CN112538119A

CN112538119A - Canine phagocytophilic cell anaplasma P44 recombinant protein and preparation method and application thereof

Info

Publication number: CN112538119A
Application number: CN202011474619.8A
Authority: CN
Inventors: 李晓光; 何坚锋; 王哲侃
Original assignee: Hangzhou Immuno Biotech Co ltd
Current assignee: Hangzhou Immuno Biotech Co ltd
Priority date: 2020-12-14
Filing date: 2020-12-14
Publication date: 2021-03-23

Abstract

The invention discloses a canine phagocytophile anaplasma P44 recombinant protein, and belongs to the field of animal virus antibody detection. The recombinant protein comprises an amino acid sequence shown in SEQ ID NO.1 or consists of the amino acid sequence shown in SEQ ID NO. 1. The invention further discloses a gene of the recombinant protein, a vector and a host cell containing the gene, a preparation method of the recombinant protein and application of the recombinant protein in detecting an antibody of dog phagocytophilic anaplasma. The recombinant protein is used for detecting the canine phagocytophile anaplasma antibody, is convenient and rapid, has high sensitivity, no cross reaction with other pathogens, strong specificity, great clinical significance and wide application prospect.

Description

Canine phagocytophilic cell anaplasma P44 recombinant protein and preparation method and application thereof

Technical Field

The invention belongs to the field of animal virus antibody detection, and particularly relates to a canine phagocytophile anaplasma P44 recombinant protein, and a preparation method and application thereof.

Background

Canine phagocytophilic anaplasmosis (anaplama phagocytophilum) is a blood pathogen caused by tick as a transmission medium, the disease caused by the blood pathogen is a common disease of humans and animals transmitted by the tick, the disease is caused by infecting animal peripheral blood neutrophils, and the clinical characteristics of the disease of animals are similar influenza-like symptoms such as fever, general malaise, anorexia, hypodynamia and the like.

Currently, the more direct clinical diagnosis methods include blood smear staining, Indirect fluorescent antibody assay (IFA), Enzyme-Linked immunosorbent assay (ELISA) and other immunological methods, and the PCR (polymerase chain reaction) method is also a detection method which is commonly used for diagnosing the anaplasma phagocytophilum and is most sensitive and highly specific for diagnosing the anaplasma phagocytophilum. However, the methods such as the immunofluorescence method, the enzyme-linked immunosorbent assay (ELISA), the Polymerase Chain Reaction (PCR) technology and the like require the use of designated instruments and equipment, have corresponding test conditions and skills, and are difficult to popularize at the basic level.

In the aspect of detecting an anaplasma phagocytophilum antibody, a small part of protein sequences are used for detecting the antibody in the current main direction of domestic and foreign researches, and the condition has a risk of missing detection.

Disclosure of Invention

In order to solve the technical problems, the technical scheme adopted by the invention is as follows:

the invention provides a dog phagocytophile anaplasma P44 recombinant protein, which comprises an amino acid sequence shown in SEQ ID NO. 1.

In the present invention, the recombinant protein is also called fusion protein or recombinant fusion protein, and is an expression product obtained by recombining two genes by a DNA recombination technique.

The P44 protein is a main immunogen protein of dog phagocytophile anaplasma, and can induce and start the immune system of the body to generate immune response. The invention carries out antibody detection on the P44 protein full-length sequence, not only can improve the diagnostic sensitivity, but also can reduce the cross reaction with other pathogens.

In some embodiments of the present invention, preferably, the recombinant protein consists of the amino acid sequence shown in SEQ ID No. 1.

In a second aspect, the present invention provides a gene encoding the recombinant protein according to the first aspect of the present invention, which comprises the nucleotide sequence shown in SEQ ID NO. 2.

The gene sequence is used for expressing the recombinant protein in the escherichia coli, and codons are optimized according to the preference of the escherichia coli to the codons. The frequency of usage of synonymous codons by different species is different and this codon preference has an impact on the translation process. If a mRNA has many rare codons clustered, this will have a negative effect on the rate of ribosome movement and greatly reduce the protein expression level. The gene sequence is subjected to codon optimization, and the method is suitable for escherichia coli expression and can improve the protein expression efficiency.

