CN112321722A

CN112321722A - Cat calicivirus VP1-VP2 recombinant protein and preparation method and application thereof

Info

Publication number: CN112321722A
Application number: CN202011271159.9A
Authority: CN
Inventors: 李晓光
Original assignee: Hangzhou Immuno Biotech Co ltd
Current assignee: Hangzhou Immuno Biotech Co ltd
Priority date: 2020-11-13
Filing date: 2020-11-13
Publication date: 2021-02-05

Abstract

The invention discloses a feline calicivirus VP1-VP2 recombinant protein, and belongs to the field of animal virus antibody detection. The recombinant protein comprises an amino acid sequence shown by SEQ ID NO.1 or an amino acid sequence shown by SEQ ID NO. 1. The invention further discloses a gene of the recombinant protein, a vector and a host cell containing the gene, a preparation method of the recombinant protein and application of the recombinant protein in detection of feline calicivirus antibodies. The recombinant protein is used for detecting the feline calicivirus, is convenient and rapid, has high sensitivity, no cross reaction with other pathogens, strong specificity, great clinical significance and wide application prospect.

Description

Cat calicivirus VP1-VP2 recombinant protein and preparation method and application thereof

Technical Field

The invention belongs to the field of animal virus antibody detection, and particularly relates to a feline calicivirus VP1-VP2 recombinant protein, and a preparation method and application thereof.

Background

Feline Calicivirus (Fcv) is a common pathogen in felines, can infect through the oral and nasal pathways, mainly proliferates in oral and respiratory tract tissues, can cause upper respiratory tract and oral lesions of cats due to FCV infection alone or in combination with other pathogens, and clinically comprises sneeze, ocular and nasal bleeding, conjunctivitis, stomatitis, gingivitis and oral ulcer, and further causes pneumonia, claudication, abortion, chronic gastroenteritis, skin edema and ulcer in severe cases. Feline calicivirus infection is a frequently encountered disease in cats, with high morbidity and low mortality. FCV is very similar to symptoms caused by infection with feline herpes virus and the like, and can cause a plurality of complicated atypical symptoms, and the pathogeny is difficult to diagnose from clinical symptoms alone, and the diagnosis needs to be confirmed by combining laboratory diagnosis. Current laboratory diagnostics for FCV include virus isolation, nucleic acid testing, and serological testing.

Detection methods using virus isolation can become difficult. Although virus isolation is the most reliable method of detection, it is time consuming. The methods such as immunofluorescence, enzyme-linked immunosorbent assay (ELISA), Polymerase Chain Reaction (PCR) and the like need to use designated instruments and equipment and have corresponding test conditions and skills, and are difficult to popularize at the basic level. The colloidal gold labeling immunoassay is a novel analysis technology which is started and developed rapidly in recent years, and has the characteristics of rapidness, simplicity, convenience, low cost, no pollution, simple operation, no need of professional knowledge of operators, and more suitability for field detection compared with the traditional method. Compared with ELISA, the method has the advantages of short color development time, no need of expensive instruments and the like, and has wide market prospect and application value.

Most cats normally have the highest levels of antibodies in vivo three weeks after infection with feline herpesvirus, and then have a rapid decline in antibody levels in vivo, so it is retrospectively diagnostic to use serological tests to measure neutralizing antibody titers in duplicate sera during the acute phase of FCV infection and after recovery.

However, current detection methods and tools for detecting FCV infection in serological assays still have major limitations.

Disclosure of Invention

In order to solve the technical problems, the technical scheme adopted by the invention is as follows:

the invention provides a feline calicivirus VP1-VP2 recombinant protein, which comprises an amino acid sequence shown in SEQ ID NO. 1.

VP1 and VP2 are derived from the FCV structural protein of the FCV virus, the capsid protein. The capsid protein 42 and VP2 coded by ORF2(Open Reading Frame, ORF, Open Reading Frame) is divided into A-F6 area, A area is located at amino terminal 1-120aa, B area is located at 121-396 aa, C area is located at 397-401 aa, D area is located at 402-425 aa and is highly conserved area, E area is located at 426-520 aa, F area is located at 521-668 aa and is highly conserved carboxyl end of capsid protein, and the area is located on the surface of virus.

In some embodiments of the present invention, preferably, the recombinant protein consists of the amino acid sequence shown in SEQ ID No. 1.

