyclic DNA, the step that needs cell culture and the extraction of amplified production, purifying etc. loaded down with trivial details.In addition, in order to carry out using thin The DNA clone of born of the same parents and need to make genetic recombination biology, therefore in terms of the environment that can be tested exist restrict.

As the method for DNA amplification in vitro, generally polymerase chain reaction (PCR) is used.But utilize PCR's DNA cloning method can not directly expand cyclic DNA in test tube.As amplification in the test tube of cyclic DNA, there is rolling circle amplification (RCA) etc. (non-patent literature 1, patent document 1, patent document 2, patent document 3).But in order to be expanded with rolling circle amplification Cyclic DNA needs every secondary design to the primer of target dna specificity.In addition, the direct amplified production of rolling circle amplification is straight chain Type DNA needs to carry out being incubated for etc. with recombinase further cyclisation process to be cyclized obtained amplified production.Also it reports Road following methods: it after the microchromosome (oriC cyclic DNA) of duplication Escherichia coli, is isolated, obtains the ring of monomer Shape replicates product (non-patent literature 2~5).But experiment is shown, under the reaction condition used in these documents, with ring-type The duplicating efficiency of DNA molecular meter stops at the 15-40% or so of added template DNA, (non-to expand the unrealized multiplication of meter Patent document 3~6).Further, the size of the cyclic DNA used in those references as template, which stops at, to be less than 10kbp。

To, in order to expand cyclic DNA with DNA cloning method in previous test tube, the combination of primer pair template DNA is needed, Amplified production is straight chain type DNA, in addition, the DNA size that can be expanded stops at several kbp.In addition, wanting to use Escherichia coli small Chromosome replication system is come the problem of when generating cricoid amplified production, having template cyclic DNA or even multiplication cannot be achieved.

Existing technical literature

Patent document

Patent document 1: Japanese Unexamined Patent Publication 2005-229950

Patent document 2: Japanese Unexamined Patent Publication 2008-161182

Patent document 3: Japanese Unexamined Patent Application Publication 2012-501173

Non-patent literature

Non-patent literature 1:Fakruddin M et al., J Pharm Bioallied Sci.2013,5:245-252

Non-patent literature 2:Peng H&Marians KJ.PNAS.1993,90:8571-8575

Non-patent literature 3:Hiasa H&Mar ians KJ.J Biol Chem.1994,269:32655-32659

Non-patent literature 4:Funnell B et al., J Biol Chem.1986,261:5616-5624

Non-patent literature 5:Hiasa H et al., J Biol Chem.1994,269:2093-2099

Non-patent literature 6:Hiasa H&Marians KJ.J Biol Chem.1994,269:26959-26968

Summary of the invention

Subject to be solved by the invention

The present invention provides the method that efficiently can replicate or expand cyclic DNA in cell free system.In addition the present invention mentions For the nucleic acid that the functional box for being used to prepare cyclic DNA can be used as to utilize.

Means for solving the problems

Further investigation has been repeated in the inventors of the present invention in order to solve the above problems, as a result, it has been found that, using enzyme below Group:

(1) it is catalyzed the first enzyme group of the duplication of cyclic DNA；

(2) the second enzyme group of 2 sisters' cyclic DNAs of catenane is reacted and is synthetically formed in the connection of catalysis Okazaki fragments；With

(3) the third enzyme group for being catalyzed the separation reaction of 2 sisters' cyclic DNAs has replication initiation sequence to replicate or expand When the cyclic DNA of (origin of chromosome (oriC)), by using ter-Tus duplication terminate mechanism and/or The DNA polymer separation mechanism of the site-specific recombination system of dif-XerCD etc. can inhibit the DNA polymer as by-product Generation.In addition, it is found that by by oriC using transposons import cyclic DNA in, even if without oriC cyclic DNA only with Also the duplication or amplification of cyclic DNA are able to carry out in the presence of low-down concentration.

In the present specification, the enzyme group duplication of above-mentioned (1), (2) and (3) or the reaction of amplification cyclic DNA will be used sometimes It is denoted as RCR (replication-cycle reaction).

In addition, in the present specification, DNA polymer refers to: the generated polymer when replicating or expanding cyclic DNA DNA (multimeric DNA).Here, the DNA of polymer refers to: using the cyclic DNA of template as monomer (monomer) polymer occurs when capturing.In the present specification, DNA polymer is simply also denoted as " polymer " sometimes.

Though the application includes the invention of following manner that is, without being limited thereto.

[1] clone method of the cyclic DNA in a kind of cell free system, it includes processes below:

Process (1): being formed into the cyclic DNA of template and the reaction mixture of reaction solution, and the reaction solution includes following Component:

First enzyme group of the duplication of catalysis cyclic DNA,

Catalysis Okazaki fragments connection reaction and be synthetically formed 2 sisters' cyclic DNAs of catenane second enzyme group and

It is catalyzed the third enzyme group of the separation reaction of 2 sisters' cyclic DNAs；With

Process (2): react the reaction mixture formed in process (1)；

Here, the cyclic DNA include can with replication initiation sequence (the origin of in conjunction with the active enzyme of DnaA Chromosome (oriC)) and also comprising being respectively relative to the 1 pair of ter sequence and/or DNA polymer that oriC is inserted into outward The base sequence of enzyme identification is separated,

Here, in the case where the cyclic DNA has ter sequence, the reaction solution of foregoing sequence (1) also includes to have to combine Inhibit the active protein of duplication in ter sequence, also, there is the alkali of DNA polymer separation enzyme identification in the cyclic DNA In the case where basic sequence, the reaction solution of foregoing sequence (1) also includes DNA polymer separation enzyme.

[2] method according to above-mentioned [1], wherein it is Cre or XerCD that DNA polymer, which separates enzyme,.

[3] clone method of the cyclic DNA in a kind of cell free system, it includes processes below:

First enzyme group of the duplication of catalysis cyclic DNA,

Process (2): react the reaction mixture formed in process (1)；

Here, the cyclic DNA include can with replication initiation sequence (the origin of in conjunction with the active enzyme of DnaA Chromosome (oriC)) and also comprising being respectively relative to the 1 pair of ter sequence and/or XerCD identification that oriC is inserted into outward Base sequence,

Here, in the case where the cyclic DNA has ter sequence, the reaction solution of foregoing sequence (1) also includes to have to combine Inhibit the active protein of duplication in ter sequence, also, there are the feelings of the base sequence of XerCD identification in the cyclic DNA Under condition, the reaction solution of foregoing sequence (1) also includes XerCD protein.

[4] method according to any one of above-mentioned [1] to [3], wherein be just respectively relative to what oriC was inserted into outward 1 for ter sequence, and the ter sequence as a side is in the 5 ' sides of oriC inserted with comprising in sequence shown in sequence number 1~14 Any sequence sequence, as another party ter sequence in the 3 ' sides of oriC inserted with including sequence shown in sequence number 1~14 The sequence of the complementary series of column.

[5] method according to any one of above-mentioned [1] to [4], wherein have and be incorporated into ter sequence and inhibit multiple The active protein of system is Tus albumen or RTP albumen.

[6] method according to above-mentioned [2] or [3], wherein the base sequence of XerCD identification is to include sequence number 15 The sequence of any sequence in sequence shown in~24 or its complementary series.

[7] method according to above-mentioned [2], wherein the base sequence of Cre identification is comprising shown in sequence number 30~35 Sequence in any sequence sequence or its complementary series.

[8] a kind of nucleic acid comprising oriC and is respectively relative to for the linear DNA of the length with 273bp~2.0kb The base sequence for 1 pair of ter sequence and/or DNA polymer the separation enzyme identification that oriC is inserted into outward.

[9] a kind of nucleic acid comprising oriC and is respectively relative to for the linear DNA of the length with 273bp~2.0kb The base sequence for 1 pair of ter sequence and/or the XerCD identification that oriC is inserted into outward.

[10] clone method of the cyclic DNA in a kind of cell free system, it includes processes below:

Process (1): oriC transposons and transposase are added in buffer and form oriC swivel base body (transposome), here, oriC transposons be comprising can with the replication initiation sequence in conjunction with the active enzyme of DnaA The linear DNA of (origin of chromosome (oriC)) and for its two end include outer end (OE) sequence linear DNA；With

It reacts oriC swivel base body and the cyclic DNA without oriC in buffer, carries out transfer reaction；

Thus the cyclic DNA comprising oriC is prepared；

Process (2): the reaction mixture of cyclic DNA and reaction solution obtained in formation process (1) comprising oriC, it is described Reaction solution includes following components:

First enzyme group of the duplication of catalysis cyclic DNA,

Process (3): react the reaction mixture formed in process (2).

[11] method according to above-mentioned [10], wherein OE sequence includes sequence number 25 (5 '- CTGTCTCTTATACACATCT-3 ') shown in sequence and its complementary series, process (1) linear DNA 5 ' ends be inserted into There is the OE sequence comprising sequence shown in sequence number 25, in 3 ' ends of the linear DNA inserted with comprising shown in sequence number 25 The OE sequence of the complementary series of sequence.

[12] method according to above-mentioned [10] or [11] is comprising the cyclic DNA of oriC also includes opposite respectively The base sequence of enzyme identification is separated in oriC 1 pair of ter sequence being inserted into outward and/or DNA polymer,

Here, in the case where the cyclic DNA has ter sequence, the reaction solution of foregoing sequence (2) also includes to have to combine Inhibit the active protein of duplication in ter sequence, also, there is the alkali of DNA polymer separation enzyme identification in the cyclic DNA In the case where basic sequence, the reaction solution of foregoing sequence (2) also includes DNA polymer separation enzyme.

[13] method according to above-mentioned [10] or [11] is comprising the cyclic DNA of oriC also includes opposite respectively In the base sequence that oriC 1 pair of ter sequence being inserted into outward and/or XerCD are identified,

Here, in the case where the cyclic DNA has ter sequence, the reaction solution of foregoing sequence (2) also includes to have to combine Inhibit the active protein of duplication in ter sequence, also, there are the feelings of the base sequence of XerCD identification in the cyclic DNA Under condition, the reaction solution of foregoing sequence (2) also includes XerCD albumen.

[14] method according to any one of above-mentioned [10] to [13], wherein the oriC transposons of process (1) also wraps Containing the base sequence for being respectively relative to 1 pair of ter sequence that oriC is inserted into outward and/or the separation enzyme identification of DNA polymer,

Here, in the case where the linear DNA has ter sequence, the reaction solution of foregoing sequence (2) also includes to have to combine Inhibit the active protein of duplication in ter sequence, also, there is the alkali of DNA polymer separation enzyme identification in the cyclic DNA In the case where basic sequence, the reaction solution of foregoing sequence (2) also includes DNA polymer separation enzyme.

[15] method according to any one of above-mentioned [10] to [13], wherein the oriC transposons of process (1) also wraps Containing the base sequence for being respectively relative to 1 pair of ter sequence that oriC is inserted into outward and/or XerCD identification,

Here, in the case where the linear DNA has ter sequence, the reaction solution of foregoing sequence (2) also includes to have to combine Inhibit the active protein of duplication in ter sequence, also, there are the feelings of the base sequence of XerCD identification in the cyclic DNA Under condition, the reaction solution of foregoing sequence (2) also includes XerCD albumen.

[16] method according to any one of above-mentioned [10] to [15], wherein also include process (4): from process (3) oriC transposons is removed in the cyclic DNA for replicating or expanding in reaction product.

[17] a kind of nucleic acid is comprising oriC and opposite respectively for the linear DNA of the length with 311bp~2.0kb Include in oriC 1 pair of ter sequence being inserted into outward and/or the base sequence of DNA polymer separation enzyme identification, and in two ends Outer end (OE) sequence.

[18] a kind of nucleic acid is comprising oriC and opposite respectively for the linear DNA of the length with 311bp~2.0kb It include outer end (OE) sequence in the base sequence that oriC 1 pair of ter sequence being inserted into outward and/or XerCD identify, and in two ends Column.

[19] the duplication kit of a kind of cyclic DNA, it includes the combinations of following components:

It is catalyzed the first enzyme group of the duplication of cyclic DNA；

The second enzyme group of 2 sisters' cyclic DNAs of catenane is reacted and is synthetically formed in catalysis Okazaki fragments connection；

It is catalyzed the third enzyme group of the separation reaction of 2 sisters' cyclic DNAs；

OriC transposons, here, oriC transposons be comprising can with the replication initiation in conjunction with the active enzyme of DnaA The linear DNA of sequence (origin of chromosome (oriC)) and for its two end include outer end (OE) sequence threadiness DNA；With

Transposase.

[20] kit according to above-mentioned [19], wherein oriC transposons also includes that be respectively relative to oriC outside The base sequence of 1 pair of ter sequence and/or DNA polymer the separation enzyme identification of insertion.

[21] kit according to above-mentioned [20], wherein also comprising inhibiting duplication with ter sequence is incorporated into Active protein；And/or DNA polymer separates enzyme.

[22] kit according to above-mentioned [19], wherein oriC transposons also includes that be respectively relative to oriC outside The base sequence of 1 pair of ter sequence and/or the XerCD identification of insertion.

[23] kit according to above-mentioned [22], wherein also comprising inhibiting duplication with ter sequence is incorporated into Active protein；And/or XerCD albumen.

The effect of invention

For the present processes, enzyme group below is being used:

(1) it is catalyzed the first enzyme group of the duplication of cyclic DNA；

(3) duplication of third enzyme group or amplification for being catalyzed the separation reaction of 2 sisters' cyclic DNAs have replication initiation sequence When the cyclic DNA of (origin of chromosome (oriC)), the generation of the DNA polymer as by-product can inhibit.Separately Outside, by importing in cyclic DNA oriC using transposons, the duplication or amplification of very low concentration of cyclic DNA are able to carry out. For these reasons, duplication product or amplified production can be efficiently obtained using the present processes.

Detailed description of the invention

Fig. 1 shows the model of the replication cycle of cyclic DNA.

Fig. 2 is the skeleton diagram imported using the oriC box of transposons with duplication or amplified reaction hereafter.

Fig. 3 is to generate the skeleton diagram (a) inhibited using the DNA polymer of termination sequence ter and Tus albumen and show it As a result gel electrophoresis images (b).

Fig. 4 be using locus specificity recombination sequence dif and XerCD DNA polymer generate inhibit skeleton diagram (a), With the gel electrophoresis images (b) for showing its result.

Fig. 5 is the schematic diagram of 15kb-ori-ter cyclic DNA and 15kb-ori-dif cyclic DNA.

Fig. 6 is to generate to inhibit to show about the DNA polymer using termination sequence ter and Tus albumen to carry out Tus titration As a result gel electrophoresis images.

Fig. 7 is to generate to inhibit to show about the DNA polymer using termination sequence ter and Tus albumen to carry out DNA titration As a result gel electrophoresis images.

Fig. 8 is the gel electrophoresis images for showing DNA polymer caused by XerCD and generating the result inhibited.

Fig. 9 is the gel electrophoresis images for showing the amplification of the 15kb plasmid using the transfer of oriC transposons.

Figure 10 is the amplification for showing the 9.3kb plasmid of high GC containing ratio in the Thermophilic Bacteria source using the transfer of oriC transposons As a result gel electrophoresis images.

Figure 11 is the gel electrophoresis images for showing the amplification of the 15kb plasmid using the transfer of oriC transposons.

Figure 12 be show change it is used in oriC transposons transfer reaction in the case where amount of DNA, utilize oriC to turn The gel electrophoresis images of the amplification of the 15kb plasmid of stand transfer.

Figure 13 is the amplification for showing the 9.3kb plasmid of high GC containing ratio in the Thermophilic Bacteria source using the transfer of oriC transposons As a result gel electrophoresis images.

Figure 14 is the amplification about the 9.3kb plasmid of the high GC containing ratio in the Thermophilic Bacteria source using the transfer of oriC transposons Object shows the gel electrophoresis images for carrying out the result of limitation enzymic digestion (KpnI and NheI).

Figure 15 is the gel electrophoresis images for showing the result of cyclisation of research λ DNA.

Figure 16 is that the cyclisation for showing λ DNA and the gel electrophoresis of the amplification of the cyclic DNA after the transfer of oriC transposons are shone Piece.

Figure 17 is that the amplified matter for the cyclic DNA that displaced about the cyclisation of λ DNA with oriC transposons shows carry out restriction enzyme Digest the gel electrophoresis images of the result of (HindIII).

Figure 18 is the schematic diagram of the reaction that falls off of oriC transposons.

Figure 19 is the chart of oriC transposons of the evaluation comprising Km-oriC to fall off.

Figure 20 is the chart evaluated after oriC transposons falls off the Amp resistant gene of recovery.

Figure 21 be fall off reaction and the oriC transposons of oriC transposons based on cutting except dereaction schematic diagram.

Figure 22 is the gel electrophoresis images for showing DNA polymer caused by Cre and generating the result inhibited.