In a third aspect, the present invention provides an expression vector comprising the gene of the second aspect of the present invention.

In some embodiments of the invention, the expression vector is pET30a, which is kanamycin resistant and the expressed fusion protein has a histidine (His) tag.

In a fourth aspect, the present invention provides a host cell comprising an expression vector according to the third aspect of the invention.

Further, the host cell is a eukaryotic host cell or a prokaryotic host cell.

In some embodiments of the invention, the host cell is a prokaryotic host cell. Preferably, the host cell is escherichia coli, more preferably, escherichia coli is BL 21. The expression by using the escherichia coli has the advantages of short period, low cost, large expression amount and the like.

In a fifth aspect, the present invention provides a method for producing a recombinant protein according to the first aspect of the present invention, comprising the step of inducing the host cell according to the fourth aspect of the present invention to express the protein.

Further, the host cell is a eukaryotic host cell or a prokaryotic host cell.

In some embodiments of the invention, the host cell is a prokaryotic host cell. Preferably, the host cell is escherichia coli, more preferably, escherichia coli is BL 21. The expression by using the escherichia coli has the advantages of short period, low cost, large expression quantity and the like.

In some embodiments of the invention, the step of inducing E.coli to express the protein is:

s1, culturing the Escherichia coli in LB medium containing 50. mu.g/mL of kanamycin at 37 ℃,

s2, when the culture solution OD600 of the escherichia coli is 0.5-0.7, the induction expression is carried out by IPTG with the final concentration of 1mM, and the induction conditions are as follows: the rotation speed is 200rpm at 25 ℃ for 4 h; by using the induction condition, the recombinant protein can be more slowly expressed, and sufficient time is provided for the formation of space conformation, which plays an important role in the function of the recombinant protein.

S3, centrifuging the culture solution at 4 ℃ and 7000rpm for 10min, and collecting thalli;

s4, crushing the thallus by using a Buffer Binding Buffer;

s5, carrying out ultrasonic disruption on thalli under the conditions of: 550w, ultrasonic for 2s, and interval of 5s, and 80-120 times in total;

s6, centrifuging at 12000rpm at 4 ℃ for 30min, and collecting supernatant, wherein the recombinant protein is in the supernatant.

Preferably, the induction is performed in step S2 at an OD600 of the E.coli culture broth of 0.6.

Preferably, in step S5, the ultrasonication is performed 100 times. By adopting the crushing method, the condition that the recombinant protein is lost due to over violent crushing is avoided.

In some embodiments of the invention, further comprising the step of purifying the recombinant protein. The recombinant protein can be purified by various methods, such as ion exchange chromatography, gel filtration chromatography, and affinity chromatography. In some embodiments of the invention, the method of affinity chromatography is selected such that higher purity can be achieved in a single purification step due to the addition of the His-tag to the recombinant protein.

In some embodiments of the invention, the supernatant containing the recombinant protein is passed through a Ni column and then eluted with an Elution Buffer to obtain the desired protein.

Preferably, the formulation of the Elution Buffer solution Elution Buffer is as follows: 50mM Tris, 0.2M NaCl, 0.5M Imidazole, pH 8.0.

The sixth aspect of the invention provides the use of the recombinant protein according to the first aspect of the invention in the preparation of a kit for detecting an antibody to canine phagocytophile anaplasma.

The seventh aspect of the invention provides a kit for detecting an antibody against canine phagocytophil anaplasma, comprising the recombinant protein according to the first aspect of the invention.

Further, the kit also comprises mouse IgG and goat anti-mouse IgG.

In some embodiments of the invention, canine phagocytophil anaplasma antibodies are detected using a double antigen sandwich gold-labeling method.