In a second aspect, the present invention provides a gene encoding the recombinant protein according to the first aspect of the present invention, which comprises the nucleotide sequence shown in SEQ ID NO. 2.

The gene sequence is used for expressing the recombinant protein in the escherichia coli, and codons are optimized according to the preference of the escherichia coli to the codons.

In a third aspect, the present invention provides an expression vector comprising the gene of the second aspect of the present invention.

In some embodiments of the invention, the expression vector is pET30a, which is kanamycin resistant and the expressed fusion protein has a histidine (His) tag.

In a fourth aspect, the present invention provides a host cell comprising an expression vector according to the third aspect of the invention.

Further, the host cell is a eukaryotic host cell or a prokaryotic host cell.

In some embodiments of the invention, the host cell is a prokaryotic host cell. Preferably, the host cell is E.coli. The expression by using the escherichia coli has the advantages of short period, low cost, large expression amount and the like.

In a fifth aspect, the present invention provides a method for producing a recombinant protein according to the first aspect of the present invention, comprising the step of inducing the host cell according to the fourth aspect of the present invention to express the protein.

Further, the host cell is a eukaryotic host cell or a prokaryotic host cell.

In some embodiments of the invention, the host cell is a prokaryotic host cell. Preferably, the host cell is E.coli. The expression by using the escherichia coli has the advantages of short period, low cost, large expression quantity and the like.

In some embodiments of the invention, the step of inducing E.coli to express the protein is:

s1, culturing the Escherichia coli in LB medium containing 50. mu.g/mL of kanamycin at 37 ℃,

s2, when the culture solution OD600 of the escherichia coli is 0.5-0.7, the induction expression is carried out by IPTG with the final concentration of 1mM, and the induction conditions are as follows: the rotation speed is 200rpm at 25 ℃ for 4 h;

s3, centrifuging the culture solution at 4 ℃ and 7000rpm for 10min, and collecting thalli;

s4, crushing the thallus by using a Buffer Binding Buffer;

s5, carrying out ultrasonic disruption on thalli under the conditions of: 500w, 2s of ultrasound and 5s of interval, and the total time is 80-120 times;

s6, centrifuging at 12000rpm at 4 ℃ for 30min, and collecting supernatant, wherein the recombinant protein is in the supernatant.

Preferably, the induction is performed in step S2 at an OD600 of the E.coli culture broth of 0.6.

Preferably, in step S5, the ultrasonication is performed 100 times. By adopting the crushing method, the condition that the recombinant protein is lost due to over violent crushing is avoided.

In some embodiments of the invention, further comprising the step of purifying the recombinant protein. The recombinant protein can be purified by various methods, such as ion exchange chromatography, gel filtration chromatography, and affinity chromatography. In some embodiments of the invention, the method of affinity chromatography is selected such that higher purity can be achieved in a single purification step due to the addition of the His-tag to the recombinant protein.

In some embodiments of the invention, the supernatant containing the recombinant protein is passed through a Ni column and then eluted with an Elution Buffer to obtain the desired protein.

Preferably, the formulation of the Elution Buffer solution Elution Buffer is as follows: 50mM Tris, 0.2M NaCl, 0.5M Imidazole, pH 8.0.

A sixth aspect of the invention provides the use of a recombinant protein according to the first aspect of the invention in the manufacture of a kit for the detection of feline calicivirus antibodies.

In a seventh aspect, the invention provides a kit for detecting feline calicivirus antibodies comprising a recombinant protein according to the first aspect of the invention.

Further, the kit also comprises mouse IgG and goat anti-mouse IgG.

In some embodiments of the invention, feline calicivirus antibodies are detected using a double antigen sandwich gold-labeling method.

In some embodiments of the invention, the kit comprises a double antigen sandwich gold-labeled test strip, and the reagent method of the test strip is as follows:

s1, preparing a recombinant protein colloidal gold compound and a mouse IgG colloidal gold compound respectively;

s2, mixing the recombinant protein colloidal gold compound and the mouse IgG colloidal gold compound to prepare a gold-labeled pad;

s3, marking on a nitrocellulose membrane by using the recombinant protein as a detection line and using goat anti-mouse IgG as a quality control line;

s4, mounting filter paper, a polyester plate containing a nitrocellulose membrane, a gold label pad and a sample pad on a bottom plate, wherein a part of the filter paper is overlapped and pressed on the polyester plate, a part of the polyester plate is overlapped and pressed on the gold label pad, a part of the gold label pad is overlapped and pressed on the sample pad, a test area and a quality control area are respectively arranged on the polyester plate, the test area is provided with a test line (T line), the quality control area is provided with a quality control line (C line), the test line is close to the gold label pad, and the quality control line is close to the filter paper, thus preparing the test strip.