Specific embodiment

Next, being specifically illustrated to the present invention, but the present invention is not restricted to these.In the present specification, as long as not Especially definition, then the scientific term used and technical term are associated in the present invention has containing for those skilled in the art's general understanding Meaning.

< cyclic DNA >

The cyclic DNA used as template is preferably double-strand.As long as the cyclic DNA used as template is comprising can be with tool The replication initiation sequence (origin of chromosome (oriC)) for having the active enzyme of DnaA to combine then is not particularly limited, can It illustrates: the natural cyclic DNA such as circular chromosome of microorganism；Natural cyclic DNA is being obtained by the cutting such as enzymatic treatment The upper other DNA fragmentation of connection such as substance, the cyclic DNA for being cyclized it；It is carried out at cyclisation to the naturally occurring DNA of straight-chain Cyclic DNA made of reason；Completely artificial synthesized cyclic DNA etc..As can with the duplication in conjunction with the active enzyme of DnaA Homing sequence (oriC) (hereinafter, being abbreviated as " replication initiation sequence " or " oriC " sometimes), can from NCBI (http: // The public databases acquisition such as www.ncbi.nlm.nih.gov/) is present in the bacterium such as Escherichia coli, bacillus subtilis Well known replication initiation sequence.In addition, by clone can with the DNA fragmentation in conjunction with the active enzyme of DnaA, to its base Sequence is parsed, also available replication initiation sequence.

In the present invention, the cyclic DNA used as template can be cyclic DNA originally comprising replication initiation sequence, It is also possible to import cyclic DNA made of replication initiation sequence to cyclic DNA of the script without replication initiation sequence.

About importing replication initiation sequence in the cyclic DNA for being free of replication initiation sequence to script, preparing makes as template The method of cyclic DNA, using well known to a person skilled in the art methods.In a mode, replication initiation sequence is not to Importing in the cyclic DNA of the sequence containing replication initiation can carry out as follows: by the transposons DNA comprising replication initiation sequence and turn Seat enzyme be added in buffer and formed include replication initiation sequence swivel base body, make the swivel base body comprising replication initiation sequence with Cyclic DNA without replication initiation sequence reacts in buffer, to carry out transfer reaction, wherein described comprising replicating The transposons DNA of beginning sequence is the linear DNA comprising replication initiation sequence and its two end includes outer end (OE) sequence, 5 ' ends The linear DNA being phosphorylated.

The cyclic DNA used in the present invention as template can include kanamycins, ampicillin, four according to purpose Drug-resistance marker's gene order of ring element etc..

The cyclic DNA used in the present invention as template can be purified, and be also possible to the thallus comprising cyclic DNA and extracted The form of the suspension of object etc..It, can also will such as DNA library etc furthermore it is possible to used using a kind of cyclic DNA as template The mixtures of a variety of cyclic DNAs use in 1 test tube as template.

In the present invention, there is no limit can be set to such as 1kb (1000 alkali to the length of the cyclic DNA used as template Base length) more than, 5kb (5000 bases longs) or more, 8kb (8,000 bases longs) or more, 10kb (10,000 bases longs) Above, 50kb (50,000 bases longs) or more, 100kb (100,000 bases longs) or more, (200,000 bases are long by 200kb Degree) more than, 500kb (500,000 bases longs) or more, 1000kb (1,000,000 bases longs) or more or 2000kb (2, 000,000 bases longs) more than length.

< the first, second, and third enzyme group >

1.First enzyme group

In the present specification, the first enzyme group refers to the enzyme group of the duplication of catalysis cyclic DNA.

First enzyme group of the duplication as catalysis cyclic DNA, can be used such as Kaguni JM&Kornberg The enzyme group recorded in A.Cell.1984,38:183-90.Specifically, as the first enzyme group, can illustrate enzyme selected from the following or Whole combinations of one or more of enzyme group or following enzyme or enzyme group: the nucleoid with the active enzyme of DnaA, a kind or more Albumen has the active enzyme of DNA gyrase or enzyme group, single-stranded DNA binding protein (single-strand binding Protein (SSB)), the enzyme with DnaB type helicase activity, with DNA helicase load the active enzyme of body, draw with DNA The enzyme of enzymatic activity is sent out, active enzyme is pressed from both sides with DNA and there is the active enzyme of DNA polymerase i II* or enzyme group.

As with the active enzyme of DnaA, as long as having same as the DnaA of starting material albumen as Escherichia coli Then its biological origin is not particularly limited the active enzyme of starting material, can be suitable for the DnaA using such as Escherichia coli. The DnaA of Escherichia coli can include with the range of 1nM~10 μM in reaction solution in terms of monomer, preferably can be with 1nM ~~5 μM, 1nM~3 μM, 1nM~1.5 μM, 1nM~1.0 μM, 1nM~500nM, 50nM~200nM, 50nM~150nM model It encloses include, but are not limited to this.

Nucleoid albumen refers to protein contained in nucleoid.1 kind or more of nucleoid albumen used in the present invention As long as have with the same active enzyme of the nucleoid albumen of Escherichia coli, then its biological origin is not particularly limited, can To be suitable for complex (heterodimer or homologous dimerization using IHF, i.e. IhfA and/or the IhfB of such as Escherichia coli Body) or the HU of Escherichia coli, i.e. hupA and hupB complex.The IHF of Escherichia coli is with heterologous/homodimer Meter can include with the range of 5nM~400nM in reaction solution, preferably can be with 5nM~200nM, 5nM~100nM, 5nM ~50nM, 10nM~50nM, 10nM~40nM, 10nM~30nM range include, but are not limited to this.Escherichia coli HU can include that can preferably be come with the range of 5nM~50nM, 5nM~25nM with the range of 1nM~50nM in reaction solution It include, but are not limited to this.

As with the active enzyme of DNA gyrase or enzyme group, as long as having same as the DNA gyrase of Escherichia coli Active enzyme, then its biological origin is not particularly limited, and can be suitable for GyrA and GyrB using such as Escherichia coli It is formed by complex.The GyrA and GyrB of Escherichia coli are formed by complex in terms of the heterologous tetramer in reaction solution Can include with the range of 20nM~500nM, preferably can with 20nM~400nM, 20nM~300nM, 20nM~200nM, 50nM~200nM, 100nM~200nM range include, but are not limited to this.

As single-stranded DNA binding protein (single-strand binding protein (SSB)), as long as have with The same active enzyme of the single-stranded DNA binding protein of Escherichia coli, then its biological origin is not particularly limited, and can be suitable for making With the SSB of such as Escherichia coli.The SSB of Escherichia coli in terms of homotetramer in reaction solution can with 20nM~ The range of 1000nM includes, preferably can with 20nM~500nM, 20nM~300nM, 20nM~200nM, 50nM~500nM, The model of 50nM~400nM, 50nM~300nM, 50nM~200nM, 50nM~150nM, 100nM~500nM, 100nM~400nM It encloses include, but are not limited to this.

As the enzyme with DnaB type helicase activity, as long as having similarly active with the DnaB of Escherichia coli Enzyme, then its biological origin is not particularly limited, and can be suitable for the DnaB using such as Escherichia coli.Escherichia coli DnaB can include with the range of 5nM~200nM in reaction solution in terms of homo-hexamer, preferably can with 5nM~ 100nM, 5nM~50nM, 5nM~30nM range include, but are not limited to this.

The active enzyme of body is loaded as with DNA helicase, as long as having similarly active with the DnaC of Escherichia coli Enzyme, then its biological origin is not particularly limited, and can be suitable for the DnaC using such as Escherichia coli.Escherichia coli come The DnaC in source can include with the range of 5nM~200nM in reaction solution in terms of homo-hexamer, preferably can with 5nM~ 100nM, 5nM~50nM, 5nM~30nM range include, but are not limited to this.

As with the active enzyme of DNA primase, as long as have with the same active enzyme of the DnaG of Escherichia coli, then Its biological origin is not particularly limited, and can be suitable for the DnaG using such as Escherichia coli.Escherichia coli DnaG can include with the range of 20nM~1000nM in reaction solution in terms of monomer, preferably can with 20nM~800nM, 50nM~800nM, 100nM~800nM, 200nM~800nM, 250nM~800nM, 250nM~500nM, 300nM~500nM Range include, but are not limited to this.

Press from both sides active enzyme as with DNA, as long as have with the same active enzyme of the DnaN of Escherichia coli, then it is given birth to Object source is not particularly limited, and can be suitable for the DnaN using such as Escherichia coli.The DnaN of Escherichia coli with Homodimer meter can include with the range of 10nM~1000nM in reaction solution, preferably can with 10nM~800nM, 10nM~500nM, 20nM~500nM, 20nM~200nM, 30nM~200nM, 30nM~100nM range include, but not It is limited to this.

As with the active enzyme of DNA polymerase i II* or enzyme group, as long as having the archaeal dna polymerase with Escherichia coli III* complex similarly active enzyme or enzyme group, then its biological origin is not particularly limited, and can be suitable for using for example wrapping The enzyme group of any one of DnaX, HolA, HolB, HolC, HolD, DnaE, DnaQ and HolE containing Escherichia coli, it is excellent It is selected as the enzyme group of the complex of DnaX, HolA, HolB and DnaE comprising Escherichia coli, further preferably comprising big The enzyme group of the complex of DnaX, HolA, HolB, HolC, HolD, DnaE, DnaQ and the HolE in enterobacteria source.Escherichia coli The DNA polymerase i II* complex in source can include with the range of 2nM~50nM in reaction solution in terms of heteromultimers, It is preferred that can be come with the range of 2nM~40nM, 2nM~30nM, 2nM~20nM, 5nM~40nM, 5nM~30nM, 5nM~20nM It include, but are not limited to this.

2.Second enzyme group

In the present specification, second enzyme group refers to that 2 elder sisters of catenane are reacted and are synthetically formed in catalysis Okazaki fragments connection The enzyme group of younger sister's cyclic DNA.

In the present invention, 2 sisters' cyclic DNAs for forming catenane refer to 2 ring-types synthesized by DNA replication dna reaction DNA is in the cyclic DNA of connection status.

The second enzyme group of 2 sisters' cyclic DNAs of catenane is synthetically formed as catalysis Okazaki fragments connection reaction, it can With illustrate for example selected from by with the active enzyme of DNA polymerase i, there is the active enzyme of DNA ligase and have RNaseH active Enzyme composition one or more of group enzyme or the enzyme combination.

As with the active enzyme of DNA polymerase i, as long as having with the DNA polymerase i of Escherichia coli as long as same activity Its biological origin is not particularly limited, and can be suitable for the DNA polymerase i using such as Escherichia coli.Escherichia coli come The DNA polymerase i in source can include with the range of 10nM~200nM in reaction solution in terms of monomer, preferably can be with 20nM ~200nM, 20nM~150nM, 20nM~100nM, 40nM~150nM, 40nM~100nM, 40nM~80nM range is wrapped Contain, but not limited to this.

As with the active enzyme of DNA ligase, as long as having with the DNA ligase of Escherichia coli as long as same activity it Biological origin is not particularly limited, and can be suitable for the DNA of the DNA ligase or T4 bacteriophage using such as Escherichia coli Ligase.The DNA ligase of Escherichia coli can be wrapped in terms of monomer in reaction solution with the range of 10nM~200nM Contain, it preferably can be with the range of 15nM~200nM, 20nM~200nM, 20nM~150nM, 20nM~100nM, 20nM~80nM Include, but are not limited to this.

As with the active enzyme of RNaseH, it is given birth to as long as having the activity for decomposing the RNA chain of RNA:DNA hybrid Object source is not particularly limited, and can be suitable for the RNaseH using such as Escherichia coli.Escherichia coli RNaseH can include with the range of 0.2nM~200nM in reaction solution in terms of monomer, preferably can with 0.2nM~ 200nM, 0.2nM~100nM, 0.2nM~50nM, 1nM~200nM, 1nM~100nM, 1nM~50nM, 10nM~50nM model It encloses include, but are not limited to this.

3.Third enzyme group

In the present specification, third enzyme group refers to the enzyme group of the separation reaction of 2 sisters' cyclic DNAs of catalysis.

The third enzyme group of separation reaction as 2 sisters' cyclic DNAs of catalysis, can be used such as Peng H&Marians The enzyme group recorded in KJ.PNAS.1993,90:8571-8575.Specifically, selected from the following 1 can be illustrated as third enzyme group Kind or more enzyme or the enzyme combination: with the active enzyme of topoisomerase I V, have the active enzyme of topoisomerase II I and Enzyme with RecQ type helicase activity.

As with the active enzyme of topoisomerase II I, as long as having same as the topoisomerase II I of Escherichia coli Active then its biological origin is not particularly limited, and can be suitable for the topoisomerase II I using such as Escherichia coli.Greatly The topoisomerase II I in enterobacteria source can include with the range of 20nM~500nM in reaction solution in terms of monomer, preferably Can include with the range of 20nM~400nM, 20nM~300nM, 20nM~200nM, 20nM~100nM, 30~80nM, but It is without being limited thereto.

As the enzyme with RecQ type helicase activity, as long as have with the RecQ of Escherichia coli same activity then its Biological origin is not particularly limited, and can be suitable for the RecQ using such as Escherichia coli.The RecQ of Escherichia coli Can include with the range of 20nM~500nM in reaction solution in terms of monomer, preferably can with 20nM~400nM, 20nM~ 300nM, 20nM~200nM, 20nM~100nM, 30~80nM range include, but are not limited to this.

As with the active enzyme of topoisomerase I V, similarly live as long as having with the topoisomerase I V of Escherichia coli Then its biological origin is not particularly limited property, can be suitable for using for example as the Escherichia coli of the complex of ParC and ParE The topoisomerase I V in source.The topoisomerase I V of Escherichia coli can be in reaction solution in terms of the heterologous tetramer The range of 0.1nM~50nMM includes, preferably can with 0.1nM~40nM, 0.1nM~30nM, 0.1nM~20nM, 1nM~ 40nM, 1nM~30nM, 1nM~20nM, 1nM~10nM, 1nM~5nM range include, but are not limited to this.

Commercially available product can be used in the first, second, and third above-mentioned enzyme group, also can be used from the extractions such as microorganism and basis The enzyme group for needing to purify.Enzyme from microorganism extraction and purifying that method that those skilled in the art can utilize can be used is suitable Preferably implement.

Enzyme other than the enzyme of Escherichia coli shown in stating in use is as above-mentioned first, second, and third enzyme group When, it can be relative to the concentration range that the enzyme for above-mentioned Escherichia coli determines according to comparable dense in terms of unit of enzyme activity Degree range come using.

The reaction solution of the cell-free protein expression system containing above-mentioned enzyme can also be made directly to mix with the cyclic DNA for becoming template Close and formed the reaction mixture of duplication or the amplification for cyclic DNA.Cell-free protein expression system can be with containing by With total serum IgE (total RNA), mRNA or the in of the RNA of the Sequence composition of the base sequence complementary for the gene for encoding above-mentioned enzyme Vitro transcription product etc. is united as the cell free translation system of template ribonucleic acid, is also possible to encode the gene of each enzyme or containing coding The cell-free transcription translation system as template DNA such as expression vector of the gene of each enzyme.

Clone method (A) > of < cyclic DNA

In a mode, this application involves the duplications of the cyclic DNA in cell free system or amplification method (hereinafter, at this Sometimes " method (A) " is denoted as in specification), it includes processes below:

First enzyme group of the duplication of catalysis cyclic DNA,

Process (2): react the reaction mixture formed in process (1)；

Here, in the case where the cyclic DNA has ter sequence, the reaction solution of foregoing sequence (1) also includes to have to combine Inhibit the active protein of duplication in ter sequence, also, there are the feelings of the base sequence of XerCD identification in the cyclic DNA Under condition, the reaction solution of foregoing sequence (1) also includes XerCD albumen.

Although being not limited by theory, method (A) is by replication cycle shown in FIG. 1 or repeats the duplication It recycles and replicates or expand cyclic DNA.In the present specification, duplication cyclic DNA refers to: generating and the cyclic DNA as template Identical molecule.When the duplication of cyclic DNA can be started by the cyclic DNA amount in the reaction product after reaction relative to reaction The cyclic DNA amount as template increase this point and confirm.Preferably, the duplication of cyclic DNA refers to: starting relative to reaction When cyclic DNA amount, the cyclic DNA amount in reaction product increases at least 2 times, 3 times, 5 times, 7 times, 9 times.Expand cyclic DNA Refer to: the duplication of cyclic DNA promotes, the ring as template when the amount of the cyclic DNA in reaction product starts relative to reaction Shape amount of DNA increases according to index rank.Therefore, the amplification of cyclic DNA is a kind of mode of the duplication of cyclic DNA.In this explanation In book, the amplification of cyclic DNA refers to: the cyclic DNA amount as template when starting relative to reaction, the ring-type in reaction product Amount of DNA increases at least 10 times, 50 times, 100 times, 200 times, 500 times, 1000 times, 2000 times, 3000 times, 4000 times, 5000 times Or 10000 times.