In some embodiments of the invention, the kit comprises a double antigen sandwich gold-labeled test strip, and the reagent method of the test strip is as follows:

s1, preparing a recombinant protein colloidal gold compound and a mouse IgG colloidal gold compound respectively;

s2, mixing the recombinant protein colloidal gold compound and the mouse IgG colloidal gold compound to prepare a gold-labeled pad;

s3, marking on a nitrocellulose membrane by using the recombinant protein as a detection line and using goat anti-mouse IgG as a quality control line;

s4, mounting filter paper, a polyester plate containing a nitrocellulose membrane, a gold label pad and a sample pad on a bottom plate, wherein a part of the filter paper is overlapped and pressed on the polyester plate, a part of the polyester plate is overlapped and pressed on the gold label pad, a part of the gold label pad is overlapped and pressed on the sample pad, a test area and a quality control area are respectively arranged on the polyester plate, the test area is provided with a test line (T line), the quality control area is provided with a quality control line (C line), the test line is close to the gold label pad, and the quality control line is close to the filter paper, thus preparing the test strip.

When the kit is used, a dog biological sample is dripped to a sample pad, the detection result is judged after the kit is placed at room temperature for 10min, and the judgment standard is as follows:

two strips appear, wherein one strip is positioned in a quality control area, and the other strip is positioned in a test area and is positive;

secondly, only one strip appears on the quality control line, no strip appears in the test area, and the test area is negative;

and thirdly, the quality control line has no strip, which indicates that the test strip is damaged, and the test strip is replaced with a new test strip for retesting no matter whether the detection line has the strip or not.

In some embodiments of the invention, a canine phagocytophil anaplasma antibody test that is positive indicates that the canine phagocytophil anaplasma antibody is present in the canine biological sample, meaning that the canine has or has been infected with canine phagocytophil anaplasma.

In some embodiments of the invention, the biological sample is serum or plasma, or any other body fluid that may contain antibodies.

The invention has the advantages of

Compared with the prior art, the invention has the following beneficial effects:

the P44 protein is a main immunogenic antigen of dog phagocytophile anaplasma and is highly conserved, can induce and start an organism immune system to generate immune response, and induce host cells to generate neutralizing antibodies, so that the P44 protein full-length sequence is subjected to antibody detection, the diagnostic sensitivity can be improved, cross reaction with other pathogens can be reduced, the specificity is strong, and the protein has great clinical significance and wide application prospect.

The colloidal gold-labeled immunoassay method adopted by the invention is a novel analysis technology, has the characteristics of rapidness, simplicity, convenience, low cost, no pollution and no need of training, is more suitable for field detection compared with the traditional method, has the advantages of short color development time, no need of expensive instruments and the like, and has wide market prospect and application value.

Drawings

FIG. 1 shows the results of gel electrophoresis of the purification of dog phagocytophile anaplasma P44 fusion protein. 1: protein marker (YEASEN, cat # 20313ES 76); 2: loading the sample after cell disruption; 3: flow through; 4: 50mM Imidazole elution; 5: 0.5M Imidazole.

FIG. 2 shows a reagent diagram of a test strip according to one embodiment of the present invention. 1: a sample pad; 2: a gold label pad; 3: NC film; 31: a detection line (T-line); 32: a quality control line (line C); 4: filtering paper; 5: a base plate.

FIG. 3 is a diagram showing the results of detection using the test strip according to one embodiment of the present invention. T: detection line, C: and (4) quality control line.

Fig. 4 shows the overall results of the test strip of the present invention on clinical canine serum samples.

Detailed Description

In order to make the technical problems, technical solutions and advantageous effects solved by the present invention more apparent, the present invention is further described in detail below with reference to the following embodiments.

Examples

The following examples are used herein to demonstrate preferred embodiments of the invention. It will be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function in the invention, and thus can be considered to constitute preferred modes for its practice. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit or scope of the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and the disclosures and references cited herein and the materials to which they refer are incorporated by reference.

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

The experimental procedures in the following examples are conventional unless otherwise specified. The instruments used in the following examples are, unless otherwise specified, laboratory-standard instruments; the test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

Example 1 construction of Gene expression vector for fusion protein of dog phagocytophilic cell anaplasma P44

The dog phagocytophil anaplasma P44 Gene was designed based on the protein sequence of NCBI Gene bank: WP _ 011451309.

