CN110713523B - Detection strip for qualitatively detecting acinetobacter baumannii specific antibody in human serum - Google Patents

Abstract

The invention relates to a test strip for qualitatively detecting Acinetobacter baumannii specific antibodies in human serum. The detection strip consists of a sample pad, a combination pad, a nitrocellulose membrane, a water absorption pad and a PVC plate. The combination pad is sprayed with a mouse anti-human IgG monoclonal antibody coupled by colored latex microspheres, and the nitrocellulose membrane is coated with a detection line of acinetobacter baumannii fusion antigen and a quality control line of a goat anti-mouse IgG polyclonal antibody. When the added sample contains the acinetobacter baumannii antibody, the acinetobacter baumannii antibody firstly forms a compound with the latex-mouse anti-human IgG monoclonal antibody, the compound is captured when the compound migrates to a detection line coated with the acinetobacter baumannii fusion antigen under the capillary action, and the detection line is in a corresponding color, so that whether the sample contains the acinetobacter baumannii antibody or not can be detected. The detection strip has the advantages of rapidness, simplicity, high sensitivity, good specificity and low false positive, can obtain a clear result within ten minutes, and is effectively used for auxiliary diagnosis of acinetobacter baumannii infection.

Description

Detection strip for qualitatively detecting acinetobacter baumannii specific antibody in human serum

Technical Field

The invention belongs to the fields of bioengineering and immunology, and particularly relates to a test strip for qualitatively detecting acinetobacter baumannii specific antibodies in human serum and a preparation method thereof.

Background

Acinetobacter baumannii (Ab) is a non-fermenting gram-negative bacillus. The strain is an important pathogenic bacterium of hospital infection, mainly causes respiratory tract infection, and can also cause bacteremia, urinary system infection, secondary meningitis, operation site infection, ventilator-associated pneumonia and the like. The resistance rate to commonly used antibiotics tends to increase year by year and is of serious concern to clinicians and microbiologists. Domestic data indicate that a.baumann ni accounts for approximately over 70% of clinically isolated acinetobacter. The drug resistance rate of baumann ni to cephalosporins of the third and fourth generations reaches 63.0% -89.9%. The drug-resistant rate of the bacteria for four aminoglycosides (amikacin, gentamicin, netilmicin, tobramycin) and ciprofloxacin reaches 96.3 percent. The vast majority of strains currently in China remain sensitive to imipenem, meropenem, cefperazone/sulbactam and polymyxin B, but have poor efficacy in the treatment of respiratory tract infections. In view of the above, in recent years, there is a trend toward further increasing the drug resistance of acinetobacter baumannii, which should be highly regarded by clinicians and the microbial community. The clinician should pay attention to the acquired acinetobacter baumannii infection, and closely cooperate with the clinical microorganism laboratory to enhance the monitoring of the infection and effectively prevent and control the infection.

The existing method for detecting the pathogen in the respiratory tract mainly adopts the traditional method, namely a separation identification method, the method needs long time, generally takes 2-3 days, and the requirement of quick identification is difficult to meet; the PCR technology developed in recent years is a quick, sensitive and specific technology, but at present, the technology still depends on the previous enrichment step of the traditional method, PCR inhibitors often exist in the enrichment liquid, so that the amplification effect is influenced, and false positive is also a prominent defect of the method. Meanwhile, the technology also needs professional detection equipment, and is not suitable for bedside detection. Immunological detection using antibodies as diagnostic targets has become an indispensable important technical means for detecting infection of pathogenic microorganisms in humans. Various specific immunoassay techniques, such as Radioimmunoassay (RIA), enzyme Immunoassay (EIA), fluorescence Immunoassay (FIA), chemiluminescence Immunoassay (CIA), immunoprecipitation, immunoagglutination, ELISA detection kit, immune colloidal gold test strip, immune latex detection reagent, and the like, have been developed. The immune latex test paper strip and other immunological detection technologies based on antigen and antibody have become an indispensable important means for detecting pathogenic microorganisms due to the characteristics of simplicity, rapidness, sensitivity, accuracy and practicability. Therefore, research and development of marker antigens of pathogenic microorganisms with proprietary intellectual property rights are the basis for development of methods for detecting pathogen antibodies such as ELISA and latex microsphere immunochromatography with proprietary intellectual property rights.

The preparation of antigen is the key to the specificity of antibody detection. In the research, surface proteins fhuE receptor, ompA, pilF and the like with interspecific specificity are selected as antigen targets to prepare fusion antigens with good specificity, and the fusion antigens are applied to preparation of acinetobacter baumannii antibody latex microsphere immunochromatography detection strips.

Disclosure of Invention

The invention aims to develop a detection strip for qualitatively detecting the acinetobacter baumannii specific antibody in human serum, which is simple to operate, low in cost, quick and rapid by using an immune latex labeling technology on the basis of fusion antigen.

The purpose of the invention is realized by the following technical scheme:

a preparation method of a test strip for qualitatively detecting specific antibodies of acinetobacter baumannii in human serum is characterized in that: the preparation method of the detection strip for qualitatively detecting the acinetobacter baumannii specific antibody in human serum comprises the following steps:

1) Preparation of Acinetobacter baumannii fusion antigen (Fhue + OmpA + Pilf):

respectively obtaining peptide segments with the most abundant antigenic epitopes in extracellular domains of acinetobacter baumannii surface protein Fhue, surface protein OmpA and surface protein Pilf, finding out the gene coding sequences of the peptide segments, optimizing the gene coding sequences of the peptide segments, and connecting the three segments of gene sequences by using the coding sequences of two segments of flexible connecting peptides to form a fusion gene;

the accession numbers of the acinetobacter baumannii surface protein Fhue, the surface protein OmpA and the surface protein Pilf in the NCBI protein database are KMV27515, AJF83030 and AJF80497 respectively;

the amino acid sequence of the flexible connecting peptide is ggsggsggsggs;

simultaneously, enzyme cutting site NdeI is introduced into the 5 'end of the fusion gene, and termination signal TAA and enzyme cutting site BamHI are introduced into the 3' end of the fusion gene, and then a whole gene sequence is chemically synthesized and is marked as FhuOmpPil;

the complete sequence of the FhuOmpPil gene is

The encoding amino acid sequence of the FhuOmpPil is as follows:

MFDGNYLDPVEGNSTEVGLKSAWFDGRLNGTLALYHIKQDNLAQEAGQVTRNGVKETYYRAAKGATSEGFEVEVSGQITPDWNITAGYSQFSAKDANDADVNTQLPRKMIQSFTTYKLPGGGSGGSGGSGGSLGYTFQDTQHNNGGKDGELTNGPELQDDLFVGAALGIELTPWLGFEAEYNQVKGDVDGLAAGAEYKQKQINGNFGGSGGSGGSGGSAVKVRTQLAAEYIRSGDLDSAKRSLDQALSVDSRDATANMMMGILLQQEGSKSNLEKAEHYFKRAISSEPDNAQARNNYGTYLYQMERYN；

the protein sequence coded by the FhuOmpPil gene is 509-627aa of surface protein Fhue of acinetobacter baumannii, 31-104aa of surface protein OmpA and 28-117aa of surface protein Pilf; three protein sequences are connected by two flexible connecting peptides; cloning the gene fragment into prokaryotic expression vector pET-28a (+) according to conventional method, inducing recombinant Escherichia coli expression by IPTG, and using Ni ²⁺ Purifying the recombinant His-FhuOmpPil fusion protein by affinity chromatography, freeze-drying and storing for later use; the amino acid sequence of the flexible connecting peptide is ggsggsggs;

2) Preparing a latex microsphere marker of a mouse anti-human IgG monoclonal antibody:

2.1 Activation of latex microspheres

Taking 1mL of colored carboxylated polystyrene latex microsphere solution with the concentration of 10%, adding 9mL of LMES (2- (N-morpholinyl) ethanesulfonic acid) buffer solution, uniformly mixing, adding NHS (N-hydroxysuccinimide) and EDC (1- (3-dimethylaminopropyl) -3-ethyl 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride) until the final concentration of the NHS and the EDC is 1mg/mL, slowly and uniformly mixing for 30 minutes at room temperature, centrifuging for 20 minutes at 19000g after the incubation is finished, removing supernatant, re-suspending the precipitate with 10mL of borax buffer solution, oscillating, and performing ultrasonic treatment to obtain activated latex microspheres; the M isThe ES buffer solution comprises the following components in percentage by weight: 0.1mol/L MES, pH of the MES buffer =8.5; the size of the colored carboxylated polystyrene latex microspheres is 100nm; the borax buffer solution comprises the following components in percentage by weight: 0.1mol/LNa ₂ B ₄ O ₇ Wherein the pH of the borax buffer is =8.5;

2.2 Preparation of latex microsphere markers

Preparing a mouse anti-human IgG monoclonal antibody into 1mg/mL by using borax buffer solution; adding 10mL of mouse anti-human IgG monoclonal antibody into 10mL of activated latex microspheres, slowly mixing uniformly for 30 minutes, centrifuging at 19000g for 10 minutes, and removing supernatant; resuspending the precipitate with 10mL borax buffer solution containing 1% casein, ultrasonically pulverizing, centrifuging for 1 time, and removing supernatant; resuspending the precipitate by the same method, repeatedly centrifuging for 1 time after ultrasonic pulverization, and removing supernatant; resuspending the precipitate with 10mL borax buffer solution containing 1% casein, namely the latex microsphere marker of the mouse anti-human IgG monoclonal antibody; the borax buffer solution comprises the following components in percentage by weight: 0.1mol/LNa ₂ B ₄ O ₇ Wherein the pH of the borax buffer solution is =8.5;

3) Preparation of the bonding pad:

spraying a latex microsphere marker of a mouse anti-human IgG monoclonal antibody on a bonding pad made of a polyester fiber material, wherein the spraying amount of a polyester fiber membrane per square centimeter is 20 mu L of the latex microsphere marker; drying at 37 deg.C in environment with relative humidity not more than 30%, cutting into required specification, sealing at 25 deg.C, drying and storing;

4) Preparation of antigen solid-phase nitrocellulose membrane:

diluting the acinetobacter baumannii fusion antigen (Fhue + OmpA + Pilf) obtained in the step 1) to 1.5mg/mL by using a borax buffer solution, and then coating the diluted antigen to a detection line position on a nitrocellulose membrane by using a membrane spraying instrument as a detection line capture antigen, wherein the coating parameter is 1 mu L/cm; spraying goat anti-mouse IgG polyclonal antibody on a quality control line position on a nitrocellulose membrane as a control line to capture the antibody, wherein the concentration is 1mg/mL, and the coating parameter is 1 muL/cm; the distance between the detection line and the quality control line is 0.7cm, and the edge distances between the detection line and the nitrocellulose membrane are 0.8cm respectively; coating, and mixingPlacing the cellulose acetate membrane in an environment with relative humidity not more than 30%, drying at 37 deg.C, cutting into required specification, sealing at 25 deg.C, drying and storing; the borax buffer solution has the components and the content of 0.1mol/LNa ₂ B ₄ O ₇ Wherein the pH of the borax buffer solution is =8.5;

5) Preparation of sample pad

Taking a glass cellulose membrane, soaking the glass cellulose membrane in a sample pad treatment solution for at least 3h, placing the sample pad treatment solution in a biological safety cabinet for ventilation drying at 37 ℃, cutting the sample pad treatment solution into required specifications, and sealing, drying and storing the sample pad treatment solution at 25 ℃; thus, a sample pad is prepared; the sample pad treatment solution comprises the following components in percentage by weight: 0.01mol/LNa ₂ B ₄ O ₇ 2g/L sodium chloride, 20g/L casein, 10ml/L Tween-20 and 10ml/L defoamer S-17; pH =8.5 of the sample pad treatment fluid;

6) Assembly of test strips

Respectively sticking a water absorption pad, an antigen solid-phase nitrocellulose membrane, a combination pad and a sample pad which are made of water absorption filter paper materials on a PVC (polyvinyl chloride) base plate in sequence, wherein a quality control line on the nitrocellulose membrane is close to the end of the water absorption pad, a detection line is close to the end of the sample pad, and then cutting the nitrocellulose membrane into detection strips with certain width, sealing and packaging the detection strips, and drying the detection strips for low-temperature storage; thus, the test strip for qualitatively detecting the specific antibody of the acinetobacter baumannii in human serum is prepared.