When the kit is used, a biological sample is dripped to a sample pad, and the detection result is judged after the kit is placed at room temperature for 10min, wherein the judgment standard is as follows:

firstly, only one strip appears on the quality control line, no strip appears in the test area, and the test area is negative;

two strips appear, wherein one strip is positioned in the quality control area, and the other strip is positioned in the test area and is positive;

and thirdly, the quality control line has no strip, which indicates that the test strip is damaged, and the test strip should be replaced with a new test strip for retesting.

In some embodiments of the invention, a positive FCV antibody test indicates that the biological sample of the subject contains FCV antibodies, meaning that the subject has or has been infected with FCV.

In some embodiments of the invention, the biological sample is serum or plasma, or any other body fluid that may contain antibodies.

The invention has the advantages of

Compared with the prior art, the invention has the following beneficial effects:

the prior art mainly focuses on the C, D and E regions of VP1, and no antibody diagnostic reagent is developed for VP1 gene region and VP 2. In order to prevent the phenomenon of omission in antibody diagnosis, the VP1 and VP2 are fused together for prokaryotic expression. Since the A region of VP1 is cut off after VP1 is mature, the inventor fuses the B, C, D, E, F regions of VP1 and VP2, and fills the technical gap.

The invention utilizes the recombinant protein to detect the FCV antibody, can improve the sensitivity of diagnosis, can reduce cross reaction with other pathogens, has strong specificity, and has great clinical significance and wide application prospect.

Drawings

FIG. 1 shows the results of gel electrophoresis of the purification of feline calicivirus VP1-VP2 fusion protein. 1: protein marker (YEASEN, cat # 20313ES 76); 2: loading the sample after cell disruption; 3: flow through; 4: 50mM Imidazole elution; 5: 0.5M Imidazole.

FIG. 2 shows a reagent map of a test strip according to one embodiment of the present invention. 1: filtering paper; 2: a polyester sheet; 21: a detection line (T); 22: a quality control line (C); 3: a gold label pad; 4: a sample pad; 5: a base plate.

FIG. 3 is a schematic diagram showing the results of an assay using a test strip according to one embodiment of the present invention. A: negative; b: positive, S: sample pad, T: detection line, C: quality control line, FCV: feline calicivirus.

FIG. 4 shows the results of a clinical specimen test using a test strip according to one embodiment of the present invention. S: sample pad, T: detection line, C: quality control line, FCV: feline calicivirus.

Detailed Description

In order to make the technical problems, technical solutions and advantageous effects solved by the present invention more apparent, the present invention is further described in detail below with reference to the following embodiments.

Examples

The following examples are used herein to demonstrate preferred embodiments of the invention. It will be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function in the invention, and thus can be considered to constitute preferred modes for its practice. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit or scope of the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs and the disclosures and references cited herein and the materials to which they refer are incorporated by reference.

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

The experimental procedures in the following examples are conventional unless otherwise specified. The instruments used in the following examples are, unless otherwise specified, laboratory-standard instruments; the test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

Example 1 construction of Gene expression vector containing feline Calicivirus VP1-VP2 fusion protein

The feline calicivirus VP1 Gene is based on NCBI Gene bank: the protein sequence of P27406.1. The VP2 Gene is based on NCBI Gene bank: the protein sequence of ALM55430 is designed.

The amino acid sequence of the VP1-VP2 recombinant protein is as follows (SEQ ID NO. 1):