The amino acid sequence of the P44 recombinant protein fusion protein is as follows (SEQ ID NO. 1):

MMSLAIVMAGNDVRAHDDVSALDTGGAGYFYVGLDYSPAFSKIRDFSIRESNGETKAVYPYLKDGKSVKLESHKFDWNTPDPRIGFKDNMLVAMEGSVGYGIGGARVELEIGYERFKTKGIRDSGSKEDEADTVYLLAKELAYDVVTGQTDKLTAALAKTSGKDIVQFANAVKITNSTIDGKVCSGKHAALVPNKGKDYDADAKESNTNAHKTAQCSGLADSAATGPKSFSGFVGAVKVGEGKNWPTGRAASATSNETVVGPTNSNATAVAKDLVALNSDEKTIVAGLLAKTIEGGEVVEIRAVSSTSVMVNACYDLLSEGLGVVPYACVGLGGNFVGVVDGHITPKLAYRLKAGLSYQLSPEISAFAGGFYHRVVGDGVYDDLPAQRLVDDTSPAGRTKDTAIANFSMAYVGGEFGVRFAF

since the frequency of usage of synonymous codons is different for different species, this codon preference has an impact on the translation process. If a mRNA has many rare codons clustered, this will have a negative effect on the rate of ribosome movement and greatly reduce the protein expression level.

In the invention, escherichia coli is used as an expression system, in order to obtain higher expression efficiency and higher expression quantity, codon optimization is carried out during the expression of foreign protein, and the foreign protein is reversely translated into a nucleotide sequence, wherein the obtained nucleotide sequence is as follows (SEQ ID NO. 2):

ATGATGAGCCTGGCGATTGTGATGGCGGGCAACGATGTGCGCGCGCATGATGATGTGAGCGCGCTGGATACCGGCGGCGCGGGCTATTTTTATGTGGGCCTGGATTATAGCCCGGCGTTTAGCAAAATTCGCGATTTTAGCATTCGCGAAAGCAACGGCGAAACCAAAGCGGTGTATCCGTATCTGAAAGATGGCAAAAGCGTGAAACTGGAAAGCCATAAATTTGATTGGAACACCCCGGATCCGCGCATTGGCTTTAAAGATAACATGCTGGTGGCGATGGAAGGCAGCGTGGGCTATGGCATTGGCGGCGCGCGCGTGGAACTGGAAATTGGCTATGAACGCTTTAAAACCAAAGGCATTCGCGATAGCGGCAGCAAAGAAGATGAAGCGGATACCGTGTATCTGCTGGCGAAAGAACTGGCGTATGATGTGGTGACCGGCCAGACCGATAAACTGACCGCGGCGCTGGCGAAAACCAGCGGCAAAGATATTGTGCAGTTTGCGAACGCGGTGAAAATTACCAACAGCACCATTGATGGCAAAGTGTGCAGCGGCAAACATGCGGCGCTGGTGCCGAACAAAGGCAAAGATTATGATGCGGATGCGAAAGAAAGCAACACCAACGCGCATAAAACCGCGCAGTGCAGCGGCCTGGCGGATAGCGCGGCGACCGGCCCGAAAAGCTTTAGCGGCTTTGTGGGCGCGGTGAAAGTGGGCGAAGGCAAAAACTGGCCGACCGGCCGCGCGGCGAGCGCGACCAGCAACGAAACCGTGGTGGGCCCGACCAACAGCAACGCGACCGCGGTGGCGAAAGATCTGGTGGCGCTGAACAGCGATGAAAAAACCATTGTGGCGGGCCTGCTGGCGAAAACCATTGAAGGCGGCGAAGTGGTGGAAATTCGCGCGGTGAGCAGCACCAGCGTGATGGTGAACGCGTGCTATGATCTGCTGAGCGAAGGCCTGGGCGTGGTGCCGTATGCGTGCGTGGGCCTGGGCGGCAACTTTGTGGGCGTGGTGGATGGCCATATTACCCCGAAACTGGCGTATCGCCTGAAAGCGGGCCTGAGCTATCAGCTGAGCCCGGAAATTAGCGCGTTTGCGGGCGGCTTTTATCATCGCGTGGTGGGCGATGGCGTGTATGATGATCTGCCGGCGCAGCGCCTGGTGGATGATACCAGCCCGGCGGGCCGCACCAAAGATACCGCGATTGCGAACTTTAGCATGGCGTATGTGGGCGGCGAATTTGGCGTGCGCTTTGCGTTT

a recombinant gene sequence is synthesized by the company of Biotechnology engineering (Shanghai) and is connected with pET30a plasmid to form a recombinant expression vector.