The invention has the advantages that:

1) The invention adopts the modes of antigen structure analysis, gene optimization and the like to construct a brand new fusion antigen gene, and successfully obtains the soluble recombinant Fhue/OmpA/Pilf fusion protein for the first time through soluble over-expression. The gene engineering fusion protein has high expression amount, high protein solubility, high antigenicity and low preparation cost.

2) The recombinant antigen prepared by using the extracellular exposure epitopes of three structural proteins on the surface of the acinetobacter baumannii for the first time has high recognition capability on serum antibodies and strong capture capability, greatly reduces the possibility of missed detection, has high sensitivity of a detection strip, and has the advantages of rapidness, high efficiency and the like.

3) The test strip has good specificity, and results of specificity experiments carried out by using 78 serum samples of acinetobacter baumannii infected persons and 100 serum samples of acinetobacter baumannii non-infected persons which are identified and confirmed by etiology show that the test strip has good specificity and sensitivity, can detect the serum of all tested acinetobacter baumannii infected persons, has no cross reaction with the serum samples of the acinetobacter baumannii non-infected persons, and is very suitable for clinical non-diagnostic application.

4) The detection strip can be preserved for two years at normal temperature, effectively prolongs the shelf life and reduces the storage condition; non-professional persons can finish the whole-process detection by using the detection test paper, the operation is simple, and the popularization of the method is facilitated; the whole detection process can be finished within 10min at the fastest speed, and is more suitable for bedside detection.

Drawings

FIG. 1 is a schematic diagram of an explosion structure of a test strip for qualitatively detecting Acinetobacter baumannii specific antibodies in human serum provided by the invention;

FIG. 2 is a schematic diagram of an assembly structure of the test strip for qualitatively detecting Acinetobacter baumannii specific antibody in human serum provided by the present invention;

wherein:

1-sample pad; 2-a conjugate pad; 3-NC film; 4-absorbent pad; 5-PVC sheet.

Detailed Description

The present invention is further specifically described by the following examples.

Sources of the various materials used or employed in the present invention

1. Latex microspheres: the latex microspheres used in the invention are carboxylated modified polystyrene latex microspheres, are products of Shanghai Yan Biotech Co., ltd, have the particle size of 100NM and the color of red, have the tolerance of the average diameter of the products within 10 percent, are in the form of 10 percent solid-water suspension, and have the product code of MSI-CAR100NM.

2. Glass cellulose film: the thickness is 0.45-0.55mm, and the water absorption capacity is 600-800mg/m ² The glass fiber has a diameter of 0.6-3 μm and good hydrophilicity, and is available from Shanghai gold-labeled Biotech Co., ltd (model number BT 50).

3. Polyester fiber film: has a thickness of 0.25-0.35mm, a climbing speed of 15-40mm/60s, excellent hydrophilicity, and is used for preparing a bonding pad, and is available from Shanghai gold-labeled Biotech Co., ltd (model number VL 98).

4. Cellulose nitrate membrane: model number Millipore Corp SHF135, with liner plates, was purchased from Millipore corporation.

5. Water-absorbing filter paper: the thickness is 0.95mm, the water absorption speed is 60s/4cm, and the water absorption capacity is 700mg/cm ² Has good water absorption and can be used as a material for manufacturing the water absorption pad. Purchased from Shanghai gold Biotechnology Ltd (model CH 37K).

6. A bottom plate: is made of high-whiteness PVC material, the surface of which is coated with a single-layer high-polymer pressure-sensitive adhesive SM31, purchased from Shanghai gold-labeled Biotech Co., ltd.

7. The microorganism samples used in the present invention were purchased from the American Type Culture Collection (ATCC).

8. pET28a (+): e.coli expression vectors, introduced from Novagen, USA.

9. Escherichia coli (e.coli) BL21 (DE 3): purchased from northern Biotechnology, inc., shanghai.

10. Goat anti-mouse IgG polyclonal antibody: product No. BA1038, product of bosch de bioengineering limited.

11. Mouse anti-human IgG monoclonal antibody: product of Abcam, USA, cat # ab771, which is a monoclonal antibody to human IgG Fab segment secreted by hybridoma cells [ 4A11 ].

The methods used in the following examples are conventional methods unless otherwise specified.

Example 1 preparation of acinetobacter baumannii fusion antigen (Fhue + OmpA + Pilf):

1.1 Cloning of Acinetobacter baumannii FhuOmpPil fusion Gene

Peptide segments with most abundant antigenic epitopes in extracellular domains of acinetobacter baumannii surface proteins Fhue, ompA and Pilf (the accession numbers in an NCBI protein database are KMV27515, AJF83030 and AJF80497 respectively) are obtained respectively, gene coding sequences of the peptide segments are found, the gene coding sequences of the peptide segments are optimized, and the three segments of gene sequences are connected by the coding sequences of two segments of flexible connecting peptides (ggsgggsgggs) to form fusion genes. Meanwhile, after introducing a restriction enzyme site NdeI at the 5 'end and introducing a termination signal TAA and a restriction enzyme site BamHI at the 3' end of the fusion gene, a complete gene sequence is chemically synthesized and is marked as FhuOmpPil. The whole gene sequence and the coded amino acid sequence are shown in a sequence table. Specifically, the protein sequence encoded by the FhuOmpPil gene is 509-627aa of the surface protein Fhue of Acinetobacter baumannii, 31-104aa of the surface protein OmpA and 28-117aa of the surface protein Pilf. The three protein sequences are connected in pairs by two sections of flexible connecting peptides (ggsggsggsggs). The gene sequence is delivered to Nanjing Jinslei Biotech, inc. for complete gene chemical synthesis, and the artificially synthesized gene fragment is connected to vector pUC57 at delivery. The vector pUC57 containing the artificially synthesized DNA fragment was digested with NdeI and BamHI, and the objective fragment was recovered by a conventional method and used. And simultaneously carrying out double enzyme digestion on the vector pET-28a (+) by NdeI and BamHI, connecting the FhuOmpPil gene obtained after double enzyme digestion into the pET-28a (+) vector according to a conventional molecular biology method, and transforming Escherichia coli TOP10 to construct a pET-FhuOmpPil expression vector. The construction of the expression vector is verified to be correct by enzyme digestion and sequence determination. The vector expresses recombinant FhuOmpPil fusion protein.