In the present processes, " cell free system " refers to not intracellular replication reaction.That is, using cell free system The present processes of implementation are to carry out in vitro.It is also the same in " method (B) " recorded below.

It is recorded in such as project of above-mentioned < cyclic DNA > about the cyclic DNA mixed with reaction solution.Make in every 1 reaction The amount of template DNA is not particularly limited, for example, react start when can with 10ng/ μ l or less, 5ng/ μ l or less, 1ng/ μ l or less, 0.8ng/ μ l or less, 0.5ng/ μ l or less, 0.1ng/ μ l or less, 50pg/ μ l or less, 5pg/ μ l or less, 0.5pg/ μ l or less, 50fg/ μ l or less, 5fg/ μ l or less, 0.5fg/ μ l concentration below are present in reaction solution.Further It ground can also there are the cyclic DNAs of 1 molecule as template is used to replicate or expand using every 1 reaction when reaction starts.

As the cyclic DNA of template comprising being respectively relative to 1 pair of ter sequence that oriC is inserted into outward used in method (A) Column and/or the base sequence of XerCD identification.In the case where the cyclic DNA has ter sequence, the reaction solution of process (1) is also wrapped Containing have be incorporated into ter sequence and inhibit duplication active protein, also, the cyclic DNA have XerCD identification alkali In the case where basic sequence, the reaction solution of process (1) also includes XerCD albumen.

Inhibit the active protein of duplication and/or XerCD that commercially available product can be used with ter sequence is incorporated into, The protein extracted from microorganism etc. simultaneously as needed after purification can be used.Enzyme from microorganism extraction and purifying can be with Suitably implemented using the method that those skilled in the art can utilize.

Ter sequence on DNA and the group of the active protein of duplication is inhibited to be combined into progress with ter sequence is incorporated into Replicate the mechanism of termination.The mechanism is found in various bacteria, for example, it is known in Escherichia coli for Tus-ter system (Hiasa, H.,and Marians,K.J.,J.Biol.Chem.,1994,269:26959-26968；Neylon,C.,et al., Microbiol.Mol.Biol.Rev., 2005 September, p.501-526), it is RTP-ter in bacillus System (Vivian, et al., J.Mol.Biol., 2007,370:481-491).It, should by utilizing in the present processes Mechanism is able to suppress the generation of the DNA polymer as by-product.About on DNA ter sequence and have be incorporated into ter sequence The combination of column and the active protein of inhibition duplication, biological origin are not particularly limited.

In preferred embodiment, the present processes use the combination of ter sequence and Tus albumen.In combination with Tus albumen The ter sequence used can be comprising 5 '-GN [A/G] [T/A] GTTGTAAC [T/G] A-3 ' (sequence number 1), more preferably 5 '-G [T/G] A [T/A] GTTGTAAC [T/G] A-3 ' (sequence number 2), 5 '-GTATGTTGTAACTA-3 ' (sequence number 3), 5 '- AGTATGTTGTAACTAAAG-3 ' (sequence number 4), 5 '-GGATGTTGTAACTA-3 ' (sequence number 5), 5 '- GTATGTTGTAACGA-3 ' (sequence number 6), 5 '-GGATGTTGTAACTA-3 ' (sequence number 7), 5 '-GGAAGTTGTAACGA-3 ' The sequence of (sequence number 8) or 5 '-GTAAGTTGTAACGA-3 ' (sequence number 9).The source of Tus albumen is not particularly limited, excellent It is selected as the Tus albumen of Escherichia coli.Tus albumen can include with the range of 1nM~200nM in reaction solution, preferably Can with 2nM~200nM, 2nM~100nM, 5nM~200nM, 5nM~100nM, 10nM~100nM, 20nM~100nM, The range of 20nM~80nM include, but are not limited to this.

In another preferred embodiment, the present processes use the combination of ter sequence and RTP albumen.With the group of RTP albumen Ter sequence used in conjunction is comprising 5 '-AC [T/A] [A/G] ANNNNN [C/T] NATGTACNAAAT-3 ' (sequence number 10), excellent It is selected as 5 '-ACTAATT [A/G] A [A/T] C [T/C] ATGTACTAAAT-3 ' (sequence number 11), 5 '-ACTAATT [A/G] A [A/T] C [T/C] ATGTACTAAATTTTCA-3 ' (sequence number 12), 5 '-GAACTAATTAAACTATGTACTAAATTTTCA-3 ' (sequence Or the sequence of 23~30 bases longs of 5 '-ATACTAATTGATCCATGTACTAAATTTTCA-3 ' (sequence number 14) number 13). As ter sequence, when selection includes the sequence of sequence number 10~12 and has the sequence of 23~30 bases longs, the sequence phase It can have at least 70%, at least 80%, at least 90%, at least 95% sequence identity for sequence number 13 or 14.RTP egg White source is not particularly limited, preferably the RTP albumen in bacillus source, more preferably bacillus subtilis The RTP albumen in the source (Bacillus subtilis).Tus albumen can be wrapped in reaction solution with the range of 1nM~200nM Contain, preferably can with 2nM~200nM, 2nM~100nM, 5nM~200nM, 5nM~100nM, 10nM~100nM, 20nM~ 100nM, 20nM~80nM range include, but are not limited to this.About ter sequence, " being inserted into outward relative to oriC " refers to: Have be incorporated into ter sequence and inhibit duplication active protein compound action under, for from oriC towards outside The duplication in direction allow to be replicated, and the duplication in the direction for entering to oriC does not allow then to replicate and stops carrying out Ter sequence is inserted into direction.The arrow of ter sequence in (a) of Fig. 3 and Fig. 5 show 1 pair of ter sequence be respectively relative to oriC by According to the state of outwardly direction insertion.Accordingly, with respect to ter sequence, " being respectively relative to 1 pair that oriC is inserted into outward " refers to: one Side is in the 5 ' sides of oriC inserted with the sequence comprising any sequence in sequence shown in sequence number 1~14, another party in oriC Sequence of the 3 ' sides inserted with the complementary series comprising sequence shown in sequence number 1~14 state.

For ter sequence, as long as relative to oriC 1 pair of insertion outward respectively, so that it may be present in any position.Example Such as, 1 pair of ter sequence can reside in the region for becoming opposite side (Japanese: to pole To な Ru) relative to oriC, there may also be Near the two sides oriC or adjacent region.It, can be by oriC when being present in region near the two sides oriC or adjacent Functional box is made with 1 pair of ter sequence, therefore importing of oriC and 1 pair of ter sequence to DNA becomes easy, having becomes template Cyclic DNA preparation cost reduce the advantages of.

The sequence of XerCD identification and the group of XerCD albumen on DNA are combined into the isolated mechanism for carrying out DNA polymer (Ip,S.C.Y.,et al.,EMBO J.,2003,22:6399-6407).XerCD albumen is the complex of XerC and XerD.Make The sequence identified by XerCD albumen, it is known to dif sequence, cer sequence, psi sequence (Colloms, et al., EMBO J., 1996,15(5):1172-1181；Arciszewska,L.K.,et al.,J.Mol.Biol.,2000,299:391-403).In In the present processes, by utilizing the mechanism, it is able to suppress the generation of the DNA polymer as by-product.About on DNA The sequence of XerCD identification and the combination of XerCD albumen, biological origin are not particularly limited.In addition, for XerCD, Its promotive factor be it is known, such as FtsK albumen can promote dif function (Ip, S.C.Y., et al., EMBO J., 2003, 22:6399-6407).In a mode, FtsK albumen may include in the reaction solution of the application method.

The sequence of XerCD identification can be comprising 5 '-GGTGCG [C/T] [A/G] [T/C] AANNNNNNTTATG [T/G] TAAA [T/C] -3 ' (sequence number 15), 5 '-GGTGCG [C/T] A [T/C] AANNNNNNTTATG [T/G] TAAAT-3 ' (sequence number 16), 5 '-GGTGCGC [A/G] [T/C] AANNNNNNTTATGTTAAA [T/C] -3 ' (sequence number 17), 5 '-GGTGCG [C/T] [A/G] CAANNNNNNTTATG [T/G] TAAA [T/C] -3 ' (sequence number 18), 5 ' - GGTGCGCATAANNNNNNTTATGTTAAAT-3 ' (sequence number 19), 5 '-GGTGCGTACAANNNNNNTTATGGTAAAT-3 ' (sequence number 20), 5 '-GGTGCGCGCAANNNNNNTTATGTTAAAC-3 ' (sequence number 21), 5 '- GGTGCGCATAATGTATATTATGTTAAAT-3 ' (sequence number 22/dif sequence), 5 '- GGTGCGTACAAGGGATGTTATGGTAAAT-3 ' (sequence number 23/cer sequence) or 5 '- The complementary series of GGTGCGCGCAAGATCCATTATGTTAAAC-3 ' (sequence number 24/psi sequence) or either of which person Sequence.1st~11 base portion of sequence number 15~24 be XerC binding site, the 18th~28 of sequence number 15~24 the The base portion of position is XerD binding site.12nd~17 base portion (6 alkali shown in NNNNNN of sequence number 15~21 Base portion point) be not XerC or XerD bond area, therefore sequence is not particularly limited.Preferably, sequence number 15~21 12nd~17 alkali of 12nd~17 base (6 base portion shown in the NNNNNN) sequence relative to sequence number 22~24 Basic sequence can have at least 70%, at least 80%, at least 90%, at least 95% sequence identity.

XerCD albumen is preferably the XerCD albumen of Escherichia coli.XerCD albumen in reaction solution can with 1nM~ The range of 200nM includes, preferably can with 5nM~200nM, 5nM~150nM, 10nM~200nM, 10nM~150nM, 20nM~200nM, 20nM~150nM, 20nM~100nM range include, but are not limited to this.

The sequence of XerCD identification can reside in any position on cyclic DNA.Such as the sequence of XerCD identification can be with It is present in the region for becoming opposite side relative to oriC, can also exist on region near oriC or adjacent.When being present in Near oriC or when adjacent region, functional box can be made by oriC and by the XerCD sequence identified, thus oriC and Importing by from the sequence of XerCD identification to DNA becomes easy, there is the preparation cost of the cyclic DNA as template to reduce excellent Point.

In this specification, the consistency % of 2 base sequences, which can be checked by visual observation with mathematical computations, to be determined.Separately Outside, consistency % can also be determined using computer program.Compare computer program as this kind of sequence, it can be mentioned, for example can With from the website of U.S. national library of medicine: http://www.ncbi.nlm.nih.gov/blast/bl2seq/ The BLASTN program (Altschul et al. (1990) J.Mol.Biol.215:403-10) utilized in bls.html: version number Or WU-BLAST2.0 algorithm etc. 2.2.7.The setting of standardized default parameter about WU-BLAST2.0 can be used with off line It stands: the parameter recorded in http://blast.wustl.edu.

The first, second, and third enzyme group contained in reaction solution, according to above-mentioned < the first, second, and third enzyme group > Project in record.

In some mode, the first enzyme group used in the present processes may include the combination of following enzymes or enzyme group: With the active enzyme of DnaA, a kind or more of nucleoid albumen, there is the active enzyme of DNA gyrase or enzyme group, single stranded DNA to combine Albumen (single-strand binding protein (SSB)), the enzyme with DnaB type helicase activity untwist with DNA Enzyme loads the active enzyme of body, active enzyme is pressed from both sides with the active enzyme of DNA primase, with DNA and has DNA polymerase i II* Active enzyme or enzyme group.Here, a kind or more of nucleoid albumen can be IHF or HU, have the active enzyme of DNA gyrase or Enzyme group can be GyrA and GyrB is formed by complex, and the enzyme with DnaB type helicase activity can be DnaB unwindase, Loading the active enzyme of body with DNA helicase can be DnaC unwindase loading body, and there is the active enzyme of DNA primase can be DnaG primase, there is DNA, which to press from both sides active enzyme, can be DnaN folder, also, have the active enzyme of DNA polymerase i II* or enzyme group It can be enzyme or enzyme group comprising any one of DnaX, HolA, HolB, HolC, HolD, DnaE, DnaQ and HolE.

In other mode, second enzyme group used in method of the invention be may include with DNA polymerase i activity Enzyme and combination with the active enzyme of DNA ligase.Alternatively, second enzyme group may include it is active with DNA polymerase i Enzyme, the combination with the active enzyme of DNA ligase and with the active enzyme of RNaseH.

In another mode, third enzyme group used in the present processes may include living with topoisomerase II I Property enzyme and/or have the active enzyme of topoisomerase I V.It lives alternatively, third enzyme group may include with topoisomerase II I The combination of the enzyme and the enzyme with RecQ type helicase activity of property.Alternatively, in addition third enzyme group can be with topoisomerase The active enzyme of III, the enzyme with RecQ type helicase activity and the combination with the active enzyme of topoisomerase I V.

Reaction solution may include buffer, ATP, GTP, CTP, UTP, dNTP, magnesium ion source and alkali metal ion source.

As long as the buffering that buffer contained in reaction solution is suitable for for the use under pH7~9, preferably pH8 Liquid is then not particularly limited.It can be mentioned, for example Tris-HCl, Hepes-KOH, phosphate buffer, MOPS-NaOH, Tricine- HCl etc..Preferred buffer is Tris-HCl.The concentration of buffer can suitably be selected by those skilled in the art, without spy It does not limit, in the case where Tris-HCl, can choose the concentration of such as 10mM~100mM, 10mM~50mM, 20mM.

ATP refers to adenosine triphosphate.When reacting beginning, the concentration of ATP contained in reaction solution can be such as 0.1mM The range of~3mM can also be preferably the range of 0.1mM~2mM, 0.1mM~1.5mM, 0.5mM~1.5mM.

GTP, CTP and UTP each refer to guanosine triphosphate, cytidine triphosphate (CTP) and uridine triphosphate.It is anti-when reacting beginning Answer the concentration of GTP, CTP and UTP contained in liquid that can be each independently the range of such as 0.1mM~3.0mM, it can also be preferred For the range of 0.5mM~3.0mM, 0.5mM~2.0mM.

DNTP be deoxyadenosine triphosphate (dATP), deoxyguanosine triphosphate (dGTP), deoxycytidine triphosphate (dCTP), With the general name of deoxythymidine triphosphoric acid (dTTP).When reacting beginning, the concentration of dNTP contained in reaction solution can be example It can also be preferably the range of 0.05mM~1mM, 0.1mM~1mM such as the range of 0.01~1mM.

Magnesium ion source is the offer magnesium ion (Mg into reaction solution²⁺) substance.It can be mentioned, for example Mg (OAc)₂、MgCl₂And MgSO₄Deng.Preferred magnesium ion source is Mg (OAc)₂.React start when reaction solution contained in the concentration of magnesium ion source can be with It is to provide the concentration of magnesium ion for example in reaction solution with the range of 5~50mM.

Alkali metal ion source is the substance that alkali metal ion is given into reaction solution.As alkali metal ion, example can be enumerated Such as sodium ion (Na⁺), potassium ion (K⁺).As the example in alkali metal ion source, potassium glutamate, potassium aspartate, chlorination can be enumerated Potassium, potassium acetate, sodium glutamate, NaAsp, sodium chloride and sodium acetate.Preferred alkali metal ion source is potassium glutamate.In The concentration in alkali metal ion source contained in reaction solution can be mentioned in reaction solution with the range of 100mM~300mM when reaction starts For the concentration of alkali metal ion, but not limited to this.It, can also be from above-mentioned alkali metal ion in order to be consistent with first application 150mM is excluded in the concentration in source.

Reaction solution can also include the non-specific adsorption inhibitor of protein or the non-specific adsorption inhibitor of nucleic acid. Preferably, reaction solution can also include the non-specific adsorption inhibitor of protein and the non-specific adsorption inhibitor of nucleic acid. It is present in reaction solution by the non-specific adsorption inhibitor and/or the non-specific adsorption inhibitor of nucleic acid that make protein, It can inhibit protein each other and/or non-specific adsorption, protein and the cyclic DNA of protein and cyclic DNA are to container table The attachment in face can expect that reaction efficiency improves.

The non-specific adsorption inhibitor of protein refer to in the present processes duplication or amplified reaction it is unrelated Protein.As such protein, it can be mentioned, for example bovine serum albumin(BSA) (BSA), lysozyme, gelatin, heparin and caseins Deng.The non-specific adsorption inhibitor of protein can in reaction solution with the range of 0.02~2.0mg/ml, preferably 0.1~ 2.0mg/ml, 0.2~2.0mg/ml, 0.5~2.0mg/ml range include, but are not limited to this.