Example 2 expression of the Canine phagocytophilic cell anaplasma P44 fusion protein

The dog phagocytophile anaplasma P44 fusion gene plasmid was transformed into Escherichia coli BL21, spread on LB plate containing 50. mu.g/mL kanamycin (Shanghai Producer, cat # K0408), cultured overnight at 37 ℃, a single colony was picked up, cultured with 300mL of LB medium containing the same concentration of kanamycin at 37 ℃ until OD600 reached about 0.6, and induced to express with 1mM IPTG (Shanghai Producer, cat # IB0168) at the final concentration under the following conditions: 25 ℃ and a rotation speed of 200rpm for 4 h. After induction, the culture broth was centrifuged at 4 ℃ and 7000rpm for 10min to collect the cells.

Example 3 purification and renaturation of the fusion protein of dog phagocytophilic cell anaplasma P44

Crushing the thallus by 50mL of loading Buffer Binding Buffer (50mM Tris, 0.2M NaCl, pH8.0); then carrying out ultrasonic crushing for 100 times with the conditions of 550w, 2s of ultrasonic treatment and 5s interval; finally, the supernatant is collected by centrifugation at 12000rpm for 30min at 4 ℃, and the target protein is in the supernatant. Then, the mixture was further purified by Ni column chromatography, and the desired protein was eluted with Elution Buffer (50mM Tris, 0.2M NaCl, 0.5M Imidazole, pH 8.0). The target protein was detected by PAGE gel electrophoresis, and the results are shown in FIG. 1.

As is clear from FIG. 1, the purified fusion protein was very pure, and the purified recombinant protein was dialyzed against dialysis buffer (50mM Tris, 0.2M NaCl, pH8.0) and the dialysis solution was changed every 12 hours for 3 times. The protein solution after dialysis was taken out, filtered through a 0.22 μm filter, measured for concentration by BCA method, and stored at-20 ℃ for further use.

Example 4 detection of Canine phagocytophilic anaplasma antibodies by double antigen sandwich gold-labeling method

Preparation of 1 double-antigen sandwich gold-labeled detection strip

1.1 firing of colloidal gold

1000mL of ultrapure water is added into a triangular flask, the triangular flask is heated to boiling on a magnetic heating stirrer, then 4mL of 10% chloroauric acid (sigma) is added, 6mL of 10% trisodium citrate solution is added, the heating and boiling are continued for 5min, then the triangular flask is cooled to room temperature, colloidal gold is filtered by a 0.22 mu m filter, and the triangular flask is placed at 4 ℃ for standby.

1.2 labeling of recombinant canine phagocytophil anaplasma P44 fusion protein

Putting 100mL of colloidal gold solution into a beaker, and adding 0.2M K into the beaker with stirring₂CO₃Adjusting the pH value of the gold water to 6.5, adding 1.2mg of purified recombinant canine phagocytosis cell anaplasma P44 fusion protein after stirring, stirring for 15min at room temperature, adding 1mL of 10% BSA solution, stirring for 15min at room temperature, then centrifuging for 10min at 12000rpm, carefully sucking out the supernatant, discarding, and diluting the precipitate to 1mL with a gold-labeled diluent (20mM Tris, 1% BSA, 0.03% Proclin300, pH8.0), thus obtaining the labeled recombinant canine phagocytosis cell anaplasma P44 fusion protein colloidal gold complex.