1.2 Acinetobacter baumannii FhuOmpPil fusion protein expression

Culturing the correctly identified positive clone bacteria, extracting plasmids, transferring into competent E.coli BL21 (DE 3) according to a conventional technology, coating the bacterial liquid on an LB (lysogeny broth) plate containing 50 mu g/mL kanamycin after the conversion is finished, and screening expression strains according to a conventional method. Individual colonies transformed with pET-FhuOmpPil having the ability to express foreign proteins were picked and inoculated into 100mL of LB medium and cultured overnight at 37 ℃. After taking out the bacterial liquid, the bacterial liquid is prepared according to the following steps of 1:100 was inoculated into 100mL of LB medium containing 50. Mu.g/mL of kanamycin, and when the cells were cultured at 37 ℃ to OD600=0.6, 1mol/L of IPTG was added to a final concentration of 0.5mmol/L, and the cells were cultured with shaking at 37 ℃ to induce expression of the fusion protein. After induction for 3h, the thalli are collected by centrifugation for 10min at 8000 r/min. The cells were treated with 50mL of BufferA (50 mM Na) ₃ PO ₄ 0.5M NaCl; pH7.4) was washed 3 times and 50mL of loading buffer (50 mM Na) ₃ PO ₄ 0.5M NaCl;5mM imidazole, pH 7.4) followed by resuspension, sonication, operating under the following conditions: the power is 50W, the working time is 2s, the interval time is 3s, the alarm temperature is 60 ℃, and the total time is 30min. After the ultrasonic treatment is finished, 19000g is centrifuged for 15min to collect precipitates and supernatant respectively, and then electrophoresis detection is carried out. The recombinant FhuOmpPil fusion protein was found to be present in the bacterial cells in solubilized form. Thin-layer scanning shows that the recombinant protein accounts for more than 20% of the total protein of the bacteria, which indicates that the fusion protein obtains higher expression quantity after gene optimization. The wild type FhuOmpPil gene which is not subjected to sequence optimization is expressed in the same manner, and no expression product is found, so that the gene optimization is successful and the effect is good. The wild type FhuOmpPil gene which is not subjected to gene optimization is expressed in the same manner as described above, and no expression product is found, which indicates that the gene optimization effect is outstanding. The sonicated supernatant obtained above was filtered through a 0.45 μm filter and purified by His Trap affinity columns (GE healthcare Co.) according to the method described in the specification. The specific method comprises the following steps:

(1) Connecting a chromatography system, wherein the system comprises a sample inlet pipe, a peristaltic pump (Shanghai Huxi analysis instrument factory, model DHL-A), a chromatography column (GE healthcare company product, trade name His Trap affinity columns) and an ultraviolet detector (Shanghai Huxi analysis instrument factory, model HD 1), the volume of the column is 2ml, and the ultraviolet detector is preheated for about 30min until the reading is stable;

(2) And (5) correcting T%: adjusting a brightness knob to display 100%;

(3) Rotate the sensitivity to the appropriate position, typically 0.2A;

(4) Equilibrating the chromatography system with the loading buffer until the reading stabilizes and then rotating "zero" to show "000";

(5) Applying protein sample, controlling the flow rate within 5ml/min, and collecting penetration liquid;

(6) Washing away unbound protein with a loading buffer, recording the reading during the process until the reading does not change any more, and collecting the eluate;

(7) Eluting with BufferA +10mM imidazole, and collecting an elution peak;

(8) Eluting with BufferA and 20mM imidazole, and collecting an elution peak;

(9) Eluting with BufferA and 40mM imidazole, and collecting an elution peak;

(10) Eluting with BufferA +100mM imidazole, and collecting an elution peak;

(11) Eluting with BufferA +150mM imidazole, and collecting an elution peak;

(12) Taking 100ul of each elution peak sample to carry out SDS-PAGE electrophoresis;

(13) As a result, it was found that the target protein (37 KD) was eluted at 100mM imidazole and had a purity of 90% or more, and the concentration was adjusted to 5mg/mL for use after the protein concentration was measured with a bradford kit. Thus, an Acinetobacter baumannii fusion antigen (Fhue + OmpA + Pilf) was prepared.

Example 2 preparation of latex microsphere labels for murine anti-human IgG monoclonal antibodies

2.1 Activation of latex microspheres

Taking 1mL of 10% red carboxylated polystyrene latex microsphere (100 nm) solution, adding 9mL of 2- (N-morpholinyl) ethanesulfonic acid (MES) buffer solution (0.1 mol/LMES, pH8.5), and uniformly mixing; respectively preparing 10mg/mL of N-hydroxysuccinimide (NHS) and 10mg/mL of 1- (3-dimethylaminopropyl) -3-ethyl-1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (EDC) solution by using MES buffer solution;

sequentially adding 1mL of the HS solution and 1mL of the EDC solution into the polystyrene latex microsphere (100 nm) solution, slowly and uniformly mixing for 30 minutes at room temperature, centrifuging for 20 minutes at 19000g after the incubation is finished, removing supernatant, and precipitating with 10mL of borax buffer solution (0.1 mol/LNa) ₂ B ₄ O ₇ Ph 8.5), resuspension, shaking, sonication (sonicator model: YJ92-IIDN, the power is 50W, the working time is 2s, the interval time is 3s, the alarm temperature is 60 ℃, and the total time is 30 min) to obtain the activated latex microspheres.

2.2 Preparation of latex microsphere markers

With borax buffer (0.1 mol/LNa) ₂ B ₄ O ₇ pH8.5) the mouse anti-human IgG monoclonal antibody was diluted to 1mg/mL. 10mL of mouse anti-human IgG monoclonal antibody is taken and added into 10mL of activated latex microsphere, and 19000g of the mixture is centrifuged for 10 minutes after being slowly and evenly mixed for 30 minutes,and removing the supernatant. The precipitate was resuspended in 10mL of borax buffer containing 1% casein, sonicated (sonicator model: YJ92-IIDN, power 50W, working time 2s, interval time 3s, alarm temperature 60 ℃, total time 30 min), centrifuged 1 time (10 min) at 19000g repeatedly, and the supernatant was removed. The pellet was resuspended in the same way, sonicated and centrifuged again at 19000g for 1 time (10 min) and the supernatant removed. And (3) resuspending the precipitate by using 10mL of borax buffer solution containing 1% casein, so as to obtain the latex microsphere marker of the mouse anti-human IgG monoclonal antibody.