The non-specific adsorption inhibitor of nucleic acid refer to in the present processes duplication or the unrelated core of amplified reaction Acid molecule or nucleic acid are similar to the factor.As such nucleic acid molecules or nucleic acid similar to the factor, it can be mentioned, for example tRNA (transhipments RNA), rRNA (rRNA), mRNA (mRNA), glycogen, heparin, widow DNA, poly (I-C) (the poly- cytidine of polyinosine -), Poly (dI-dC) (the poly- poly- deoxycytidine of deoxyinosine -), poly (A) (poly- adenine) and poly (dA) (poly- deoxyadenine) Deng.The non-specific adsorption inhibitor of nucleic acid can be in reaction solution with the range of 1~500ng/ μ l, preferably 10~500ng/ μ L, 10~200ng/ μ l, 10~100ng/ μ l range include, but are not limited to this.In order to be taken into account with first application, select When selecting non-specific adsorption inhibitor of the tRNA as nucleic acid, 50ng/ μ l can be excluded from the concentration of tRNA.

Reaction solution can also include straight-chain DNA specificity exonuclease or RecG type unwindase.Preferably, reaction solution It can also include straight-chain DNA specificity exonuclease and RecG type unwindase.By making the circumscribed core of straight-chain DNA specificity Sour enzyme and/or RecG type unwindase are present in reaction solution.Can reduce in duplication or amplified reaction due to double-strand cutting etc. and The amount of the straight-chain DNA of generation can expect the raising of the yield of target supercoil product.

Straight-chain DNA specificity exonuclease is successively hydrolyzed from the 5 ' ends of straight-chain DNA or 3 ' ends Enzyme.It is successively hydrolyzed as long as straight-chain DNA specificity exonuclease has from the 5 ' ends of straight-chain DNA or 3 ' ends Active then its type or biological origin are not particularly limited.For example, RecBCD, λ exonuclease, exonuclease can be used III, exonuclease VIII, T5 exonuclease, T7 exonuclease and Plasmid-Safe^TM ATP-Dependent DNA enzymatic (epicentre) etc..Preferred straight-chain DNA specificity exonuclease is RecBCD.Straight-chain DNA exonuclease Enzyme can be include, but are not limited in reaction solution with the range of the range of 0.01~1.0U/ μ l, preferably 0.1~1.0U/ μ l This.It is to make straight-chain in the reaction of 37 DEG C, 30 minutes about the unit of enzyme activity (U) of straight-chain DNA exonuclease Unit of the enzyme amount as 1U needed for the deoxyribonucleotide of the 1nmol of DNA becomes acid-solubility.

RecG type unwindase is considered as the second level DNA removed when extension terminates by replication fork is impinging one another and is formed The enzyme of the unwindase of structure.RecG type unwindase its biology as long as having with the RecG of Escherichia coli similarly activity Source is not particularly limited, and can be suitable for the RecG using such as Escherichia coli.The RecG of Escherichia coli is with monomer Meter in reaction solution can with the range of 100nM~800nM, preferably 100nM~500nM, 100nM~400nM, 100nM~ The range of 300nM include, but are not limited to this.RecG type unwindase can be relative to the RecG for above-mentioned Escherichia coli Determining concentration range according to concentration range comparable in terms of unit of enzyme activity come using.

Reaction solution can also include ammonium salt.As the example of ammonium salt, ammonium sulfate, ammonium chloride and ammonium acetate can be enumerated.Especially Preferred ammonium salt is ammonium sulfate.Ammonium salt in reaction solution can with the range of 0.1mM~100mM, preferably 0.1mM~50mM, 1mM~50mM, 1mM~20mM range include, but are not limited to this.

As one kind of second enzyme group, in the DNA ligase for using Escherichia coli as with DNA ligase activity Enzyme when, include its co-factor, that is, NAD (nicotinamide adenine dinucleotide) in reaction solution.NAD can be in reaction solution The range of 0.01mM~1.0mM, preferably 0.1mM~1.0mM, 0.1mM~0.5mM range include, but are not limited to this.

Reaction solution used in method of the invention can also include reducing agent.It, can as the example of preferred reducing agent Enumerate DTT, beta -mercaptoethanol and glutathione.Preferred reducing agent is DTT.

Reaction solution used in method of the invention can be also comprising for making the regenerated enzyme of ATP and substrate.Again as ATP The combination of the enzyme and substrate of raw system, can enumerate creatine kinase and creatine phosphate and pyruvate kinase and phosphoenolpyruvate third Ketone acid.As the enzyme of ATP regenerating system, myokinase can be enumerated.The combination of the enzyme and substrate of preferred ATP regenerating system is creatine Kinases and creatine phosphate.

Above-mentioned operation (2) is the process for reacting the reaction mixture formed in process (1).Process (2) can be Such as the process within the temperature range of 15 DEG C~80 DEG C, 15~50 DEG C, 15 DEG C~40 DEG C reacting reaction mixture.It is excellent Selection of land, process (2) can be the process kept the temperature under isothermal conditions.As isothermy, as long as DNA replication dna reaction can carry out It is not particularly limited, can be set to contained certain temperature in the range of optimum temperature i.e. 20 DEG C~80 DEG C of such as archaeal dna polymerase Degree, contained certain temperature in the range of can be set to 25 DEG C~50 DEG C are contained in the range of can be set to 25 DEG C~40 DEG C Certain temperature can be set to 30 DEG C or so.In the present specification, " under isothermal conditions keep the temperature ", " being reacted under isothermal " art Language refers to is held in above-mentioned temperature range in the reaction.Soaking time can be produced according to the duplication of the cyclic DNA as target The amount of object or amplified production can be set to such as 1~24 hour being suitable for setting.

Alternatively, as above-mentioned operation (2), may include the reaction mixture that makes to be formed in process (1) by repeatedly into The process being incubated under 30 DEG C of row or more of incubation and the temperature cycles of 27 DEG C of incubations below.As long as 30 DEG C or more of incubation That the temperature range of the duplication that can originate the cyclic DNA comprising oriC is not particularly limited, can be such as 30~80 DEG C, 30~50 DEG C, 30~40 DEG C, 37 DEG C.30 DEG C or more of incubation is not particularly limited, and every 1 circulation can be 10 seconds~10 minutes. As long as 27 DEG C of incubations below can inhibit replication initiation, the temperature for the extension for carrying out DNA is not particularly limited, such as It can be 10~27 DEG C, 16~25 DEG C, 24 DEG C.27 DEG C of incubations below are not particularly limited, and preferably cooperate expanded ring-type The length of DNA is to set, such as recycles for 1, and every 1000 base can be 1~10 second.The cycle-index of temperature cycles does not have It is particularly limited to, can be 10~50 circulations, 20~40 circulations, 25~35 circulations, 30 circulations.

It, can be with after the process for keeping the temperature above-mentioned reaction mixture under isothermal conditions for the present processes It include the process purified to duplication product or the amplified production of cyclic DNA according to purpose.The purifying of cyclic DNA can be used The method that those skilled in the art can utilize is appropriately carried out.

It, can be straight by the reaction mixture after reaction about the cyclic DNA for using the present processes to replicate or amplify Connect or suitable purification after for convert etc. subsequent purpose.

Clone method (A ') > of < cyclic DNA

It is known in the same manner as the combination of XerCD and dif, using Cre and its identify sequence loxP combination also may be implemented The separation (Ip, S.C.Y., et al., EMBO J., 2003,22:6399-6407) of DNA polymer.The present inventors's discovery, makees For the combined substitution of XerCD and dif in method (A), enzyme is separated using DNA polymer and its identifies that the combination of sequence can also To inhibit the generation as the DNA polymer of by-product.

In a mode, this application involves a kind of duplication of the cyclic DNA in cell free system or amplification method (hereinafter, It is denoted as " method (A ') " sometimes in the present specification), it includes processes below:

First enzyme group of the duplication of catalysis cyclic DNA,

Process (2): react the reaction mixture formed in process (1)；

Here, in the case which has ter sequence, the reaction solution of foregoing sequence (1) also includes to have to be incorporated into Ter sequence and inhibit duplication active protein, also, the cyclic DNA have DNA polymer separation enzyme identification base In the case where sequence, the reaction solution of foregoing sequence (1) also includes DNA polymer separation enzyme.

That is, method (A') is " XerCD " in method (A) to be expanded to " DNA polymer separates enzyme ", by " XerCD is identified Base sequence " expand to " and DNA polymer separate enzyme identification base sequence " range method.Accordingly, with respect to method (A) It is each composition and be recorded in the explanation in the project of clone method (A) > of < cyclic DNA, method (A') is also suitable.

DNA polymer separation enzyme is the isolated enzyme that DNA polymer can be realized by generating genetic recombination.Identification is special Fixed base sequence and can to can be used as DNA in the locus specificity recombinase that the base sequence position generates genetic recombination more Aggressiveness separates enzyme and uses.The specific base sequence that DNA polymer separation enzyme is identified is denoted as " DNA polymer separation enzyme knowledge Other base sequence ".By separating enzyme using DNA polymer and being separated the combination for the base sequence that enzyme identifies by DNA polymer Genetic recombination, the separation of DNA polymer may be implemented.Method (A ') is able to suppress and using the mechanism as by-product DNA polymer generation.Commercially available product can be used in DNA polymer separation enzyme, also can be used and extracts simultaneously from microorganism etc. The enzyme generated as needed.Enzyme from microorganism extraction and purifying the method that those skilled in the art can utilize can be used Suitably implement.

DNA polymer separation enzyme, which separate the combination of base sequence that enzyme identifies with the DNA polymer, to be enumerated: XerCD with Dif sequence, Cre and loxP sequence (Siegel, R.W., et al.., FEBS Lett., 2001,499 (1-2): 147-153； Araki, K., et al., Nucleic Acids Res.:1997,25 (4): 868-872), budding yeast (Saccharomyces Verevisiae, Japanese: budding yeast) source recombinase FLP and FRT sequence (Broach, J.R., et al., Cell, 1982,29 (1): 227-234), recombinase DreO and rox sequence (Anastassiadis, K., the et in the source bacteriophage D6 Al., Dis.Model.Mech., 2009,2:508-515), the weight in the source Lu Shi yeast (zygosacchromyces rouxii) Group enzyme R and RS sequence (Araki, H., et al., J.Mol.Biol., 1985,182 (2): 191-203), serine recombinase man Race (such as Gin, γ δ, Tn3 and Hin) and their identification sequence (Smith, M.C., et al., Mol.Microbiol., 2002,44:299), but these are not limited to.

About XerCD and dif sequence, as described in the project of clone method (A) > of < cyclic DNA.

About the combination of Cre and loxP sequence, biological origin is not particularly limited.Cre is preferably that bacteriophage P1 comes The Cre albumen in source.Cre can include with the range of 0.01~200mU/ μ l in reaction solution, preferably can with 0.1~ 150mU/ μ l, 0.1~100mU/ μ l, 0.5~100mU/ μ l, 0.5~80mU/ μ l, 0.1~50mU/ μ l, 1~50mU/ μ l, 1~ The range of 30mU/ μ l include, but are not limited to this.

The loxP sequence of Cre identification can be comprising the 5 '-ATAACTTCGTATAGCATACA as loxP consensus sequence TTATACGAAGTTAT-3 ' (sequence number 30) or (lower-case portion is variation relative to consensus sequence as variation loxP sequence Base) 5 '-ATAACTTCGTATAGtATACATTATACGAAGTTAT-3 ' (sequence number 31/lox511), 5 '-ATAACTTC GTATAGgATACtTTATACGAAGTTAT-3 ' (sequence number 32/lox2272), 5 '-ATAACTTCGTATAtacctttcTATA CGAAGTTAT-3 ' (sequence number 33/loxFAS), 5 '-ATAACTTCGTATAGCATACATTATACGAAcggta-3 ' (sequence number 34/lox RE), 5 '-taccgTTCGTATAGCATACATTATACGAAGTTAT-3 ' (sequence number 35/lox LE) or they in The complementary series of any one sequence.

The recombinase FLP in the source budding yeast (Saccharomyces verevisiae) can be with 1nM in reaction solution The range of~200nM includes, preferably can with 5nM~200nM, 5nM~150nM, 10nM~200nM, 10nM~150nM, 20nM~200nM, 20nM~150nM, 20nM~100nM range include, but are not limited to this.The FRT sequence that FLP is identified It can be the sequence comprising 5 '-GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC-3 ' (sequence number 36) or its complementary series Column.

The recombinase DreO in the source bacteriophage D6 can be with the range of 1nM~200nM including preferably may be used in reaction solution With with 5nM~200nM, 5nM~150nM, 10nM~200nM, 10nM~150nM, 20nM~200nM, 20nM~150nM, The range of 20nM~100nM include, but are not limited to this.The rox sequence that DreO is identified can be comprising 5 '-TAACTTTAA The sequence of ATAATGCCAATTATTTAAAGTTA-3 ' (sequence number 37) or its complementary series.

The recombinase R in the source Lu Shi yeast (zygosacchromyces rouxii) in reaction solution can with 1nM~ The range of 200nM includes, preferably can with 5nM~200nM, 5nM~150nM, 10nM~200nM, 10nM~150nM, 20nM~200nM, 20nM~150nM, 20nM~100nM range include, but are not limited to this.The RS sequence that enzyme R is identified Can be includes Araki, sequence or its complementary series disclosed in H. etc. (J.Mol.Biol., 1985,182 (2): 191-203) Sequence.

Serine recombinates enzyme family (γ δ, Tn3, Gin and Hin) can be come in reaction solution with the range of 1nM~200nM Include, it preferably can be with 5nM~200nM, 5nM~150nM, 10nM~200nM, 10nM~150nM, 20nM~200nM, 20nM ~150nM, 20nM~100nM range include, but are not limited to this.γ δ, Tn3 and their identification sequence res can be packet Sequence disclosed in (Cell, 1982,30:19-27) such as N.D.F.. containing Grindley or the sequence of its complementary series.Gin and It identifies that sequence can be comprising sequence disclosed in Kahmann.R. etc. (Cell, 1985,41:771-780) or its complementary sequence The sequence of column.Hin and its identification sequence can be comprising (J.Biol.Chem., 1989,264:10072- such as Glasgow.A.C. 10082) sequence of sequence or its complementary series disclosed in.

The sequence of DNA polymer separation enzyme identification can reside in any position on cyclic DNA.For example, DNA polymer The sequence of separation enzyme identification can reside in region near oriC or adjacent, and can also exist on becomes phase relative to oriC The region of opposite side.

Clone method (B) > of < cyclic DNA

In a mode, this application involves a kind of duplication of the cyclic DNA in cell free system or amplification method (hereinafter, It is denoted as " method (B) " sometimes in the present specification), it includes processes below:

Process (1): oriC transposons and transposase being added in buffer and form oriC swivel base body, here, oriC Transposons be comprising can with replication initiation sequence (the origin of chromosome in conjunction with the active enzyme of DnaA (oriC)) linear DNA and the linear DNA for its two end comprising outer end (OE) sequence；

Thus the process of the cyclic DNA comprising oriC is prepared；

First enzyme group of the duplication of catalysis cyclic DNA,

Process (3): react the reaction mixture formed in process (2).

Although being not limited by theory, method (B) using transposons into the cyclic DNA without oriC by being imported OriC, to prepare the cyclic DNA comprising oriC, duplication or expand cyclic DNA that this includes oriC.By schematic diagram in Fig. 2. In Fig. 2, the process represented by " transposons is formed ", " transfer reaction " corresponds to above-mentioned operation (1).With regard to replicating or expand and Speech by replication cycle shown in FIG. 1 or is repeated the replication cycle and replicates or expand in above-mentioned operation (2) and (3) Cyclic DNA.The definition of duplication and amplification about cyclic DNA, as described in method (A).

About the cyclic DNA comprising oriC mixed with reaction solution, according to the note in the project of above-mentioned < cyclic DNA > It carries.The amount of cyclic DNA comprising oriC used in every 1 reaction is as described in the amount the template DNA in method (A).

In addition, the explanation for the other ingredients that may include in enzyme group, reaction solution contained in reaction solution, with method (A) In it is identical.Further, the process (2) in above-mentioned operation (3) and method (A) equally carries out.About also comprising to cyclic DNA The process this point that duplication product or amplified production are purified and the ring-type for replicating or amplifying using the present processes The application of DNA, it is also identical with method (A).

As long as known to those skilled in the art its of the OE sequence at the both ends of oriC transposons is identified by transposase, be can be used as The sequence that OE sequence uses then can be arbitrary sequence.In preferred embodiment, OE sequence includes sequence number 25 (5 '- CTGTCTCTTATACACATCT-3 ') shown in sequence or its complementary series, process (1) linear DNA 5 ' ends be inserted into Have the OE sequence comprising sequence shown in sequence number 25, in 3 ' ends of the linear DNA inserted with comprising shown in sequence number 25 The OE sequence of the complementary series of sequence.

In above-mentioned operation (1), oriC swivel base body formed used in oriC transposons concentration can be 20~ 200nM can be preferably 40~160nM.