1.3 murine IgG markers

Putting 100mL of colloidal gold solution into a beaker, and adding 0.2M K into the beaker with stirring₂CO₃The pH of the gold solution was adjusted to 7.0, and after stirring, 1mg of mouse IgG (Hangzhou Longji Biotechnology Co., Ltd., cat # AS00901) was added, and after stirring at room temperature for 15min, 1mL of 10% BSA solution was added, and after stirring at room temperature for 15min, centrifugation was carried out at 12000rpm for 10min, the supernatant was carefully aspirated and discarded, and the precipitate was diluted to 1mL with a gold-labeled diluent (20mM Tris, 1% BSA, 0.03% Proclin300, pH8.0) to obtain a volume of 1mL, which was a labeled mouse IgG colloidal gold complex.

And (3) diluting the gold-labeled compound by a gold-labeled diluent by 100 times, mixing the diluted gold-labeled compound with the dog phagocytophile anaplasma P44 fusion protein colloidal gold compound diluted in the step 1.2, soaking the glass fiber in the mixture, and drying the mixture at 37 ℃ for 4 hours to obtain the gold-labeled pad.

1.4 punctum membranes of recombinant canine phagocytophil anaplasma P44 fusion protein

Diluting the purified P44 fusion protein with a spotting diluent (50mM Tris, 2% sucrose, pH8.5) to 1.2mg/mL as a detection Line (Test-Line, T Line) of a colloidal gold Test strip, diluting goat anti-mouse IgG (Hangzhou Longji Biotechnology limited, Cat: PS00901) with the same diluent to 0.3mg/mL as a quality Control Line (Control-Line, C Line) of the colloidal gold Test strip, streaking the two diluted solutions onto a nitrocellulose membrane, and drying at 37 ℃ overnight.

1.5 Assembly of test strip for detecting dog phagocytophilic cell anaplasma antibody by double-antigen sandwich gold-labeling method

The gold label pad, the coated raw materials are arranged on a polyester plate of a nitrocellulose membrane (NC membrane), filter paper, a sample pad and other installation base plates to assemble the test paper strip for detecting the canine phagocytophilic anaplasma antibody by the double-antigen sandwich method. The specific installation manner is shown in fig. 2: the sample pad 1, the gold label pad 2, the NC membrane 3, and the filter paper 4 are mounted on the base plate 5, respectively. Wherein a part of the sample pad 1 is superposed and pressed on the gold label pad 2, a part of the gold label pad 2 is superposed and pressed on the NC membrane 3, and a part of the filter paper 4 is superposed and pressed on the NC membrane 3. The NC membrane 3 is divided into a test area and a quality control area, the test area is provided with a detection line 31(T line), the quality control area is provided with a quality control line 32(C line), the detection line 31 is close to the gold mark pad 2, and the quality control line 32 is close to the filter paper 4.

Further, the assembled test paper strip is cut into strips with the length of 3mm by a slitter, and then the strips are put into a specially made plastic card, so that the mature detection reagent card is formed.

2 detection of canine phagocytophil anaplasma antibody test paper strip/card by double-antigen sandwich gold-labeling method

Adding 90 μ L of sample (canine serum, plasma) to be detected to sample application position (S), standing at room temperature for 10min, and determining the result according to the following criteria (as shown in FIG. 3):

fourthly, two strips appear, wherein one strip is positioned in the quality control area, and the other strip is positioned in the test area and is positive;

only one strip appears on the quality control line, no strip appears in the test area, and the result is negative;

sixthly, no strip appears on the quality control line, which indicates that the test strip is damaged, and the test strip is replaced by a new test strip for retesting whether the detection line has a strip or not.

3 detection result of test strip/card for detecting dog phagocytophilic anaplasma antibody by double-antigen sandwich gold-labeling method

A total of 15 canine serum positive for the anaplasma infection of canine phagocytophiles (sample No. 1-15) and 50 normal uninfected canine serum (sample No. 16-65) were tested, wherein the test results were positive for the two lines of T and C, and negative for the one line of C.

The results are shown in table 1: positive 15 out of 15 positive sera, 0 missing, and 2 false positive out of 50 negative sera (sample No. 26 and sample No. 49).