ADDGSITAPEQGTMVGGVIAEPSAQMSTAADMATGKSVDSEWEAFFSFHTSVNWSTSETQGKILFKQSLGPLLNPYLEHLAKLYVAWSGSIEVRFSISGSGVFGGKLAAIVVPPGVDPVQSTSMLQYPHVLFDARQVEPVIFCLPDLRSTLYHLMSDTDTTSLVIMVYNDLINPYANDANSSGCIVTVETKPGPDFKFHLLKPPGSMLTHGSIPSDLIPKTSSLWIGNRYWSDITDFVIRPFVFQANRHFDFNQETAGWSTPRFRPISVTITEQNGAKLGIGVATDYIVPGIPDGWPDTTIPGELIPAGDYAITNGTGNDITTATGYDTADIIKNNTNFRGMYICGSLQRAWGDKKISNTAFITTATLDGDNNNKINPCNTIDQSKIVVFQDNHVGKKAQTSDDTLALLGYTGIGEQAIGSDRDRVVRISTLPETGARGGNHPIFYKNSIKLGYVIRSIDVFNSQILHTSRQLSLNHYLLPPDSFAVYRIIDSNGSWFDIGIDSDGFSFVGVSGFGKLEFPLSASYMGIQLAKIRLASNIRSPMTKLMNSILGLIDTVTNTIGKAQQIELDKAALGQQRELALQRMNLDRQALNNQVEQFNKLLEQRVQGPIQSVRLARAAGFRVDPYSYTNQNFYDDQLNAIRLSYRNLFKI

the recombinant protein is obtained by fusing the B, C, D, E, F region of VP1 and VP 2.

Since the frequency of usage of synonymous codons is different for different species, this codon preference has an impact on the translation process. If a mRNA has many rare codons clustered, this will have a negative effect on the rate of ribosome movement and greatly reduce the protein expression level.

In the invention, escherichia coli is used as an expression system, in order to obtain higher expression efficiency and higher expression quantity, codon optimization is carried out during the expression of foreign protein, and the foreign protein is reversely translated into a nucleotide sequence, wherein the obtained nucleotide sequence is as follows (SEQ ID NO. 2):

GCGGATGATGGCAGCATTACCGCGCCGGAACAGGGCACCATGGTGGGCGGCGTGATTGCGGAACCGAGCGCGCAGATGAGCACCGCGGCGGATATGGCGACCGGCAAAAGCGTGGATAGCGAATGGGAAGCGTTTTTTAGCTTTCATACCAGCGTGAACTGGAGCACCAGCGAAACCCAGGGCAAAATTCTGTTTAAACAGAGCCTGGGCCCGCTGCTGAACCCGTATCTGGAACATCTGGCGAAACTGTATGTGGCGTGGAGCGGCAGCATTGAAGTGCGCTTTAGCATTAGCGGCAGCGGCGTGTTTGGCGGCAAACTGGCGGCGATTGTGGTGCCGCCGGGCGTGGATCCGGTGCAGAGCACCAGCATGCTGCAGTATCCGCATGTGCTGTTTGATGCGCGCCAGGTGGAACCGGTGATTTTTTGCCTGCCGGATCTGCGCAGCACCCTGTATCATCTGATGAGCGATACCGATACCACCAGCCTGGTGATTATGGTGTATAACGATCTGATTAACCCGTATGCGAACGATGCGAACAGCAGCGGCTGCATTGTGACCGTGGAAACCAAACCGGGCCCGGATTTTAAATTTCATCTGCTGAAACCGCCGGGCAGCATGCTGACCCATGGCAGCATTCCGAGCGATCTGATTCCGAAAACCAGCAGCCTGTGGATTGGCAACCGCTATTGGAGCGATATTACCGATTTTGTGATTCGCCCGTTTGTGTTTCAGGCGAACCGCCATTTTGATTTTAACCAGGAAACCGCGGGCTGGAGCACCCCGCGCTTTCGCCCGATTAGCGTGACCATTACCGAACAGAACGGCGCGAAACTGGGCATTGGCGTGGCGACCGATTATATTGTGCCGGGCATTCCGGATGGCTGGCCGGATACCACCATTCCGGGCGAACTGATTCCGGCGGGCGATTATGCGATTACCAACGGCACCGGCAACGATATTACCACCGCGACCGGCTATGATACCGCGGATATTATTAAAAACAACACCAACTTTCGCGGCATGTATATTTGCGGCAGCCTGCAGCGCGCGTGGGGCGATAAAAAAATTAGCAACACCGCGTTTATTACCACCGCGACCCTGGATGGCGATAACAACAACAAAATTAACCCGTGCAACACCATTGATCAGAGCAAAATTGTGGTGTTTCAGGATAACCATGTGGGCAAAAAAGCGCAGACCAGCGATGATACCCTGGCGCTGCTGGGCTATACCGGCATTGGCGAACAGGCGATTGGCAGCGATCGCGATCGCGTGGTGCGCATTAGCACCCTGCCGGAAACCGGCGCGCGCGGCGGCAACCATCCGATTTTTTATAAAAACAGCATTAAACTGGGCTATGTGATTCGCAGCATTGATGTGTTTAACAGCCAGATTCTGCATACCAGCCGCCAGCTGAGCCTGAACCATTATCTGCTGCCGCCGGATAGCTTTGCGGTGTATCGCATTATTGATAGCAACGGCAGCTGGTTTGATATTGGCATTGATAGCGATGGCTTTAGCTTTGTGGGCGTGAGCGGCTTTGGCAAACTGGAATTTCCGCTGAGCGCGAGCTATATGGGCATTCAGCTGGCGAAAATTCGCCTGGCGAGCAACATTCGCAGCCCGATGACCAAACTGATGAACAGCATTCTGGGCCTGATTGATACCGTGACCAACACCATTGGCAAAGCGCAGCAGATTGAACTGGATAAAGCGGCGCTGGGCCAGCAGCGCGAACTGGCGCTGCAGCGCATGAACCTGGATCGCCAGGCGCTGAACAACCAGGTGGAACAGTTTAACAAACTGCTGGAACAGCGCGTGCAGGGCCCGATTCAGAGCGTGCGCCTGGCGCGCGCGGCGGGCTTTCGCGTGGATCCGTATAGCTATACCAACCAGAACTTTTATGATGATCAGCTGAACGCGATTCGCCTGAGCTATCGCAACCTGTTTAAAATT