Example 3 preparation of conjugate pad:

the polyester fiber film was cut into pieces of 4cm × 0.8 cm/piece, and 64 μ L of the latex microsphere marker prepared in example 2 was dropped onto the cut pieces of the film. After spraying, drying at 37 ℃ for 12h in an environment with the relative humidity of 20%. Sealing, drying and storing at 25 ℃.

Example 4 preparation of antigen-immobilized nitrocellulose membrane:

the nitrocellulose membrane was cut to a size of 4 cm. Times.2.3 cm. Borax buffer (0.1 mol/LNa) will be used ₂ B ₄ O ₇ pH8.5) respectively diluting the acinetobacter baumannii fusion antigen (Fhue + OmpA + Pilf) obtained in the step 1 and the goat anti-mouse IgG polyclonal antibody into 1.5mg/mL and 1mg/mL; filling the diluted acinetobacter baumannii fusion antigen (Fhue + OmpA + Pilf) into a BIODOT membrane-scribing instrument spray head 1, setting the amount of 1.0 mu l/cm, and spraying the diluted acinetobacter baumannii fusion antigen on a nitrocellulose membrane to form a detection line, wherein the edge distance between the detection line and the nitrocellulose membrane is 0.8cm; and (3) filling the diluted goat anti-mouse IgG polyclonal antibody into a nozzle 2 of a BIODOT membrane drawing instrument, setting the amount of 1.0 mu l/cm, spraying the diluted goat anti-mouse IgG polyclonal antibody on a nitrocellulose membrane to be used as a quality control line, and setting the distance between the diluted goat anti-mouse IgG polyclonal antibody and a detection line to be 0.7cm. After coating, the nitrocellulose membrane is placed in an environment with the relative humidity of 20 percent, dried at 37 ℃ for 12h, sealed at 25 ℃ and stored in a dry way.

EXAMPLE 5 preparation of sample pad

Preparing sample pad treatment solution with different formulas, observing the release effect of the latex microsphere labeled antibody, and optimizing by multiple orthogonal tests to obtain the optimal formula (0.01 mol/LNa) of the sample pad treatment solution ₂ B ₄ O ₇ 2g/L sodium chloride, 20g/L casein, 10ml/L Tween20, 10ml/L antifoam S-17, pH 8.5). Taking a glass cellulose membrane, soaking the glass cellulose membrane in the sample pad treatment solution for 3h, then placing the sample pad in a biological safety cabinet for 12h at 37 ℃ for ventilation drying, cutting the sample pad into strips with the specification of 4cm multiplied by 3cm, sealing and drying at 25 ℃ for storage, and obtaining the sample pad. Thus, a sample pad was prepared. Tests prove that the use of the sample pad greatly improves the release rate of the latex microsphere labeled antibody on the bonding pad, and achieves better application effect.

EXAMPLE 6 absorbent pad tailoring

The water-absorbing filter paper purchased from Shanghai gold-labeled Biotechnology Co., ltd, model number CH37K, was cut into pieces of 4 cm. Times.3 cm/strip for use.

EXAMPLE 7 cutting of PVC sheets

A high-whiteness PVC sheet purchased from Shanghai gold-labeled Biotechnology Co., ltd., model number SM31 was cut into 4cm × 8.5 cm/strip for use.

EXAMPLE 8 Assembly of test strips

As shown in fig. 1 and 2, an NC film 3, a conjugate pad 2, an absorbent pad 4, and a sample pad 1 are sequentially bonded on a single-sided PVC sheet 5, wherein the conjugate pad 2 and the absorbent pad 4 are stacked on the NC film 3, respectively overlapping the NC film 3 by about 2mm, and the sample pad 1 is stacked on the conjugate pad 2, overlapping the conjugate pad 2 by about 2mm. The NC membrane 3 is marked with a detection line T and a quality control line C. Cutting the adhered test paper board into test strips with the width of 4mm by a cutting machine, and filling the prepared test strips and the drying agent into an aluminum foil bag for sealing and storage.

EXAMPLE 9 method of Using test strips

9.1 Treatment of the sample to be examined

Obtaining 100 μ L serum of a subject to be tested by conventional method, adding sample diluent (0.01 mol/LNa) ₂ B ₄ O ₇ 2g/L sodium chloride, 20ml/L Tween-20), and taking out 100 mu L to be used as a sample to be detected.

9.2 Adding the sample to be examined, and determining the result

Adding 100 mu L of sample into the randomly extracted and assembled detection strip, combining the acinetobacter baumannii antibody in the sample liquid with the latex microsphere labeled antibody on the binding pad, combining the antibody with a detection line (T line) under the action of chromatography, and acting for 10min at room temperature, wherein two red lines, namely a detection line T line and a quality control line C line, appear in the positive result; if the detection sample does not contain the Acinetobacter baumannii antibody, a negative result only shows that a red line appears on the C line of the quality control line, and the sample does not contain the Acinetobacter baumannii antibody.

EXAMPLE 10 Performance of test strips

10.1 Analysis of specificity and sensitivity)

In order to verify the specificity and sensitivity of the test strip for qualitatively detecting the Acinetobacter baumannii specific antibody in human serum, 78 portions of Acinetobacter baumannii infector positive serum samples which are verified by pathogen analysis and WB experiments and 100 portions of non-Acinetobacter baumannii infector serum samples which are verified by WB experiments (WB experiments are verified to be negative) are detected according to the composition and the method of the test strip in the embodiment 8 and the embodiment 9 (wherein the non-Acinetobacter baumannii infector serum samples comprise Haemophilus influenzae antibody positive serum, mycoplasma pneumoniae antibody positive serum, streptococcus pneumoniae antibody positive serum, legionella pneumophila antibody positive serum and chlamydia pneumoniae antibody positive serum);

the detection result of the detection strip of the invention is as follows: 78 Acinetobacter baumannii infected persons have positive serum antibodies; 100 serum samples of non-acinetobacter baumannii infected persons are negative, so that the detection specificity of the detection strip is 100%, and the sensitivity is 100%.