TABLE 1 detection results of canine phagocytophil anaplasma antibodies

From this, it was found that the sensitivity and specificity of the sample detection were 100% and 96%, respectively, and the overall coincidence rate was 96.9%, as shown in fig. 4.

The results show that the recombinant canine phagocytophile anaplasma P44 fusion protein for detecting the canine phagocytophile anaplasma has very high sensitivity and specificity, can be used as a raw material for manufacturing a canine phagocytophile anaplasma antibody detection test strip, and can be widely applied to clinical detection.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Hangzhou Yiminou Biotechnology Ltd

<120> canine phagocytophilic cell anaplasma P44 recombinant protein, and preparation method and application thereof

<130> AJ2010244

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 422

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Met Ser Leu Ala Ile Val Met Ala Gly Asn Asp Val Arg Ala His

1 5 10 15

Asp Asp Val Ser Ala Leu Asp Thr Gly Gly Ala Gly Tyr Phe Tyr Val

20 25 30

Gly Leu Asp Tyr Ser Pro Ala Phe Ser Lys Ile Arg Asp Phe Ser Ile

35 40 45

Arg Glu Ser Asn Gly Glu Thr Lys Ala Val Tyr Pro Tyr Leu Lys Asp

50 55 60

Gly Lys Ser Val Lys Leu Glu Ser His Lys Phe Asp Trp Asn Thr Pro

65 70 75 80

Asp Pro Arg Ile Gly Phe Lys Asp Asn Met Leu Val Ala Met Glu Gly

85 90 95

Ser Val Gly Tyr Gly Ile Gly Gly Ala Arg Val Glu Leu Glu Ile Gly

100 105 110

Tyr Glu Arg Phe Lys Thr Lys Gly Ile Arg Asp Ser Gly Ser Lys Glu

115 120 125

Asp Glu Ala Asp Thr Val Tyr Leu Leu Ala Lys Glu Leu Ala Tyr Asp

130 135 140

Val Val Thr Gly Gln Thr Asp Lys Leu Thr Ala Ala Leu Ala Lys Thr

145 150 155 160

Ser Gly Lys Asp Ile Val Gln Phe Ala Asn Ala Val Lys Ile Thr Asn

165 170 175

Ser Thr Ile Asp Gly Lys Val Cys Ser Gly Lys His Ala Ala Leu Val

180 185 190

Pro Asn Lys Gly Lys Asp Tyr Asp Ala Asp Ala Lys Glu Ser Asn Thr

195 200 205

Asn Ala His Lys Thr Ala Gln Cys Ser Gly Leu Ala Asp Ser Ala Ala

210 215 220

Thr Gly Pro Lys Ser Phe Ser Gly Phe Val Gly Ala Val Lys Val Gly

225 230 235 240

Glu Gly Lys Asn Trp Pro Thr Gly Arg Ala Ala Ser Ala Thr Ser Asn

245 250 255

Glu Thr Val Val Gly Pro Thr Asn Ser Asn Ala Thr Ala Val Ala Lys

260 265 270

Asp Leu Val Ala Leu Asn Ser Asp Glu Lys Thr Ile Val Ala Gly Leu

275 280 285

Leu Ala Lys Thr Ile Glu Gly Gly Glu Val Val Glu Ile Arg Ala Val

290 295 300

Ser Ser Thr Ser Val Met Val Asn Ala Cys Tyr Asp Leu Leu Ser Glu

305 310 315 320

Gly Leu Gly Val Val Pro Tyr Ala Cys Val Gly Leu Gly Gly Asn Phe

325 330 335

Val Gly Val Val Asp Gly His Ile Thr Pro Lys Leu Ala Tyr Arg Leu

340 345 350

Lys Ala Gly Leu Ser Tyr Gln Leu Ser Pro Glu Ile Ser Ala Phe Ala

355 360 365

Gly Gly Phe Tyr His Arg Val Val Gly Asp Gly Val Tyr Asp Asp Leu

370 375 380

Pro Ala Gln Arg Leu Val Asp Asp Thr Ser Pro Ala Gly Arg Thr Lys

385 390 395 400

Asp Thr Ala Ile Ala Asn Phe Ser Met Ala Tyr Val Gly Gly Glu Phe

405 410 415

Gly Val Arg Phe Ala Phe

420

<210> 2

<211> 1266

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgatgagcc tggcgattgt gatggcgggc aacgatgtgc gcgcgcatga tgatgtgagc 60