As long as transposase identification OE sequence and formed swivel base body, cyclic DNA transfer transfer stand DNA enzyme, then its Biological origin is not particularly limited, and can be suitable for the transposase using such as Escherichia coli.Particularly preferably high work Property Tn5 variation (E54K, L372P) albumen (Goryshin, I.Y., and Reznikoff, W.S., J.Biol.Chem., 1998, 273:7367-7374).Commercially available product can be used in transposase, also can be used and extracts from microorganism etc. and purify as needed Transposase afterwards.Enzyme from microorganism extraction and purifying method that those skilled in the art can utilize can be used suitably Implement.In the case where using high activity Tn5 variation (E54K, L372P) albumen as transposase, in above-mentioned operation (1), Concentration used in the formation of oriC swivel base body can be 50~200nM, can be preferably 80~150nM.

Process (1) as long as used in buffer it is slow in pH6~9, be preferably suitable for for use under pH7.5 Fliud flushing is then not particularly limited.It can be mentioned, for example Tris- acetic acid, Tris-HCl, Hepes-KOH, phosphate buffer, MOPS- NaOH, Tricine-HCl etc..Preferred buffer is Tris- acetic acid or Tris-HCl.The concentration of buffer can be by this field Technical staff suitably selects, and is not particularly limited, and in the case where Tris- acetic acid or Tris-HCl, can choose such as 10mM ~100mM, 10mM~50mM, 20mM concentration.

In process (1), formed oriC swivel base body process by 30 DEG C or so at a temperature of keep the temperature 30 minutes or so Come carry out.

The transfer reaction of process (1) is in the optimum temperature of transposase, carry out at such as 37 DEG C.Carry out the time of transfer reaction It can suitably be selected, such as can be 15 minutes or so by those skilled in the art.In addition, in the transfer reaction of process (1), TRNA can be added.In the transfer reaction of process (1), the concentration for adding tRNA can choose such as 10~200ng/ μ l, 30 The concentration of~100ng/ μ l, 50ng/ μ l.

In a mode, the cyclic DNA comprising oriC of process (2) can be also inserted into comprising being respectively relative to oriC outward 1 pair of ter sequence and/or the base sequence that is identified by DNA polymer separation enzyme such as XerCD, Cre.In this case, in the ring In the case that shape DNA has ter sequence, the reaction solution of foregoing sequence (2) also includes to have to be incorporated into ter sequence and inhibit to replicate Active protein, also, the base sequence that in the cyclic DNA there is XerCD, Cre etc. to be identified by DNA polymer separation enzyme In the case where, the reaction solution of foregoing sequence (2) also includes the DNA polymer such as XerCD, Cre separation enzyme.

Alternatively, in another way, according to make to be respectively relative to 1 pair of ter sequence that oriC is inserted into outward and/or XerCD, Cre etc. is prepared by the mode that the base sequence that DNA polymer separation enzyme identifies is contained in a part of oriC transposons, For the base sequence that 1 pair of ter sequence and/or XerCD, Cre etc. are identified by DNA polymer separation enzyme, swivel base also can use Son is imported into cyclic DNA.That is, the linear DNA of process (1) also includes to be respectively relative to oriC to be inserted into outward in which 1 pair of ter sequence and/or the base sequence that is identified by DNA polymer separation enzyme such as XerCD, Cre, and have in the linear DNA In the case where having ter sequence, the reaction solution of foregoing sequence (2) also includes with the activity for being incorporated into ter sequence and inhibiting to replicate Protein, and the cyclic DNA have XerCD, Cre etc. by DNA polymer separation enzyme identify base sequence the case where Under, the reaction solution of foregoing sequence (2) also includes XerCD albumen.

Here, about 1 pair of ter sequence and/or XerCD, Cre that oriC is inserted into outward etc. is respectively relative to by DNA poly Body separation enzyme identification base sequence and be incorporated into ter sequence and inhibit duplication active protein and/or The DNA polymer such as XerCD, Cre separates the definition and explanation of enzyme, to as described in method (A) or method (A').

In a mode, method (B) can also include process (4): replicating or expand from the reaction product in process (3) Cyclic DNA in remove oriC transposons.

Remove oriC transposons process may include: using 0.1~30nM, preferably 1~20nM, more preferably 3~ The processing of the transposase of 10nM；With utilize the straight-chain double-stranded DNA dependence single stranded DNA exonuclease of ExoIII etc The single stranded of the end DNA is handled.Buffer used in processing using transposase can be used to be delayed used in process (1) Fliud flushing.The buffer used in the processing using single stranded DNA exonuclease, as long as single stranded DNA exonuclease rises The buffer of any composition then can be used in the condition of effect.

In addition, the process for removing oriC transposons can be also comprising using contained in the sequence for corresponding to oriC transposons The processing of the restriction enzyme of restriction enzyme sites.The purpose of the processing is specificity cutting oriC transposons.Therefore, it selects at this time Include in oriC transposons but is free of in the region other than the oriC swivel base subregion in the cyclic DNA that duplication amplifies Restriction enzyme position corresponding to restriction enzyme.It, can in order to carry out the specific double-strand cutting in region contained in oriC transposons To use CRISPR-Cas9 to replace restriction enzyme.In this case, the specific sequence in region contained in oriC transposons is specified As guide RNA.

< functionality box (nucleic acid) >

In a mode, this application involves comprising oriC and be respectively relative to 1 pair of ter sequence that oriC is inserted into outward And/or XerCD, Cre etc. are by the nucleic acid of the base sequence of DNA polymer separation enzyme identification.Preferably, aforementioned nucleic acid is threadiness DNA, it is further preferred that aforementioned nucleic acid is double-strandednucleic acid.The length of aforementioned nucleic acid does not have as long as the preparation that can be used for cyclic DNA It is particularly limited to.In preferred embodiment, the length of aforementioned nucleic acid be 273bp~2.0kb, 273bp~1.5kb or 273bp~ The length of 1.0kb.The shortest length of aforementioned nucleic acid is 273bp, oriC 245bp, and in 1 pair of ter sequence or DNA polymer Separating shortest dif sequence in enzyme recognition sequence is 28bp, is thus length when being directly connected to these.

Above-mentioned nucleic acid can be used as the function being used to prepare in the present processes (A) as the cyclic DNA of template Property box come using.

In another way, this application involves comprising oriC and be respectively relative to 1 pair of ter sequence that oriC is inserted into outward And/or XerCD, Cre etc. by the base sequence of DNA polymer separation enzyme identification and include outer end (OE) sequence in two ends Nucleic acid.Preferably, aforementioned nucleic acid is linear DNA, it is further preferred that aforementioned nucleic acid is double-strandednucleic acid.The length of aforementioned nucleic acid As long as the preparation that degree can be used for cyclic DNA is not particularly limited.In preferred embodiment, the length of aforementioned nucleic acid is 311bp The length of~2.0kb, 311bp~1.5kb or 311bp~1.0kb.The shortest length of aforementioned nucleic acid is 311bp, and oriC is 245bp, shortest dif sequence is 28bp, also, 2 OE sequences in 1 pair of ter sequence or DNA polymer separation enzyme recognition sequence It is classified as 38bp, is thus length when being directly connected to these.

Above-mentioned nucleic acid can come in the present processes (B) as the functional box for playing the role of oriC transposons It utilizes.

Here, about 1 pair of ter sequence and/or XerCD, Cre that oriC is inserted into outward etc. is respectively relative to by DNA poly Body separation enzyme identification base sequence and be incorporated into ter sequence and inhibit duplication active protein and/or The DNA polymer such as XerCD, Cre separates the definition and explanation of enzyme, to as described in method (A) and method (A').

Above-mentioned functional box is reducing the cyclic DNA comprising oriC for the template for becoming method (A), (A ') and (B) It is useful in terms of preparation cost.

< kit >

In a mode, this application involves a kind of duplications of cyclic DNA or reagent for amplification box (hereinafter, in this specification In, it is denoted as " kit (A) " sometimes), it includes the combinations of following components:

It is catalyzed the first enzyme group of the duplication of cyclic DNA；

Comprising oriC and 1 pair of ter sequence and/or XerCD, Cre that oriC is inserted into outward are respectively relative to etc. by DNA Polymer separates the linear DNA of the base sequence of enzyme identification；And

There is the active albumen for being incorporated into ter sequence and inhibiting duplication in the case where the linear DNA is with ter sequence Matter, and/or in the case where the base sequence that there is the linear DNA XerCD, Cre etc. to be identified by DNA polymer separation enzyme it is right Enzyme should be separated in the DNA polymer such as XerCD, Cre of the sequence.Kit (A) be for carry out the present processes (A) or The kit of (A ').

The specific ingredient and concentration that product are respectively constituted contained in kit (A) of the invention, according to above-mentioned < One, in the project of amplification method (A ') > of amplification method (A) >, < cyclic DNA of second, third enzyme group >, < cyclic DNA Record.

In another way, this application involves the duplications of cyclic DNA or the combination of reagent for amplification box (hereinafter, in this theory In bright book, " kit (B) " is denoted as sometimes), it includes the combinations of following components:

It is catalyzed the first enzyme group of the duplication of cyclic DNA；

Transposase.Kit (B) is the kit for carrying out the present processes (B).

In certain mode, the oriC transposons in kit (B) can be also comprising being respectively relative to oriC is inserted into outward 1 The base sequence that ter sequence and/or XerCD, Cre etc. are identified by DNA polymer separation enzyme.In this case, kit It (B) can be also comprising inhibiting in the active protein and/or insertion oriC transposons of duplication with ter sequence is incorporated into DNA polymer separation enzyme corresponding to the sequence identified by DNA polymer separation enzyme.

The specific ingredient and concentration of product are respectively constituted contained in kit (B) of the invention, such as above-mentioned < first, Record in the project of amplification method (B) > of second, third enzyme group >, < cyclic DNA.

For the kit (A) of the application and (B), above-mentioned composition product can all be covered in 1 kit, separately Outside, it is the kit used in the present processes if it is purpose, a part of above-mentioned composition product can also not be included. When for the kit of a part not comprising above-mentioned composition product, implementer can be additional necessary into the kit in amplification Ingredient and the amplification method (A) and (B) for implementing the application respectively.

The kit (A) of the application and (B) can be also comprising additional composition product, and the addition composition product include to be selected from albumen The non-specific adsorption inhibitor of matter, the non-specific adsorption inhibitor of nucleic acid, straight-chain DNA specificity exonuclease, One or more of the combination of enzyme and substrate of RecG type unwindase, ammonium salt, NAD, reducing agent and ATP regenerating system at Point.Additional composition product can be used as 1 kit and be included in the kit of the application, alternatively, can also be used as with this Separate agent box premised on the kit of application is used together provides.

For the kit (A) of the application and (B), may include the mixtures of above-mentioned composition product is packed into 1 and At package body, also may include by single above-mentioned composition product or several above-mentioned composition product mix after independently pack Package body.The kit (A) of the application and (B) in addition can separately include the cyclic DNA recorded for implementing the application Amplification method (A) and (B) instruction specification.

Embodiment

Hereinafter, illustrating the present invention based on embodiment.It should be noted that the present invention is not recorded by following embodiments Range limit.

Embodiment 1: the duplication for the cyclic DNA of termination sequence ter and Tus albumen inhibited with DNA polymer is utilized

< material and method >

It is prepared into the cyclic DNA of template as follows.It is inserted into oriC segment into M13mp18 plasmid vector, 8.0kb ring is made Shape DNA.The region insertion of the opposite side as oriC in the 8.0kb cyclic DNA includes 2 opposite (lower stroke of ter sequence Line) DNA fragmentation ((5 '-ACTTTAGTTACAACATACTTATT-N₁₇₆-AATAAGTATGTTGTAACTAAAGT-3 ' (sequence Number 26)), the 8.0kb cyclic DNA ((a) of Fig. 3) for inserting ter is made.Use the 8.0kb cyclic DNA of insertion ter as mould Plate DNA uses 8.0kb cyclic DNA as the comparison DNA for being free of ter sequence.

Tus is raw by the inclusion of the process of affinity column chromatography and gel filtration column chromatography by the Bacillus coli expression strain of Tus At, preparation.

Prepare the reaction solution of composition shown in table 1 and other than forming shown in table 1 also with final concentration 2nM or 5nM Mode is added with the reaction solution of Tus.Added in a manner of final concentration of 0.8ng/ μ l respectively into these reaction solutions template DNA or Comparison DNA keeps the temperature 1 hour in 30 DEG C of incubator, to be reacted after mixing on ice.It is every 1 reaction total volume be 10 microlitres.[α-is first added into reaction solution³²P] dATP, after DNA replication dna reaction, to a part progress agarose of reaction solution After gel electrophoresis (0.5%1 × TAE, 150V, 100 minutes, 14 DEG C), is detected and taken in BAS imaging plate³²The product of P, confirmation produce Target supercoil product structure is given birth to.

[table 1]

In table, SSB indicates that Escherichia coli SSB, IHF indicate the complex of Escherichia coli IhfA and IhfB, DnaG indicates that Escherichia coli DnaG, DnaN indicate that Escherichia coli DnaN, PolIII* are indicated by Escherichia coli The DNA polymerase i II* as complex that DnaX, HolA, HolB, HolC, HolD, DnaE, DnaQ and HolE are constituted is compound Body, DnaB indicate that Escherichia coli DnaB, DnaC indicate that Escherichia coli DnaC, DnaA indicate Escherichia coli RNaseH, Ligase indicate that Escherichia coli DNA ligase, PolI indicate Escherichia coli DNA polymerase i, GyrA table Show that Escherichia coli GyrA, GyrB indicate that Escherichia coli GyrB, Topo IV indicate Escherichia coli ParC and ParE Complex, Topo III indicate Escherichia coli topoisomerase II I, RecQ indicate Escherichia coli RecQ.

SSB is the process from the Bacillus coli expression strain of SSB by the inclusion of ammonium sulfate precipitation and ion exchange column chromatography Purifying, preparation.

IHF is from the coexpression strain of the Escherichia coli of IhfA and IhfB by the inclusion of ammonium sulfate precipitation and affinity column chromatography Process purifying, preparation.

DnaG be from the Bacillus coli expression strain of DnaG by the inclusion of ammonium sulfate precipitation, Anion exchange column chromatography and Gel filtration column chromatography process purifying, preparation.

DnaN is from the Bacillus coli expression strain of DnaN by the inclusion of ammonium sulfate precipitation and Anion exchange column chromatography Process purifying, preparation.

PolIII* is to co-express strain from the Escherichia coli of DnaX, HolA, HolB, HolC, HolD, DnaE, DnaQ and HolE In by the inclusion of ammonium sulfate precipitation, affinity column chromatography and gel filtration column chromatography process purifying, preparation.

DnaB, DnaC are from the coexpression strain of the Escherichia coli of DnaB and DnaC by the inclusion of ammonium sulfate precipitation, affinity column The process of chromatography and gel filtration column chromatography purifying, preparation.

DnaA is from the Bacillus coli expression strain of DnaA by the inclusion of ammonium sulfate precipitation, dialysis precipitating and gel filtration Column chromatography process purifying, preparation.

GyrA, GyrB are passed through from the mixture of the Bacillus coli expression strain of the Bacillus coli expression strain and GyrB of GyrA Process purifying, preparation comprising ammonium sulfate precipitation, affinity column chromatography and gel filtration column chromatography.

Topo IV is to pass through packet from the mixture of the Bacillus coli expression strain of the Bacillus coli expression strain and ParE of ParC Liquid containing ammonium sulfate precipitating, the process of affinity column chromatography and gel filtration column chromatography purifying, preparation.

Topo III is from the Bacillus coli expression strain of Topo III by the inclusion of ammonium sulfate precipitation and affinity column chromatography Process purifying, preparation.

RecQ is from the Bacillus coli expression strain of RecQ by the inclusion of ammonium sulfate precipitation, affinity column chromatography and gel mistake Filter column chromatography process purifying, preparation.

RNaseH, Ligase, PolI have used the enzyme (Takara Shuzo Co., Ltd.) of commercially available Escherichia coli.

< result >

The testing result for replicating product is shown in Fig. 3.

It has been confirmed that using the case where 8.0kb cyclic DNA of insertion ter is as including Tus in template and reaction solution Under, inhibit the generation of the polymer as by-product and replicates or expand the cyclic DNA of target supercoil product structure.It is another Aspect, the case where Tus is free of in the case where using the 8.0kb cyclic DNA without ter sequence as template and in reaction solution Under, although observing the generation of the cyclic DNA of target supercoil product structure, also observe the polymer as by-product Generation.

Tus-ter system is that the mechanism of duplication termination is carried out in circular chromosome.Experimental result shown in the present embodiment is true Recognize: by the duplication amplified reaction of cyclic DNA group enter the system, be able to suppress the generation of non-specific DNA polymer.