8.2 Stability test

The test strips were dried and sealed, and then placed at 4 ℃,25 ℃, 37 ℃ and used to test Acinetobacter baumannii antibody positive (WB confirmation) serum dilutions after 6 months, 12 months, 18 months, 21 months and 24 months, respectively, and the results were observed.

Drying and sealing the detection strip, and standing at 4 deg.C and 25 deg.C for 6-24 months respectively to detect strong positive result; positive results were also detected after 6-18 months at 37 ℃, but were reduced after 21-24 months of storage. Indicating that the test strip can be stored at 4 ℃ or 25 ℃ for at least 2 years.

Finally, it is noted that the above-mentioned embodiments illustrate rather than limit the invention, and that, while the invention has been described with reference to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.

Sequence listing

<110> Hubei university of industry

<120> detection strip for qualitatively detecting acinetobacter baumannii specific antibody in human serum

<141> 2019-10-31

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 936

<212> DNA

<213> FhuOmpPil Gene sequence (FhuOmpPil)

<400> 1

catatgttcg atggcaacta cctggacccg gtagaaggta actctactga agttggtctc 60

aaatccgctt ggtttgacgg ccgtctgaac ggtaccctgg ctctgtacca catcaaacag 120

gacaacctgg cacaggaagc gggccaagtt acccgtaacg gtgttaaaga gacttactac 180

cgtgcagcga aaggcgctac atccgaaggt tttgaagttg aagtatcagg tcagatcact 240

ccagattgga acatcaccgc aggttactct caattttctg ctaaggacgc gaacgatgcg 300

gacgtaaaca ctcagcttcc gcgtaaaatg atccagagct tcactaccta taaactgcct 360

ggtggtggtt ctggtggttc tggtggttct ggtggttctc tgggttacac cttccaggat 420

actcagcaca acaacggcgg taaagacggt gaactgacca acggtccgga actgcaggac 480

gacctgttcg ttggtgctgc gctgggtatc gaactgactc cgtggctggg tttcgaagcc 540

gagtataacc aggttaaggg tgacgtggat ggcctggcag cgggtgctga atacaaacag 600

aaacagatca acggtaactt cggtggttct ggtggttctg gtggttctgg tggttctgcg 660

gttaaggtac gcactcaact ggcggctgaa tatatccgtt caggtgatct ggactccgcg 720

aaacgctccc tggaccaggc cctgagcgtt gactctcgtg acgcgacagc aaacatgatg 780

atgggcatcc tgctgcagca ggagggctct aaatctaacc tggagaaagc ggagcactac 840

ttcaaacgtg ctatcagttc tgaaccggat aacgctcagg cgcgcaacaa ctatggtacc 900

tatctgtacc agatggaacg ttataactaa ggatcc 936

<210> 2

<211> 308

<212> PRT

<213> FhuOmpPil protein sequence (FhuOmpPil)

<400> 2

Met Phe Asp Gly Asn Tyr Leu Asp Pro Val Glu Gly Asn Ser Thr Glu

1 5 10 15

Val Gly Leu Lys Ser Ala Trp Phe Asp Gly Arg Leu Asn Gly Thr Leu

20 25 30

Ala Leu Tyr His Ile Lys Gln Asp Asn Leu Ala Gln Glu Ala Gly Gln

35 40 45

Val Thr Arg Asn Gly Val Lys Glu Thr Tyr Tyr Arg Ala Ala Lys Gly

50 55 60

Ala Thr Ser Glu Gly Phe Glu Val Glu Val Ser Gly Gln Ile Thr Pro

65 70 75 80

Asp Trp Asn Ile Thr Ala Gly Tyr Ser Gln Phe Ser Ala Lys Asp Ala

85 90 95

Asn Asp Ala Asp Val Asn Thr Gln Leu Pro Arg Lys Met Ile Gln Ser

100 105 110

Phe Thr Thr Tyr Lys Leu Pro Gly Gly Gly Ser Gly Gly Ser Gly Gly

115 120 125

Ser Gly Gly Ser Leu Gly Tyr Thr Phe Gln Asp Thr Gln His Asn Asn

130 135 140

Gly Gly Lys Asp Gly Glu Leu Thr Asn Gly Pro Glu Leu Gln Asp Asp

145 150 155 160

Leu Phe Val Gly Ala Ala Leu Gly Ile Glu Leu Thr Pro Trp Leu Gly

165 170 175

Phe Glu Ala Glu Tyr Asn Gln Val Lys Gly Asp Val Asp Gly Leu Ala

180 185 190

Ala Gly Ala Glu Tyr Lys Gln Lys Gln Ile Asn Gly Asn Phe Gly Gly

195 200 205

Ser Gly Gly Ser Gly Gly Ser Gly Gly Ser Ala Val Lys Val Arg Thr

210 215 220

Gln Leu Ala Ala Glu Tyr Ile Arg Ser Gly Asp Leu Asp Ser Ala Lys

225 230 235 240

Arg Ser Leu Asp Gln Ala Leu Ser Val Asp Ser Arg Asp Ala Thr Ala

245 250 255

Asn Met Met Met Gly Ile Leu Leu Gln Gln Glu Gly Ser Lys Ser Asn

260 265 270

Leu Glu Lys Ala Glu His Tyr Phe Lys Arg Ala Ile Ser Ser Glu Pro

275 280 285

Asp Asn Ala Gln Ala Arg Asn Asn Tyr Gly Thr Tyr Leu Tyr Gln Met

290 295 300

Glu Arg Tyr Asn

305

Claims (4)

1. An acinetobacter baumannii fusion antigen Fhue + OmpA + Pilf, which is characterized in that: the protein sequence of the acinetobacter baumannii fusion antigen Fhue + OmpA + Pilf is as follows:

MFDGNYLDPVEGNSTEVGLKSAWFDGRLNGTLALYHIKQDNLAQEAGQVTRNGVKETYYRAAKGATSEGFEVEVSGQITPDWNITAGYSQFSAKDANDADVNTQLPRKMIQSFTTYKLPGGGSGGSGGSGGSLGYTFQDTQHNNGGKDGELTNGPELQDDLFVGAALGIELTPWLGFEAEYNQVKGDVDGLAAGAEYKQKQINGNFGGSGGSGGSGGSAVKVRTQLAAEYIRSGDLDSAKRSLDQALSVDSRDATANMMMGILLQQEGSKSNLEKAEHYFKRAISSEPDNAQARNNYGTYLYQMERYN；

the complete sequence of the gene for encoding the protein of the acinetobacter baumannii fusion antigen Fhue + OmpA + Pilf is:

CATATGTTCGATGGCAACTACCTGGACCCGGTAGAAGGTAACTCTACTGAAGTTGGTCT

CAAATCCGCTTGGTTTGACGGCCGTCTGAACGGTACCCTGGCTCTGTACCACATCAAACAGGACAACCTGGCACAGGAAGCGGGCCAAGTTACCCGTAACGGTGTTAAAGAGACTTACTACCGTGCAGCGAAAGGCGCTACATCCGAAGGTTTTGAAGTTGAAGTATCAGGTCAGATCACTCCAGATTGGAACATCACCGCAGGTTACTCTCAATTTTCTGCTAAGGACGCGAACGATGCGGACGTAAACACTCAGCTTCCGCGTAAAATGATCCAGAGCTTCACTACCTATAAACTGCCTGGTGGTGGTTCTGGTGGTTCTGGTGGTTCTGGTGGTTCTCTGGGTTACACCTTCCAGGATACTCAGCACAACAACGGCGGTAAAGACGGTGAACTGACCAACGGTCCGGAACTGCAGGACGACCTGTTCGTTGGTGCTGCGCTGGGTATCGAACTGACTCCGTGGCTGGGTTTCGAAGCCGAGTATAACCAGGTTAAGGGTGACGTGGATGGCCTGGCAGCGGGTGCTGAATACAAACAGAAACAGATCAACGGTAACTTCGGTGGTTCTGGTGGTTCTGGTGGTTCTGGTGGTTCTGCGGTTAAGGTACGCACTCAACTGGCGGCTGAATATATCCGTTCAGGTGATCTGGACTCCGCGAAACGCTCCCTGGACCAGGCCCTGAGCGTTGACTCTCGTGACGCGACAGCAAACATGATGATGGGCATCCTGCTGCAGCAGGAGGGCTCTAAATCTAACCTGGAGAAAGCGGAGCACTACTTCAAACGTGCTATCAGTTCTGAACCGGATAACGCTCAGGCGCGCAACAACTATGGTACCTATCTGTACCAGATGGAACGTTATAACTAAGGATCC。

2. a method for preparing acinetobacter baumannii fusion antigen Fhue + OmpA + Pilf according to claim 1, characterized in that: the method comprises the following steps:

respectively obtaining peptide segments with the most abundant antigenic epitopes in the extracellular domains of the acinetobacter baumannii surface protein Fhue, the surface protein OmpA and the surface protein Pilf, finding out the gene coding sequence of the peptide segment, optimizing the gene coding sequence of the peptide segment, and connecting the three segments of gene sequences by using the coding sequences of two segments of flexible connecting peptides to form a fusion gene;

the Acinetobacter baumannii surface protein Fhue, the surface protein OmpA and the surface protein Pilf respectively have access numbers of KMV27515, AJF83030 and AJF80497 in an NCBI protein database;

the amino acid sequence of the flexible connecting peptide is ggsggsggs;

simultaneously, enzyme cutting site NdeI is introduced into the 5 'end of the fusion gene, a termination signal TAA and enzyme cutting site BamHI are introduced into the 3' end of the fusion gene, and then a complete gene sequence is chemically synthesized and recordedIs FhuOmpPil；

The above-mentionedFhuOmpPilThe complete sequence of the gene is:

CATATGTTCGATGGCAACTACCTGGACCCGGTAGAAGGTAACTCTACTGAAGTTGGTCT

CAAATCCGCTTGGTTTGACGGCCGTCTGAACGGTACCCTGGCTCTGTACCACATCAAACAGGACAACCTGGCACAGGAAGCGGGCCAAGTTACCCGTAACGGTGTTAAAGAGACTTACTACCGTGCAGCGAAAGGCGCTACATCCGAAGGTTTTGAAGTTGAAGTATCAGGTCAGATCACTCCAGATTGGAACATCACCGCAGGTTACTCTCAATTTTCTGCTAAGGACGCGAACGATGCGGACGTAAACACTCAGCTTCCGCGTAAAATGATCCAGAGCTTCACTACCTATAAACTGCCTGGTGGTGGTTCTGGTGGTTCTGGTGGTTCTGGTGGTTCTCTGGGTTACACCTTCCAGGATACTCAGCACAACAACGGCGGTAAAGACGGTGAACTGACCAACGGTCCGGAACTGCAGGACGACCTGTTCGTTGGTGCTGCGCTGGGTATCGAACTGACTCCGTGGCTGGGTTTCGAAGCCGAGTATAACCAGGTTAAGGGTGACGTGGATGGCCTGGCAGCGGGTGCTGAATACAAACAGAAACAGATCAACGGTAACTTCGGTGGTTCTGGTGGTTCTGGTGGTTCTGGTGGTTCTGCGGTTAAGGTACGCACTCAACTGGCGGCTGAATATATCCGTTCAGGTGATCTGGACTCCGCGAAACGCTCCCTGGACCAGGCCCTGAGCGTTGACTCTCGTGACGCGACAGCAAACATGATGATGGGCATCCTGCTGCAGCAGGAGGGCTCTAAATCTAACCTGGAGAAAGCGGAGCACTACTTCAAACGTGCTATCAGTTCTGAACCGGATAACGCTCAGGCGCGCAACAACTATGGTACCTATCTGTACCAGATGGAACGTTATAACTAAGGATCC；

the above-mentionedFhuOmpPilThe protein sequence of (a) is:

MFDGNYLDPVEGNSTEVGLKSAWFDGRLNGTLALYHIKQDNLAQEAGQVTRNGVKETYYRAAKGATSEGFEVEVSGQITPDWNITAGYSQFSAKDANDADVNTQLPRKMIQSFTTYKLPGGGSGGSGGSGGSLGYTFQDTQHNNGGKDGELTNGPELQDDLFVGAALGIELTPWLGFEAEYNQVKGDVDGLAAGAEYKQKQINGNFGGSGGSGGSGGSAVKVRTQLAAEYIRSGDLDSAKRSLDQALSVDSRDATANMMMGILLQQEGSKSNLEKAEHYFKRAISSEPDNAQARNNYGTYLYQMERYN；

the above-mentionedFhuOmpPilThe protein sequence coded by the gene is 509-627aa of surface protein Fhue of acinetobacter baumannii, 31-104aa of surface protein OmpA and 28-117aa of surface protein Pilf; three protein sequences are connected by two flexible connecting peptides; cloning the gene fragment into prokaryotic expression vector pET-28a (+) according to conventional method, inducing recombinant Escherichia coli expression by IPTG, and using Ni ²⁺ Purifying the recombinant His-FhuOmpPil fusion protein by affinity chromatography, freeze-drying and storing for later use; the amino acid sequence of the flexible connecting peptide is ggsggsggs.