a recombinant gene sequence is synthesized by the company of Biotechnology engineering (Shanghai) and is connected with pET30a plasmid to form a recombinant expression vector.

Example 2 expression of fusion protein containing feline calicivirus VP1-VP2

The synthesized fusion gene plasmid of feline calicivirus VP1-VP2 was transformed into Escherichia coli BL21, spread on LB plate containing 50. mu.g/mL kanamycin (Shanghai Biotech., cat # K0408), cultured overnight at 37 ℃, a single colony was picked up, cultured with 300mL of LB medium containing kanamycin at the same concentration at 37 ℃ until OD600 reached about 0.6, and induced to express with IPTG (Shanghai Biotech., cat # IB0168) at a final concentration of 1mM under the induction conditions: 25 ℃ and a rotation speed of 200rpm for 4 h. After induction, the culture broth was centrifuged at 4 ℃ and 7000rpm for 10min to collect the cells.

Example 3 purification and renaturation of fusion proteins containing feline calicivirus VP1-VP2

Crushing the thallus by 50mL of loading Buffer Binding Buffer (50mM Tris, 0.2M NaCl, pH8.0); then carrying out ultrasonic crushing for 100 times with the conditions of 500w, 2s of ultrasonic treatment and 5s interval; finally, the supernatant is collected by centrifugation at 12000rpm for 30min at 4 ℃, and the target protein is in the supernatant. Then, the mixture was further purified by Ni column chromatography, and the desired protein was eluted with Elution Buffer (50mM Tris, 0.2M NaCl, 0.5M Imidazole, pH 8.0). The target protein was detected by PAGE gel electrophoresis, and the results are shown in FIG. 1.

As is clear from FIG. 1, the purified fusion protein was very pure, and the purified recombinant protein was dialyzed against dialysis buffer (50mM Tris, 0.2M NaCl, pH8.0) and the dialysis solution was changed every 12 hours for 3 times. The protein solution after dialysis was taken out, filtered through a 0.22 μm filter, measured for concentration by BCA method, and stored at-20 ℃ for further use.

Example 4 detection of feline calicivirus antibodies by double antigen sandwich gold-labeling method

Preparation of 1 double-antigen sandwich gold-labeled detection strip

1.1 firing of colloidal gold

Adding 1000mL of ultrapure water into a triangular flask, heating the ultrapure water on a magnetic heating stirrer until the ultrapure water is boiled, then adding 4mL of 10% chloroauric acid (sigma), then adding 6mL of 10% trisodium citrate solution, continuing heating and boiling for 5min, then cooling to room temperature, filtering colloidal gold by using a 0.22um filter, and standing at 4 ℃ for later use.