Embodiment 2: the cyclic DNA of locus specificity recombination sequence dif and XerCD inhibited with DNA polymer is utilized Duplication

< material and method >

In the way of including dif sequence (sequence number 22) in the region in the opposite side as oriC of cyclic DNA, lead to Recombining reaction in Bacillus coli cells is crossed to be prepared into the 12kb cyclic DNA ((a) of Fig. 4) inserted with dif of template.Specifically For, it using the Escherichia coli of the recombinant protein group of expression λ bacteriophage, is reacted by in-vivo recombination, preparation contains The upstream side the dif region 4.2kb of the box and escherichia coli chromosome of oriC and kalamycin resistance gene and downstream side The cyclic DNA of the target length in the region 6.0kb.

As the comparison DNA for being free of dif sequence, the 8.0kb cyclic DNA recorded in embodiment 1 is used.

XerCD is from the coexpression strain of the Escherichia coli of XerC and XerD by the inclusion of ammonium sulfate precipitation, affinity column chromatography Process purifying, preparation.

Prepare the reaction solution of composition shown in the table 1 of embodiment 1 and other than forming shown in table 1 also with final concentration The mode of 3.5nM, 7nM, 14nM or 35nM are added with the reaction solution of XerCD.Into these reaction solutions respectively with final concentration The mode of 0.8ng/ μ l adds template DNA or comparison DNA, after mixing on ice, keeps the temperature 1 hour in 30 DEG C of incubator, from And it is reacted.The total volume of every 1 reaction is 10 microlitres.[α-is first added into reaction solution³²P] dATP, similarly to Example 1 It detects the by-product after reacting, confirm its structure.

< result >

The testing result for replicating product is shown in (b) of Fig. 4.

It has been confirmed that use the 12kb cyclic DNA inserted with dif as in template and reaction solution include XerCD feelings Under condition, inhibits the generation of the polymer as by-product and replicate or amplify the cyclic DNA of target supercoil product structure.Separately On the one hand, be free of XerCD's in the case where using the 8.0kb cyclic DNA without dif sequence as template and in reaction solution In the case of, it observes the generation of the cyclic DNA of target supercoil product structure, but also observes the polymer as by-product Generation.

XerCD-dif system is that the mechanism of chromosome separation is carried out in circular chromosome.That is, XerCD-dif system is Carry out the isolated mechanism of DNA polymer.The confirmation of experimental result shown in the present embodiment: pass through the duplication expansion in cyclic DNA Increase group in reaction and enter the system, is able to suppress the generation of non-specific DNA polymer.

Embodiment 3: it is influenced caused by the position of ter sequence or dif sequence in cyclic DNAIn Examples 1 and 2, Template DNA is prepared in the way of the region for the opposite side as oriC that ter sequence or dif sequence are located in cyclic DNA. In embodiment 3, near oriC or the cyclic DNA of adjacent position, carrying out ter sequence or the configuration of dif sequence Duplication amplified reaction.

< material and method >

In order to construct 15kb cyclic DNA, the 15kbDNA of oriC is free of using genome of E.coli as template amplification, preparation Segment.

It is following to prepare 15kb-ori-ter ring-type as cyclic DNA of the position configured with ter sequence near oriC DNA.Ori-ter box, cyclisation, to make (Fig. 5) are connected in above-mentioned 15kbDNA segment.Ori-ter box (0.38kb) Sequence is as follows, has outside ter sequence (underscore) at the both ends of oriC box (lowercase).

Ori-ter box: 5 '-AGTATGTTGTAACTAAAGATAACTTCGTATAATGTATGCTATACGAAGTTATaca gatcgtgcgatctactgtggataactctgtcaggaagcttggatcaaccggtagttatccaaagaacaactgttgt tcagtttttgagttgtgtataacccctcattctgatcccagcttatacggtccaggatcaccgatcattcacagtt aatgatcctttccaggttgttgatcttaaaagccggatccttgttatccacagggcagtgcgatcctaataagaga tcacaatagaacagatctctaaataaatagatcttctttttaatacccaggatccATTTAACATAATATACATTAT GCGCACCTTTAGTTACAACATACT- 3 ' (sequence numbers 27)

It is following to prepare 15kb-ori-dif ring-type as cyclic DNA of the position configured with dif sequence near oriC DNA.Ori-dif box, cyclisation, to make (Fig. 5) are connected in above-mentioned 15kbDNA segment.Ori-dif box (0.32kb) Sequence is as follows, it is adjacent in the upstream side of oriC box (lowercase) and have dif sequence (underscore).

Ori-dif box: 5 '-ATTTAACATAATATACATTATGCGCACCAAGTATacagatcgtgcgatctactgt ggataactctgtcaggaagcttggatcaaccggtagttatccaaagaacaactgttgttcagtttttgagttgtgt ataacccctcattctgatcccagcttatacggtccaggatcaccgatcattcacagttaatgatcctttccaggtt gttgatcttaaaagccggatccttgttatccacagggcagtgcgatcctaataagagatcacaatagaacagatct Ctaaataaatagatcttctttttaatacccaggatcc-3 ' (sequence number 28)

The DNA polymer of ter and Tus is depended on to generate inhibition in order to study, in addition to composition shown in table 2 below In reaction solution also in a manner of final concentration of 0,2,6,20 or 60nM added with Tus, with final concentration of 0.5ng/ μ l, 5pg/ μ L, cyclic DNA is added in the mode of 50fg/ μ l or 0.5fg/ μ l, reacts 3 hours or 17 hours at 30 DEG C.

Inhibit to study DNA polymer caused by XerCD and generate, also in addition to composition shown in table 2 below In reaction solution in a manner of 0,30 or 60nM of final concentration added with XerCD, ring-type is added in a manner of final concentration 0.5ng/ μ l DNA reacts 2 hours at 30 DEG C.

For reaction product, carry out agarose gel electrophoresis (0.5%1 × TBE, 60V, 60 minutes), with SybrGreen I (Takara Shuzo Co., Ltd.) dyeing, detects DNA.

[table 2]

Each enzyme in table is enzyme identical with the enzyme recorded in embodiment 1, by preparing with the method recorded in embodiment 1 Or it obtains.

1 > of < result is generated dependent on the DNA polymer of ter and Tus to be inhibited

(1) Tus is titrated

The testing result for replicating amplified production is shown in Fig. 6.Template DNA amount is 0.5ng/ μ l, uses amount shown in fig. 6 Tus, carried out at 30 DEG C 3 hours react.

It may validate that in the case where using 15kb-ori-ter cyclic DNA as including Tus in template and reaction solution, Inhibit the generation of the polymer as by-product and replicates or amplify the cyclic DNA of target supercoil product structure.In addition, logical The Tus concentration improved in reaction solution is crossed, the effect of the generation of polymer is inhibited to get a promotion.Specifically, with 20nM or For 60nM there are in the case where Tus, the generation of polymer is reduced to the level that can hardly confirm.

On the other hand, may validate that use 15kb-ori-dif cyclic DNA as in template and reaction solution comprising Tus In the case of, the effect for inhibiting polymer to generate is not observed.This shows that Tus-ter system generates inhibitory effect to polymer and has Contribution.

In addition, the above results show that ter sequence is configured near oriC or phase in the cyclic DNA for becoming template In the case where adjacent position, also obtains DNA polymer and generate inhibitory effect.That is, insertion position of the ter sequence in cyclic DNA Inhibitory effect will not be generated to DNA polymer to impact.

(2) DNA is titrated

The testing result for replicating amplified production is shown in Fig. 7.Using the template DNA and Tus of amount shown in Fig. 7,30 It carries out reacting for 17 hours at DEG C.

It may validate that in the case where using 15kb-ori-ter cyclic DNA as including Tus in template and reaction solution, Inhibit the generation of the polymer as by-product and replicates or amplify the cyclic DNA of target supercoil product structure.In particular, Even if template DNA amount is reduced to 0.5fg/ μ l, the effect can also be observed that.

DNA polymer caused by 2 > XerCD of < result, which generates, to be inhibited

The testing result for replicating amplified production is shown in Fig. 8.Template DNA amount is 0.5ng/ μ l, uses amount shown in Fig. 8 XerCD, carried out at 30 DEG C 2 hours react.

It may validate that when using 15kb-ori-dif cyclic DNA as including XerCD in template and reaction solution, inhibit The generation and duplication of polymer as by-product or the cyclic DNA for amplifying target supercoil product structure.In addition, by by The XerCD concentration in reaction solution is gradually improved, the effect for inhibiting polymer to generate also is promoted.

In addition, the above results show: dif sequence is being configured near oriC or phase in the cyclic DNA for becoming template When the position of neighbour, also obtains DNA polymer and generate inhibitory effect.That is, insertion position of the dif sequence in cyclic DNA will not be right DNA polymer generates inhibitory effect and impacts.

According to the above results 1 and 2, even if ter sequence and dif sequence are configured adjacently or configure with oriC in its vicinity, It efficiently works, DNA polymer is inhibited to generate.Ter sequence and dif sequence can be only fitted to this point near oriC, meaning Taste functional box can be made together with oriC in these sequences and be used for the building of cyclic DNA.

Embodiment 4: (1) is imported using the oriC box of transposons

In order to carry out the duplication or amplification of cyclic DNA using the present processes, need into the cyclic DNA for becoming template Import oriC.In example 4, research and utilization transposons imports oriC box (Fig. 2).

< material and method >

As transposase (Tnp), high activity Tn5 variation (E54K, L372P) protein is used.The protein is from large intestine Bacillus express strain in by the inclusion of ammonium sulfate precipitation, affinity column chromatography process purifying, preparation.

As oriC transposons, will there are the following of outer end (OE) sequence (underscore) at the both ends of the sequence comprising oriC It is used after the 5 ' phosphorylation of DNA fragmentation of Sequence composition.

OriC transposons: 5 '-CTGTCTCTTATACACATCTgaagatccggcagaagaatggctgggatcgtgggt taatttactcaaataagtatacagatcgtgcgatctactgtggataactctgtcaggaagcttggatcaaccggta gttatccaaagaacaactgttgttcagtttttgagttgtgtataacccctcattctgatcccagcttatacggtcc aggatcaccgatcattcacagttaatgatcctttccaggttgttgatcttaaaagccggatccttgttatccacag ggcagtgcgatcctaataagagatcacaatagaacagatctctaaataaatagatcttctttttaatacccaggat cccaggtctttctcaagccgacAGATGTGTATAAGAGACAG- 3 ' (sequence numbers 29)

About oriC transfer reaction, by 116nM Tnp and 48nM oriC transposons in buffer (10mM Tris- acetic acid [pH 7.5], 15%glycerol, 50mM potassium glutamate, 1mM DTT, 0.1mM EDTA) at 30 DEG C keep the temperature 30 minutes and Form oriC swivel base body.By oriC swivel base body (0.5 μ l) and target DNA (10fM) in buffer (5 μ l；10mM Tris-HCl[pH 7.5], 150mM potassium glutamate, 10mM Mg (oAc)₂) in keep the temperature 15 minutes at 37 DEG C, carry out transfer reaction.As target DNA, Use the bacillus coli gene expression plasmid from 15kb or the thermus thermophilus (Thermus as height Thermophilic Bacteria Thermophilus the 9.3kb plasmid (pTT8 plasmid)) extracted in HB8 plants.Then it carries out at 70 DEG C at 5 minutes heat inactivations Reason.

In the reaction solution of composition shown in table 2 to embodiment 3, the reaction mixture of above-mentioned oriC transfer reaction is added A part (0.5 μ l), reacted 3 hours at 30 DEG C.For reaction product, carry out agarose gel electrophoresis (0.5%1 × TBE, 60V, 60 minutes), it is dyed with SybrGreen (Takara Shuzo Co., Ltd.), detects DNA.

< result >

The bacillus coli gene expression plasmid for using 15kb is shown in Fig. 9 as result when target DNA, will use from as Result when the 9.3kb plasmid (pTT8 plasmid) extracted in HB8 plants of thermus thermophilus of height Thermophilic Bacteria is as target DNA is shown in figure 10。

A part that the reaction mixture of the oriC transfer reaction of Tnp will be present is used for the duplication amplification side of cyclic DNA When method, the generation as duplication product/amplified production supercoil product is confirmed.On the other hand, in oriC transfer reaction not There are in the case where Tnp, duplication product/amplified production is not confirmed carrying out the duplication amplification method of cyclic DNA yet.

In addition, the above results show: particularly, can also for 10fM (0.1pg/ μ l) this very low concentration of target DNA Efficiently to import oriC, and can be expanded by the duplication amplification method of the cyclic DNA of the application.This shows: passing through OriC box is set to carry out transposons, the readily and efficiently rate that realizes imports oriC into target DNA, and thus obtained includes The cyclic DNA of oriC is efficiently amplified also by the duplication amplification method of the cyclic DNA of the application.

Embodiment 5: (2) are imported using the oriC box of transposons

Transposase (Tnp) and oriC transposons use enzyme and transposons same as Example 4.

About oriC transfer reaction, by 116nM Tnp and 144nM oriC transposons in buffer (10mM Tris- acetic acid [pH 7.5], 15%glycerol, 50mM potassium glutamate, 1mM DTT, 0.1mM EDTA) at 30 DEG C keep the temperature 30 minutes and Form oriC swivel base body.By oriC swivel base body (0.5 μ l), target DNA (1pM (50pg (3 × 10⁶Molecule)/5 μ l) and tRNA (50ng/ μ l) is in buffer (5 μ l；10mM Tris-HCl [pH 7.5], 150mM potassium glutamate, 10mM Mg (oAc)₂) in 15 minutes are kept the temperature at 37 DEG C, carries out transfer reaction.As target DNA, the bacillus coli gene expression plasmid of 15kb is used.Then into 70 DEG C of row, the processing of 5 minutes heat inactivations.

The reaction mixing of above-mentioned oriC transfer reaction is added in the 5 μ l of reaction solution as shown in the table 2 of embodiment 3 to composition A part (0.5 μ l) of object, reacts 4 hours at 30 DEG C.For reaction product, carry out agarose gel electrophoresis (0.5%1 × TBE, 60V, 55 minutes), it is dyed with SybrGreen I (Takara Shuzo Co., Ltd.), detects DNA.Show the result in Figure 11.With reality It applies example 4 similarly, is used for the duplication of cyclic DNA in a part of the reaction mixture for the oriC transfer reaction that Tnp will be present When amplified reaction, the generation as duplication product/amplified production supercoil product is confirmed.On the other hand, oriC transfer is anti- It answers there is no in the case where Tnp, even if carrying out the duplication amplified reaction of cyclic DNA, does not also confirm duplication product/amplification Product.

In addition, the additive amount of target DNA is changed to 1pM (50pg (3 × 10 in oriC transfer reaction⁶Molecule)/5 μ l), 0.1pM(5pg(3×10⁵Molecule)/5 μ l), 10fM (500fg (3 × 10⁴Molecule)/5 μ l) and 1fM (50fg (3 × 10³Molecule)/ 5 μ l), carry out reaction similar to the above.Show the result in Figure 12.Should the result shows that: even for ((3000 points of 50fg of 1fM Son)/5 μ l) this very low concentration of target DNA, oriC can also be efficiently imported, and the ring-type of the application can be passed through The duplication amplification method of DNA expands.

Embodiment 6: the amplification of the thermophilic bacteria plasmid of oriC transposons transfer is utilized

In oriC transfer reaction, 50fg is used to extract from as HB8 plants of thermus thermophilus of height Thermophilic Bacteria The plasmid (pTT8 plasmid) of 9.3kb carries out oriC transfer reaction and ring as target DNA similarly to Example 5 in addition to this The duplication amplified reaction of shape DNA.Show the result in Figure 13.

When pTT8 plasmid is digested with Kpn I and Nhe I, generation 5.3kb, 1.7kb as shown in the plasmid map of Figure 14, The segment of 1.3kb and 1.0kb.Duplication product caused by above-mentioned reaction/amplified production restriction enzyme Kpn I and Nhe I is disappeared Change.Show the result in Figure 14.Kpn I and the Nhe I of duplication product/amplified production caused by above-mentioned reaction are digested, with PTT8 plasmid similarly confirms the segment of 5.3kb, 1.7kb, 1.3kb and 1.0kb.This shows: multiple caused by above-mentioned reaction Product/amplified production processed is reproducible to amplify the cyclic DNA for having oriC transposons relative to the transfer of pTT8 plasmid.

These the result shows that: in the 9.3kb matter using GC containing ratio high (GC containing ratio about 70%) and heterogenous cell source When grain, also similarly to Example 5, oriC can also efficiently be imported for very low concentration of target DNA, and can pass through The duplication amplification method of the cyclic DNA of the application expands.

Embodiment 7: the amplification of the λ DNA of oriC transposons transfer is utilized

λ DNA is the straight-chain DNA in bacteriophage source.It is cyclized, preparation is shifted by oriC transposons and imports oriC's Cyclic DNA carries out the duplication amplification method of the cyclic DNA of the application.