3. A test strip for qualitatively detecting Acinetobacter baumannii specific antibodies in human serum is characterized in that: the test strip for qualitatively detecting the specific antibody of acinetobacter baumannii in human serum comprises a nitrocellulose membrane coated with the acinetobacter baumannii fusion antigen Fhue + OmpA + Pilf as claimed in claim 1 and a latex microsphere marker of a mouse anti-human IgG monoclonal antibody.

4. A method for preparing the test strip for qualitatively detecting acinetobacter baumannii specific antibodies in human serum according to claim 3, characterized in that: the method comprises the following steps:

1) Preparing an acinetobacter baumannii fusion antigen Fhue + OmpA + Pilf;

2) Preparing a latex microsphere marker of a mouse anti-human IgG monoclonal antibody:

2.1 Activation of latex microspheres:

taking 1mL of colored carboxylated polystyrene latex microsphere solution with the concentration of 10%, adding 9mL of MES buffer solution, mixing uniformly, adding NHS and EDC until the final concentration of the two is 1mg/mL, and carrying out room temperature treatmentSlowly mixing uniformly for 30 minutes, centrifuging for 20 minutes at 19000g after the incubation is finished, removing supernatant, re-suspending the precipitate with 10mL of borax buffer solution, oscillating, and performing ultrasonic treatment to obtain activated latex microspheres; the MES buffer solution comprises the following components in percentage by weight: 0.1mol/L MES, pH of the MES buffer =8.5; the borax buffer solution comprises the following components in percentage by weight: 0.1mol/L Na ₂ B ₄ O ₇ The pH value of the borax buffer solution is 8.5; the grain size of the colored carboxylated polystyrene latex microspheres is 100nm;

2.2 Preparation of latex microsphere markers:

preparing a mouse anti-human IgG monoclonal antibody into 1mg/mL by using borax buffer solution; adding 10mL of mouse anti-human IgG monoclonal antibody into 10mL of activated latex microspheres, slowly mixing uniformly for 30 minutes, centrifuging at 19000g for 10 minutes, and removing supernatant; resuspending the precipitate with 10mL borax buffer solution containing 1% casein, ultrasonically pulverizing, centrifuging for 1 time, and removing supernatant; resuspending the precipitate by the same method, repeatedly centrifuging for 1 time after ultrasonic pulverization, and removing supernatant; resuspending the precipitate with 10mL borax buffer solution containing 1% casein to obtain the latex microsphere marker of the mouse anti-human IgG monoclonal antibody; the borax buffer solution comprises the following components in percentage by weight: 0.1mol/L Na ₂ B ₄ O ₇ Wherein the pH of the borax buffer is =8.5;

3) Preparation of the bonding pad:

spraying a latex microsphere marker of a mouse anti-human IgG monoclonal antibody on a bonding pad made of a polyester fiber material, wherein the spraying amount of a polyester fiber film per square centimeter is 20 muL; drying at 37 deg.C in environment with relative humidity not more than 30%, cutting into required specification, sealing at 25 deg.C, drying and storing;

4) Preparation of antigen solid-phase nitrocellulose membrane:

diluting the Acinetobacter baumannii fusion antigen Fhue + OmpA + Pilf obtained in the step 1) to 1.5mg/mL by using a borax buffer solution, and then using a detection line position coated on a nitrocellulose membrane by using a membrane spraying instrument as a detection line to capture the antigen, wherein the coating parameter is 1 muL/cm; spraying a goat anti-mouse IgG polyclonal antibody on a quality control line position on a nitrocellulose membrane as a control line to capture the antibody, wherein the concentration is 1mg/mL, and the coating parameter is 1 muL/cm; it is provided withThe distance between the detection line and the quality control line is 0.7cm, and the edge distances between the detection line and the quality control line and between the detection line and the nitrocellulose membrane are respectively 0.8cm; after coating, putting the nitrocellulose membrane in an environment with the relative humidity not more than 30%, drying at 37 ℃, cutting into required specifications, sealing at 25 ℃, drying and storing; the components and the content of the borax buffer solution are 0.1mol/L Na ₂ B ₄ O ₇ Wherein the pH of the borax buffer is =8.5;

5) Preparation of sample pad:

taking a glass cellulose membrane, soaking the glass cellulose membrane in the sample pad treatment solution for at least 3 hours, placing the sample pad treatment solution in a biological safety cabinet, performing ventilation drying at 37 ℃, cutting the sample pad into required specifications, and performing sealing, drying and storage at 25 ℃; thus, a sample pad was prepared; the sample pad treatment solution comprises the following components in percentage by weight: 0.01mol/L Na ₂ B ₄ O ₇ 2g/L sodium chloride, 20g/L casein, 10ml/L Tween-20 and 10ml/L defoamer S-17; pH =8.5 of the sample pad treatment fluid;

6) Assembling the detection strip:

respectively sticking a water absorption pad, an antigen solid-phase nitrocellulose membrane, a combination pad and a sample pad which are made of water absorption filter paper materials on a PVC (polyvinyl chloride) base plate in sequence, wherein a quality control line on the nitrocellulose membrane is close to the end of the water absorption pad, a detection line is close to the end of the sample pad, and then cutting the nitrocellulose membrane into detection strips with certain width, sealing and packaging the detection strips, and drying the detection strips for low-temperature storage; thus, the test strip for qualitatively detecting the specific antibody of the acinetobacter baumannii in human serum is prepared.

Images