gcgctggata ccggcggcgc gggctatttt tatgtgggcc tggattatag cccggcgttt 120

agcaaaattc gcgattttag cattcgcgaa agcaacggcg aaaccaaagc ggtgtatccg 180

tatctgaaag atggcaaaag cgtgaaactg gaaagccata aatttgattg gaacaccccg 240

gatccgcgca ttggctttaa agataacatg ctggtggcga tggaaggcag cgtgggctat 300

ggcattggcg gcgcgcgcgt ggaactggaa attggctatg aacgctttaa aaccaaaggc 360

attcgcgata gcggcagcaa agaagatgaa gcggataccg tgtatctgct ggcgaaagaa 420

ctggcgtatg atgtggtgac cggccagacc gataaactga ccgcggcgct ggcgaaaacc 480

agcggcaaag atattgtgca gtttgcgaac gcggtgaaaa ttaccaacag caccattgat 540

ggcaaagtgt gcagcggcaa acatgcggcg ctggtgccga acaaaggcaa agattatgat 600

gcggatgcga aagaaagcaa caccaacgcg cataaaaccg cgcagtgcag cggcctggcg 660

gatagcgcgg cgaccggccc gaaaagcttt agcggctttg tgggcgcggt gaaagtgggc 720

gaaggcaaaa actggccgac cggccgcgcg gcgagcgcga ccagcaacga aaccgtggtg 780

ggcccgacca acagcaacgc gaccgcggtg gcgaaagatc tggtggcgct gaacagcgat 840

gaaaaaacca ttgtggcggg cctgctggcg aaaaccattg aaggcggcga agtggtggaa 900

attcgcgcgg tgagcagcac cagcgtgatg gtgaacgcgt gctatgatct gctgagcgaa 960

ggcctgggcg tggtgccgta tgcgtgcgtg ggcctgggcg gcaactttgt gggcgtggtg 1020

gatggccata ttaccccgaa actggcgtat cgcctgaaag cgggcctgag ctatcagctg 1080

agcccggaaa ttagcgcgtt tgcgggcggc ttttatcatc gcgtggtggg cgatggcgtg 1140

tatgatgatc tgccggcgca gcgcctggtg gatgatacca gcccggcggg ccgcaccaaa 1200

gataccgcga ttgcgaactt tagcatggcg tatgtgggcg gcgaatttgg cgtgcgcttt 1260

gcgttt 1266

Claims

1. A dog phagocytophile anaplasma P44 recombinant protein, which is characterized by comprising an amino acid sequence shown in SEQ ID NO. 1.

2. The recombinant protein according to claim 1, consisting of the amino acid sequence shown in SEQ ID No. 1.

3. A gene encoding the recombinant protein of claim 1 or 2, comprising the nucleotide sequence of SEQ ID No. 2.

4. An expression vector comprising the gene of claim 3.

5. A host cell comprising the expression vector of claim 4.

6. A method for producing a recombinant protein according to claim 1 or 2, comprising the step of inducing the host cell according to claim 3 to express the protein.

7. The method of claim 6, wherein the expression vector is pET30a and the host cell is E.coli.

8. The method of claim 7, wherein the step of inducing the host cell to express the protein comprises:

s2, when the culture solution OD600 of the escherichia coli is 0.5-0.7, the induction expression is carried out by IPTG with the final concentration of 1mM, and the induction conditions are as follows: the rotation speed is 200rpm at 25 ℃ for 4 h;

s4, crushing the thallus by using a Buffer Binding Buffer;

9. Use of the recombinant protein of claim 1 or 2 for the preparation of a kit for the detection of canine phagocytophile anaplasma antibodies.

10. A kit for detecting an antibody against canine phagocytophile anaplasma, comprising the recombinant protein of claim 1 or 2.