(1)Annealing and notch reparation reaction

It is following to carry out annealing reaction.λ DNA (spinning of 48kb/ Japan) 160ng/ μ l is added to buffer (10mM Tris- HCL (pH 7.5), 50mM NaCl, 1mM EDTA) in, obtain the solution of 5 μ l.The solution is kept the temperature after five minutes at 65 DEG C, 4 DEG C are cooled to -0.5 DEG C/30 seconds cooling rates, the position COS of two ends of λ DNA is connected and is cyclized.

It is following to carry out notch reparation reaction.0.5 μ l of solution after annealing reaction is added to comprising 50nM ligase, 50nM Pol I, 20mU/ μ l Exo III, 5nM gyrase, 0.1mg/ml BSA reaction solution (as reaction buffer, use 2 institute of table The reaction buffer (that is, reaction buffer of the enzyme group without table 2) of the composition shown), it is reacted 16 hours at 30 DEG C.

For the reaction product of notch reparation reaction, agarose gel electrophoresis (0.5%1 × TBE, 60V, 55 points are carried out Clock), it is dyed with SybrGreen I (Takara Shuzo Co., Ltd.), detects DNA.Show the result in Figure 15.Carrying out notch reparation In the reaction product of reaction, observe that the band of supercoil product, supercoil product show that there are the DNA of unnotched cyclisation.

(2)The amplification of oriC transposons transfer and λ DNA

The 1 μ l of reaction product for using notch reparation to react is carried out similarly to Example 5 as the solution comprising target DNA The duplication amplified reaction of oriC transfer reaction and cyclic DNA.Here, in the duplication amplified reaction of cyclic DNA, using to The RecJf (NEB company) of 60nM RecG and 0.5U/ μ l is further added in the reaction solution of composition shown in the table 2 of embodiment 3 Solution.RecG be from the Bacillus coli expression strain of RecG by the inclusion of ammonium sulfate precipitation, affinity column chromatography process and give birth to At, preparation.Show the result in Figure 16.

When λ DNA is digested with restriction enzyme HindIII, the segment of 27kb, 9.4kb, 6.6kb, 2.3kb and 2.0kb are generated. The restriction enzyme HindIII of duplication product/amplified production caused by above-mentioned reaction is digested into (37 DEG C, 3 hours).It shows the result in Figure 17.When digesting duplication product/amplified production caused by above-mentioned reaction with HindIII, confirmed in the same manner as λ DNA The segment of 27kb, 9.4kb, 6.6kb, 2.3kb and 2.0kb.This shows: product/amplified production is replicated caused by above-mentioned reaction Duplication amplifies the cyclic DNA that the DNA transfer being cyclized into relative to λ DNA has oriC transposons.

These the result shows that: for straight-chain DNA, also can use the application by carrying out oriC transfer reaction after cyclisation Cyclic DNA duplication amplified reaction.

The removing (1) of embodiment 8:oriC transposons

Studying the oriC importeding into cyclic DNA by oriC transfer reaction could remove.

(1)Cyclic DNA

The oriC transposons of embodiment 5 includes kanamycins (Km) resistant gene and oriC.On the other hand, the large intestine of 15kb Bacillus gene expression plasmid includes ampicillin (Amp) resistant gene.It screens and recycles anti-by the oriC transfer of embodiment 5 It is in the plasmid that should be obtained, in the region of the coding ampicillin resistance gene of the bacillus coli gene expression plasmid of 15kb Transfer has the cyclic DNA (being denoted as p15k::Km-oriC) of oriC transposons.Specifically, making to shift by the oriC of embodiment 5 Obtained plasmid conversion Escherichia coli are reacted, Amp sensitivity, the transformant of Km tolerance are screened, to be cloned.

(2)OriC transposons falls off

By transposase, make to fall off with the comparable region of oriC transposons shifted by oriC transfer reaction.In addition, When shifting oriC transposons by oriC transfer reaction, the region of 9bp is repeatedly formed at the both ends of oriC transposons, therefore It is handled when removing oriC transposons, so that the region of the 9bp does not repeat to exist after connection.For extracting oriC swivel base Sub and generation the end DNA comprising the region 9bp, uses straight-chain double-stranded DNA dependence single stranded DNA exonuclease Exo III and the single stranded for carrying out end section.Then, single-stranded mutual annealing is carried out using the repeating part in the region 9bp, realizes ring Change.Schematic diagram is shown in Figure 18.

Specifically, carrying out reaction below.

OriC transposons, which falls off, reacts following progress: by 0~30nM (0nM, 3nM, 10nM and 30nM) transposase and 2ng/ μ L p15k::Km-oriC is in buffer (5 μ l；10mM Tris-HCl [pH 7.5], 150mM potassium glutamate, 10mM Mg (oAc)₂) in keep the temperature 16 hours at 37 DEG C, to carry out.Then the heat inactivation processing of 70 DEG C, 5 minutes is carried out.

It falls off to oriC transposons and Takara ExoIII buffer (50mM Tris-HCl (pH is added in 1 μ l of reaction product 8.0),5mM MgCl₂, 1mM DTT), ExoIII (Takara) 20mU/ μ l, make 5 μ l of final volume.Make the mixture 30 DEG C reaction 10 minutes, carry out ExoIII processing.

Will with ExoIII, treated that reaction product is kept the temperature after five minutes at 65 DEG C, with -0.5 DEG C/30 seconds cooling rates It is cooled to 4 DEG C and anneals.

(3)It is fallen off by conversion confirmation oriC transposons

Large intestine bar is converted using 2 μ l of sample obtained in above-mentioned (2) and Competent cell (bacillus coli DH 5 alpha) 50 Bacterium.By transformed cells be seeded into comprising 25 μ l ampicillin, 100 μ g/ml, 25 μ l kanamycins, 25 μ g/ml plate on, 37 An evening is incubated at DEG C.

The bacterium colony formation of (0nM) when being not added with transposase in above-mentioned (2) is set as 100, when calculating change swivel base enzyme concentration Opposite Colony Forming Unit (%).

(4)As a result

Show the result in Figure 19 and Figure 20.

According to the result of Figure 19 it is found that the transformed cells of kanamycins tolerance with the concentration for the transposase being added and It reduces.When adding transposase 30nM, the transformed cells of kanamycins tolerance are no longer present.This shows to pass through addition Transposase can make oriC transposons fall off.

In addition, according to fig. 20 result it is found that handled dependent on ExoIII, due to oriC transposons insertion and temporary quilt The ampicillin gene of destruction can restore.

The removing (2) of embodiment 9:oriC transposons

In parallel with ExoIII processing, to the limit using restriction enzyme position contained in the sequence for corresponding to oriC transposons The case where enzyme processed is handled in parallel is studied.Signal is illustrated in Figure 21.

(1)Cyclic DNA

Use cyclic DNA same as Example 8.

(2)OriC transposons falls off

OriC transposons falls off to react to carry out similarly to Example 8 other than using 10nM transposase.

It falls off to oriC transposons and Takara ExoIII buffer (50mM Tris-HCl is only added in 1 μ l of reaction product (pH 8.0),5mM MgCl₂, 1mM DTT) and ExoIII (Takara) 20mU/ μ l or be added ExoIII (Takara) 20mU/ μ l and NheI (NEB) 0.6U/ μ l, makes 5 μ l of final volume.The mixture is reacted 10 minutes at 30 DEG C, is carried out ExoIII processing.

Will with ExoIII and NheI, treated that reaction product is kept the temperature after five minutes at 65 DEG C, with -0.5 DEG C/30 seconds drops Warm speed is cooled to 4 DEG C and anneals.

(3)It is fallen off by conversion confirmation oriC transposons

It is converted similarly to Example 8.Calculate Colony Forming Unit.

(4)As a result

Show the result in table 3

[table 3]

Should the result shows that: by by the position transposons DNA with restriction enzyme (NheI) cut off, can reduce and fail due to swivel base The problem of enzyme and the plasmid containing transposons to fall off from cyclic DNA are remained as noise.

DNA polymer brought by embodiment 10:Cre, which generates, to be inhibited

< material and method >

By being template with pUC19 (precious biotech firm) and using primer SUE1156:5 '- CTATGCGGCATCAGAGCAG-3 ' (sequence number 38) and SUE1361:5 '-GTTAAGCCAGCCCCGACAC-3 ' (sequence number 39) PCR, to prepare the pUC DNA fragmentation of 2.6kb.

As cyclic DNA of the position configured with loxP sequence near oriC, it is prepared for pUC19-OLDT ring-type as follows DNA.PUC DNA fragmentation is connected with OLDT box, is cyclized and makes.The sequence of OLDT box (0.41kb) is as follows, (small in oriC box Write letter part) upstream side be adjacent to loxP sequence (underscore part).

OLDT box: 5 '-CGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACAGTATGTTGTAACTAA AGATAACTTCGTATAATGTATGCTATACGAAGTTATACAGATCGTGCgatctactgtggataactctgtcaggaagct tggatcaaccggtagttatccaaagaacaactgttgttcagtttttgagttgtgtataacccctcattctgatccc agcttatacggtccaggatcaccgatcattcacagttaatgatcctttccaggttgttgatcttaaaagccggatc cttgttatccacagggcagtgcgatcctaataagagatcacaatagaacagatctctaaataaatagatcttcttt ttaatacCCAGGATCCATTTAACATAATATACATTATGCGCACCTTTAGTTACAACATACTATGCGGCATCAGAGC AGATTGTACTGAGAGTGCACCAT-3 ' (sequence number 40)

As the control cyclic DNA for not having loxP sequence, it is prepared for pUC-OriC300 cyclic DNA as follows.By pUC DNA fragmentation is connected with OriC300 box, is cyclized and makes.The sequence of oriC300 box (0.41kb) is as follows, has oriC box (small letter Letter part).

OriC300 box: 5 '-CGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACAGTATGTTGTAACTA AAgatctactgtggataactctgtcaggaagcttggatcaaccggtagttatccaaagaacaactgttgttcagtt tttgagttgtgtataacccctcattctgatcccagcttatacggtccaggatcaccgatcattcacagttaatgat cctttccaggttgttgatcttaaaagccggatccttgttatccacagggcagtgcgatcctaataagagatcacaa tagaacagatctctaaataaatagatcttctttttaatacTTTAGTTACAACATACTATGCGGCATCAGAGCAGAT TGTACTGAGAGTGCACCAT-3 ' (sequence number 41)

Cre uses the product bought from NEB company.

Prepare the reaction solution of composition shown in the table 2 of embodiment 3 and other than forming shown in table 2 also with final concentration 1mU/ μ l, 3mU/ μ l, 10mU/ μ l or 30mU/ μ l are added with the reaction solution of Cre.Into these reaction solutions respectively with final concentration The mode of 0.01ng/ μ l adds pUC19-OLDT cyclic DNA or pUC-OriC300 cyclic DNA, after mixing on ice, at 33 DEG C Incubator in keep the temperature 3 hours and make its reaction.

For reaction product, carry out agarose gel electrophoresis (0.5%1 × TBE, 60V, 60 minutes), with SybrGreen I (Takara Shuzo Co., Ltd.) dyes and detects DNA.

< result >

The testing result for replicating amplified production is shown in Figure 22.

May validate that use pUC-OLDT cyclic DNA that loxP sequence is configured near oriC as template and anti- It answers in liquid and is produced comprising in the case where Cre, inhibiting the generation of the polymer as by-product and replicating or amplify target supercoil The cyclic DNA of object structure.At this point, the appearance of the intermediate product from polymer to monomer separation also can be observed.In addition, by by The Cre concentration in reaction solution is gradually improved, the effect of the generation of polymer is inhibited also to improve.

When using the pUC19-OriC300 cyclic DNA without loxP sequence as template, the effect of Cre is not observed Fruit.

Industrial availability

By the invention it is possible to which providing conveniently and efficiently can replicate or expand cyclic DNA, particularly long-chain cyclic DNA Method.

Sequence number 1:ter sequence (consensus sequence)

Sequence number 2:ter sequence (consensus sequence)

Sequence number 3:ter sequence (terA, B, D, E, or H)

Sequence number 4:ter sequence (terA, B, D, E, or H)

Sequence number 5:ter sequence (terC)

Sequence number 6:ter sequence (terF)

Sequence number 7:ter sequence (terG)

Sequence number 8:ter sequence (terI)

Sequence number 9:ter sequence (tarJ)

Sequence number 10:ter sequence (bacillus, consensus sequence)

Sequence number 11:ter sequence (bacillus subtilis, consensus sequence)

Sequence number 12:ter sequence (bacillus subtilis, consensus sequence)

Sequence number 13:ter sequence (terVII)

Sequence number 14:ter sequence (terIX)

Sequence number 15: the sequence (consensus sequence) identified by XerCD

Sequence number 16: the sequence (consensus sequence, dif and cer) identified by XerCD

Sequence number 17: the sequence (consensus sequence, dif and psi) identified by XerCD

Sequence number 18: the sequence (consensus sequence, cer and psi) identified by XerCD

Sequence number 19:dif sequence

Sequence number 20:cer sequence

Sequence number 21:psi sequence

Sequence number 22:dif sequence

Sequence number 23:cer sequence

Sequence number 24:psi sequence

Sequence number 25: outer end (OE) sequence

Sequence number 26: the DNA fragmentation comprising 1 pair of ter sequence

Sequence number 27:ori-ter box

Sequence number 28:ori-dif box

Sequence number 29:oriC transposons

Sequence number 30:loxP consensus sequence

Sequence number 31:lox511 sequence

Sequence number 32:lox2272 sequence

Sequence number 33:loxFAS sequence

Sequence number 34:lox RE sequence

Sequence number 35:lox LE sequence

Sequence number 36:FRT sequence

Sequence number 37:rox sequence

Sequence number 38: primer SUE1156

Sequence number 39: primer SUE1361

Sequence number 40:OLDT box

Sequence number 41:OriC300 box

Sequence table

<110>state-run research and development legal person Science and Technology Agency (Japan Science and Technology Agency)

<120>duplication of cyclic DNA or amplification method

<130> FA4002-17267

<150> JP 2017-037489

<151> 2017-02-28

<160> 41

<170> PatentIn version 3.5

<210> 1

<211> 14

<212> DNA

<213>artificial sequence

<220>

<223>ter sequence (consensus sequence)

<220>

<221> misc_feature

<222> (2)..(2)

<223>n is a, c, g, or t

<220>

<221> misc_feature

<222> (3)..(3)

<223>r is a or g

<220>

<221> misc_feature

<222> (4)..(4)

<223>w is a or t

<220>

<221> misc_feature

<222> (13)..(13)

<223>k is g or t

<400> 1

gnrwgttgta acka 14

<210> 2

<211> 14

<212> DNA

<213>artificial sequence

<220>

<223>ter sequence (consensus sequence)

<220>

<221> misc_feature

<222> (2)..(2)

<223>k is g or t

<220>

<221> misc_feature

<222> (4)..(4)

<223>w is a or t

<220>

<221> misc_feature

<222> (13)..(13)

<223>k is g or t

<400> 2

gkawgttgta acka 14

<210> 3

<211> 14

<212> DNA

<213>artificial sequence

<220>

<223>ter sequence (terA, B, D, E, or H)

<400> 3

gtatgttgta acta 14

<210> 4

<211> 18

<212> DNA

<213>artificial sequence

<220>

<223>ter sequence (terA, B, D, E, or H)

<400> 4

agtatgttgt aactaaag 18

<210> 5

<211> 14

<212> DNA

<213>artificial sequence

<220>

<223>ter sequence (terC)

<400> 5

ggatgttgta acta 14

<210> 6

<211> 14

<212> DNA

<213>artificial sequence

<220>

<223>ter sequence (terF)

<400> 6

gtatgttgta acga 14

<210> 7

<211> 14

<212> DNA

<213>artificial sequence

<220>

<223>ter sequence (terG)

<400> 7

ggatgttgta acta 14

<210> 8

<211> 14

<212> DNA

<213>artificial sequence

<220>

<223>ter sequence (terI)

<400> 8

ggaagttgta acga 14

<210> 9

<211> 14

<212> DNA

<213>artificial sequence

<220>

<223>ter sequence (terJ)

<400> 9

gtaagttgta acga 14

<210> 10

<211> 23

<212> DNA

<213>artificial sequence

<220>

<223>ter sequence (bacillus (Bacillus), consensus sequence)

<220>

<221> misc_feature

<222> (3)..(3)

<223>w is a or t

<220>

<221> misc_feature

<222> (4)..(4)

<223>r is a or g

<220>

<221> misc_feature

<222> (6)..(10)

<223>n is a, c, g or t

<220>

<221> misc_feature

<222> (11)..(11)

<223>y is t or c

<220>

<221> misc_feature

<222> (12)..(12)

<223>n is a, c, g or t

<220>

<221> misc_feature

<222> (19)..(19)

<223>n is a, c, g or t

<400> 10

acwrannnnn ynatgtacna aat 23

<210> 11

<211> 23

<212> DNA

<213>artificial sequence

<220>

<223>ter sequence (bacillus subtilis (Bacillus subtilis), consensus sequence)

<220>

<221> misc_feature

<222> (8)..(8)

<223>r is a or g

<220>

<221> misc_feature

<222> (10)..(10)

<223>w is a or t

<220>

<221> misc_feature

<222> (12)..(12)

<223>y is c or t

<400> 11

actaattraw cyatgtacta aat 23

<210> 12

<211> 28

<212> DNA

<213>artificial sequence

<220>

<223>ter sequence (bacillus subtilis (Bacillus subtilis), consensus sequence)

<220>

<221> misc_feature

<222> (8)..(8)

<223>r is a or g

<220>

<221> misc_feature

<222> (10)..(10)

<223>w is a or t

<220>

<221> misc_feature

<222> (12)..(12)

<223>y is c or t

<400> 12

actaattraw cyatgtacta aattttca 28

<210> 13

<211> 30

<212> DNA

<213>artificial sequence

<220>

<223>ter sequence (terVII)

<400> 13

gaactaatta aactatgtac taaattttca 30

<210> 14

<211> 30

<212> DNA

<213>artificial sequence

<220>

<223>ter sequence (terIX)

<400> 14

atactaattg atccatgtac taaattttca 30

<210> 15

<211> 28

<212> DNA

<213>artificial sequence

<220>

<223>sequence (consensus sequence) identified by XerCD

<220>

<221> misc_feature

<222> (7)..(7)

<223>y is c or t

<220>

<221> misc_feature

<222> (8)..(8)

<223>r is a or g

<220>

<221> misc_feature

<222> (9)..(9)

<223>y is c or t

<220>

<221> misc_feature

<222> (12)..(17)

<223>n is a, c, g or t

<220>

<221> misc_feature

<222> (23)..(23)

<223>k is g or t

<220>

<221> misc_feature

<222> (28)..(28)

<223>y is c or t

<400> 15

ggtgcgyrya annnnnntta tgktaaay 28

<210> 16

<211> 28

<212> DNA

<213>artificial sequence

<220>

<223>sequence (consensus sequence, dif and cer) identified by XerCD

<220>

<221> misc_feature

<222> (7)..(7)

<223>y is c or t

<220>

<221> misc_feature

<222> (9)..(9)

<223>y is c or t

<220>

<221> misc_feature

<222> (12)..(17)

<223>n is a, c, g or t

<220>

<221> misc_feature

<222> (23)..(23)

<223>k is g or t

<400> 16

ggtgcgyaya annnnnntta tgktaaat 28

<210> 17

<211> 28

<212> DNA

<213>artificial sequence

<220>

<223>sequence (consensus sequence, dif and psi) identified by XerCD

<220>

<221> misc_feature

<222> (9)..(9)

<223>y is c or t

<220>

<221> misc_feature

<222> (12)..(17)

<223>n is a, c, g, or t

<220>

<221> misc_feature

<222> (28)..(28)

<223>y is c or t

<400> 17

ggtgcgcrya annnnnntta tgttaaay 28

<210> 18

<211> 28

<212> DNA

<213>artificial sequence

<220>

<223>sequence (consensus sequence, cer and psi) identified by XerCD

<220>

<221> misc_feature

<222> (7)..(7)

<223>y is c or t

<220>

<221> misc_feature

<222> (8)..(8)

<223>r is a or g

<220>

<221> misc_feature

<222> (12)..(17)

<223>n is a, c, g, or t

<220>

<221> misc_feature

<222> (23)..(23)

<223>k is g or t

<220>

<221> misc_feature

<222> (28)..(28)

<223>y is c or t

<400> 18

ggtgcgyrca annnnnntta tgktaaay 28

<210> 19

<211> 28

<212> DNA

<213>artificial sequence

<220>

<223>dif sequence

<220>

<221> misc_feature

<222> (12)..(17)

<223>n is a, c, g, or t

<400> 19

ggtgcgcata annnnnntta tgttaaat 28

<210> 20

<211> 28

<212> DNA

<213>artificial sequence

<220>

<223>cer sequence

<220>

<221> misc_feature

<222> (12)..(17)

<223>n is a, c, g, or t

<400> 20

ggtgcgtaca annnnnntta tggtaaat 28

<210> 21

<211> 28

<212> DNA

<213>artificial sequence

<220>

<223>psi sequence

<220>

<221> misc_feature

<222> (12)..(17)

<223>n is a, c, g, or t

<400> 21

ggtgcgcgca annnnnntta tgttaaac 28

<210> 22

<211> 28

<212> DNA

<213>artificial sequence

<220>

<223>dif sequence

<400> 22

ggtgcgcata atgtatatta tgttaaat 28

<210> 23

<211> 28

<212> DNA

<213>artificial sequence

<220>

<223>cer sequence

<400> 23

ggtgcgtaca agggatgtta tggtaaat 28

<210> 24

<211> 28

<212> DNA

<213>artificial sequence

<220>

<223>psi sequence

<400> 24

ggtgcgcgca agatccatta tgttaaac 28

<210> 25

<211> 19

<212> DNA

<213>artificial sequence

<220>

<223>outer end (OE) sequence

<400> 25

ctgtctctta tacacatct 19

<210> 26

<211> 222

<212> DNA

<213>artificial sequence

<220>

<223>comprising the DNA fragmentation of 1 pair of ter sequence

<220>

<221> misc_feature

<222> (24)..(199)

<220>

<221> misc_feature

<222> (24)..(199)

<223>n is a, c, g, or t

<400> 26

actttagtta caacatactt attnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60

nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120

nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 180

nnnnnnnnnn nnnnnnnnna ataagtatgt tgtaactaaa gt 222

<210> 27

<211> 383

<212> DNA

<213>artificial sequence

<220>

<223>ori-ter box

<400> 27

agtatgttgt aactaaagat aacttcgtat aatgtatgct atacgaagtt atacagatcg 60

tgcgatctac tgtggataac tctgtcagga agcttggatc aaccggtagt tatccaaaga 120

acaactgttg ttcagttttt gagttgtgta taacccctca ttctgatccc agcttatacg 180

gtccaggatc accgatcatt cacagttaat gatcctttcc aggttgttga tcttaaaagc 240

cggatccttg ttatccacag ggcagtgcga tcctaataag agatcacaat agaacagatc 300

tctaaataaa tagatcttct ttttaatacc caggatccat ttaacataat atacattatg 360

cgcaccttta gttacaacat act 383

<210> 28

<211> 320

<212> DNA

<213>artificial sequence

<220>

<223>ori-dif box

<400> 28

atttaacata atatacatta tgcgcaccaa gtatacagat cgtgcgatct actgtggata 60

actctgtcag gaagcttgga tcaaccggta gttatccaaa gaacaactgt tgttcagttt 120

ttgagttgtg tataacccct cattctgatc ccagcttata cggtccagga tcaccgatca 180

ttcacagtta atgatccttt ccaggttgtt gatcttaaaa gccggatcct tgttatccac 240

agggcagtgc gatcctaata agagatcaca atagaacaga tctctaaata aatagatctt 300

ctttttaata cccaggatcc 320

<210> 29

<211> 399

<212> DNA

<213>artificial sequence

<220>

<223>oriC transposons DNA

<400> 29

ctgtctctta tacacatctg aagatccggc agaagaatgg ctgggatcgt gggttaattt 60

actcaaataa gtatacagat cgtgcgatct actgtggata actctgtcag gaagcttgga 120

tcaaccggta gttatccaaa gaacaactgt tgttcagttt ttgagttgtg tataacccct 180

cattctgatc ccagcttata cggtccagga tcaccgatca ttcacagtta atgatccttt 240

ccaggttgtt gatcttaaaa gccggatcct tgttatccac agggcagtgc gatcctaata 300

agagatcaca atagaacaga tctctaaata aatagatctt ctttttaata cccaggatcc 360

caggtctttc tcaagccgac agatgtgtat aagagacag 399

<210> 30

<211> 34

<212> DNA

<213>artificial sequence

<220>

<223>loxP consensus sequence

<400> 30

ataacttcgt atagcataca ttatacgaag ttat 34

<210> 31

<211> 34

<212> DNA

<213>artificial sequence

<220>

<223>511 sequence of lox

<400> 31

ataacttcgt atagtataca ttatacgaag ttat 34

<210> 32

<211> 34

<212> DNA

<213>artificial sequence

<220>

<223>lox2272 sequence

<400> 32

ataacttcgt ataggatact ttatacgaag ttat 34

<210> 33

<211> 34

<212> DNA

<213>artificial sequence

<220>

<223>loxFAS sequence

<400> 33

ataacttcgt atataccttt ctatacgaag ttat 34

<210> 34

<211> 34

<212> DNA

<213>artificial sequence

<220>

<223>lox RE sequence

<400> 34

ataacttcgt atagcataca ttatacgaac ggta 34

<210> 35

<211> 34

<212> DNA

<213>artificial sequence

<220>

<223>lox LE sequence

<400> 35

taccgttcgt atagcataca ttatacgaag ttat 34

<210> 36

<211> 34

<212> DNA

<213>artificial sequence

<220>

<223>FRT sequence

<400> 36

gaagttccta ttctctagaa agtataggaa cttc 34

<210> 37

<211> 32

<212> DNA

<213>artificial sequence

<220>

<223>rox sequence

<400> 37

taactttaaa taatgccaat tatttaaagt ta 32

<210> 38

<211> 19

<212> DNA

<213>artificial sequence

<220>

<223>SUE1156 primer

<400> 38

ctatgcggca tcagagcag 19

<210> 39

<211> 19

<212> DNA

<213>artificial sequence

<220>

<223>SUE1361 primer

<400> 39

gttaagccag ccccgacac 19

<210> 40

<211> 461

<212> DNA

<213>artificial sequence

<220>

<223>OLDT box

<400> 40

cgcgtcagcg ggtgttggcg ggtgtcgggg ctggcttaac agtatgttgt aactaaagat 60

aacttcgtat aatgtatgct atacgaagtt atacagatcg tgcgatctac tgtggataac 120

tctgtcagga agcttggatc aaccggtagt tatccaaaga acaactgttg ttcagttttt 180

gagttgtgta taacccctca ttctgatccc agcttatacg gtccaggatc accgatcatt 240

cacagttaat gatcctttcc aggttgttga tcttaaaagc cggatccttg ttatccacag 300

ggcagtgcga tcctaataag agatcacaat agaacagatc tctaaataaa tagatcttct 360

ttttaatacc caggatccat ttaacataat atacattatg cgcaccttta gttacaacat 420

actatgcggc atcagagcag attgtactga gagtgcacca t 461

<210> 41

<211> 378

<212> DNA

<213>artificial sequence

<220>

<223>oriC300 box

<400> 41

cgcgtcagcg ggtgttggcg ggtgtcgggg ctggcttaac agtatgttgt aactaaagat 60

ctactgtgga taactctgtc aggaagcttg gatcaaccgg tagttatcca aagaacaact 120

gttgttcagt ttttgagttg tgtataaccc ctcattctga tcccagctta tacggtccag 180

gatcaccgat cattcacagt taatgatcct ttccaggttg ttgatcttaa aagccggatc 240

cttgttatcc acagggcagt gcgatcctaa taagagatca caatagaaca gatctctaaa 300

taaatagatc ttctttttaa tactttagtt acaacatact atgcggcatc agagcagatt 360

gtactgagag tgcaccat 378

Claims

1. a kind of clone method of the cyclic DNA in cell free system, it includes processes below:

Process (1): being formed into the cyclic DNA of template and the reaction mixture of reaction solution, and the reaction solution includes following components:

First enzyme group of the duplication of catalysis cyclic DNA,

Process (2): react the reaction mixture formed in process (1)；

Wherein, the cyclic DNA include can with replication initiation sequence (the origin of in conjunction with the active enzyme of DnaA Chromosome (oriC)) and also comprising being respectively relative to 1 pair of ter sequence that oriC is inserted into outward and/or by DNA poly Body separates the base sequence of enzyme identification,

Wherein, in the case where the cyclic DNA has ter sequence, the reaction solution of the process (1) also includes to have to be incorporated into Ter sequence and inhibit duplication active protein, also, the cyclic DNA have DNA polymer separation enzyme identification base In the case where sequence, the reaction solution of the process (1) also includes DNA polymer separation enzyme.

2. according to the method described in claim 1, wherein, it is Cre or XerCD that DNA polymer, which separates enzyme,.

3. method according to claim 1 or 2, wherein be just respectively relative to 1 pair of ter sequence that oriC is inserted into outward and Speech, the ter sequence as a side is in the 5 ' sides of oriC inserted with including any sequence in sequence shown in sequence number 1~14 Sequence, as another party ter sequence in the 3 ' sides of oriC inserted with the complementary series comprising sequence shown in sequence number 1~14 Sequence.

4. according to the method in any one of claims 1 to 3, wherein have the work for being incorporated into ter sequence and inhibiting duplication Property protein be Tus albumen or RTP albumen.

5. according to the method described in claim 2, wherein, the base sequence of XerCD identification is comprising shown in sequence number 15~24 Sequence in any sequence sequence or its complementary series.

6. according to the method described in claim 2, wherein, the base sequence of Cre identification is comprising shown in sequence number 30~35 The sequence of any sequence in sequence or its complementary series.

7. a kind of nucleic acid comprising oriC and is respectively relative to oriC for the linear DNA of the length with 273bp~2.0kb The base sequence for 1 pair of ter sequence and/or DNA polymer the separation enzyme identification being inserted into outward.

8. a kind of clone method of the cyclic DNA in cell free system, it includes processes below:

Process (1): oriC transposons and transposase are added in buffer and form oriC swivel base body, wherein oriC swivel base Son for comprising can with the replication initiation sequence (origin of chromosome (oriC)) in conjunction with the active enzyme of DnaA Linear DNA and its two end include outer end (OE) sequence；With

Thus the cyclic DNA comprising oriC is prepared；

Process (2): the reaction mixture of the cyclic DNA and reaction solution obtained in (1) comprising oriC, the reaction solution packet are formed Containing following components:

First enzyme group of the duplication of catalysis cyclic DNA,

Process (3): react the reaction mixture formed in process (2).

9. according to the method described in claim 8, wherein, OE sequence includes 25 (5 '-CTGTCTCTTATACACATCT- of sequence number 3 ') sequence and its complementary series shown in, process (1) linear DNA 5 ' ends inserted with comprising shown in sequence number 25 The OE sequence of sequence, in OE sequence of the 3 ' ends of the linear DNA inserted with the complementary series comprising sequence shown in sequence number 25 Column.

10. method according to claim 8 or claim 9 is comprising the cyclic DNA of oriC also includes to be respectively relative to oriC The base sequence for 1 pair of ter sequence and/or DNA polymer the separation enzyme identification being inserted into outward,

Wherein, in the case where the cyclic DNA has ter sequence, the reaction solution of the process (2) also includes to have to be incorporated into Ter sequence and inhibit duplication active protein, also, the cyclic DNA have DNA polymer separation enzyme identification base In the case where sequence, the reaction solution of the process (2) also includes DNA polymer separation enzyme.

11. the method according to any one of claim 8 to 10, wherein the oriC transposons of process (1) also includes difference The base sequence of enzyme identification is separated relative to oriC 1 pair of ter sequence being inserted into outward and/or DNA polymer,

Wherein, in the case where the linear DNA has ter sequence, the reaction solution of the process (2) also includes to have to be incorporated into Ter sequence and inhibit duplication active protein, also, the cyclic DNA have DNA polymer separation enzyme identification base In the case where sequence, the reaction solution of the process (2) also includes DNA polymer separation enzyme.

12. the method according to any one of claim 8 to 11, wherein also include process (4): from the anti-of process (3) The cyclic DNA for replicating or expanding in product is answered to remove oriC transposons.

13. a kind of nucleic acid comprising oriC and is respectively relative to oriC for the linear DNA of the length with 311bp~2.0kb The base sequence for 1 pair of ter sequence and/or DNA polymer the separation enzyme identification being inserted into outward, and include outer end in two ends (OE) sequence.

14. a kind of duplication kit of cyclic DNA, it includes the combinations of following components:

It is catalyzed the first enzyme group of the duplication of cyclic DNA；

OriC transposons, wherein oriC transposons be comprising can with the replication initiation sequence in conjunction with the active enzyme of DnaA The linear DNA of (origin of chromosome (oriC)) and be its two end include outer end (OE) sequence traditional thread binding DNA；With

Transposase.

15. kit according to claim 14, wherein oriC transposons also includes to be respectively relative to oriC to be inserted into outward 1 pair of ter sequence and/or DNA polymer separation enzyme identification base sequence.

16. kit according to claim 15, wherein also comprising inhibiting the work replicated with ter sequence is incorporated into The protein of property；And/or DNA polymer separates enzyme.