1.2 labelling of recombinant feline calicivirus VP1-VP2 fusion proteins

Putting 100mL of colloidal gold solution into a beaker, and adding 0.2M K into the beaker with stirring₂CO₃Adjusting the pH of the gold water to 10.5, stirring, and adding 2mg of purified recombinant feline calicivirus VP1-VP2 fusion proteinStirring at room temperature for 15min, adding 1mL of 10% BSA solution, stirring at room temperature for 15min, then centrifuging at 12000rpm for 10min, carefully sucking out the supernatant, discarding, and diluting the precipitate with gold-labeled diluent (20mM Tris, 1% BSA, 0.03% Proclin300, pH8.0) to 1mL, which is labeled recombinant feline calicivirus VP1-VP2 fusion protein colloidal gold complex.

1.3 murine IgG markers

Putting 100mL of colloidal gold solution into a beaker, and adding 0.2M K into the beaker with stirring₂CO₃The pH of the gold solution was adjusted to 7.0, and after stirring, 1mg of mouse IgG (Hangzhou Longji Biotechnology Co., Ltd., cat # AS00901) was added, and after stirring at room temperature for 15min, 1mL of 10% BSA solution was added, and after stirring at room temperature for 15min, centrifugation was carried out at 12000rpm for 10min, the supernatant was carefully aspirated and discarded, and the precipitate was diluted to 1mL with a gold-labeled diluent (20mM Tris, 1% BSA, 0.03% Proclin300, pH8.0) to obtain a volume of 1mL, which was a labeled mouse IgG colloidal gold complex.

Diluting the gold-labeled compound by 100 times with a gold-labeled diluent, mixing with the feline calicivirus VP1-VP2 fusion protein colloidal gold compound diluted in the step 1.2, soaking the glass fiber, and drying at 37 ℃ for 4h to obtain the gold-labeled pad.

1.4 Spot Membrane of recombinant feline calicivirus VP1-VP2 fusion protein

Diluting the purified VP1-VP2 fusion protein to 0.9mg/mL by using a spotting membrane diluent (50mM Tris, 2% sucrose, pH8.5) to be used as a detection Line (Test-Line) of a colloidal gold Test strip, diluting goat anti-mouse IgG (Hangzhou Longji Biotechnology limited, Cat: PS00901) to 0.3mg/mL by using the same diluent to be used as a quality Control Line (Control-Line) of the colloidal gold Test strip, scribing the two diluted solutions on a nitrocellulose membrane, and drying at 37 ℃ for overnight.

1.5 Assembly of test strip for detecting feline calicivirus antibody by double-antigen sandwich gold-labeled method

And (3) assembling the gold label pad, the polyester plate coated with the raw materials to a nitrocellulose membrane (NC membrane), filter paper, a sample pad and other installation base plates into the reagent strip for detecting the feline calicivirus antibody by the double-antigen sandwich method. The specific installation manner is shown in fig. 2: the sample pad 1, the gold label pad 2, the NC membrane 3, and the filter paper 4 are mounted on the base plate 5, respectively. Wherein a part of the sample pad 1 is superposed and pressed on the gold label pad 2, a part of the gold label pad 2 is superposed and pressed on the NC membrane 3, and a part of the filter paper 4 is superposed and pressed on the NC membrane 3. The NC membrane 3 is divided into a test area and a quality control area, the test area is provided with a detection line 31(T line), the quality control area is provided with a quality control line 32(C line), the detection line 31 is close to the gold mark pad 2, and the quality control line 32 is close to the filter paper 4.

Further, the assembled test paper strip is cut into strips with the length of 3mm by a slitter, and then the strips are put into a specially made plastic card, so that the mature detection reagent card is formed.

2 detection of feline calicivirus antibody test paper strip/card by double-antigen sandwich gold-labeled method

Adding 90 mu L of samples (serum and plasma) to be detected to a sample adding position (S), standing at room temperature for 10min, and judging the result, wherein the result judgment standard is as follows:

fourthly, only one strip appears on the quality control line, no strip appears in the test area, and the test area is negative, as shown in figure 3A;

two strips appear, one strip is positioned in the quality control area, the other strip is positioned in the test area and is positive,

as shown in FIG. 3B;

sixthly, no strip appears on the quality control line, which indicates that the test strip is damaged and the test strip should be replaced by a new test strip for retesting.

3 detection result of feline calicivirus antibody test paper strip/card by double-antigen sandwich gold-labeled method

A total of 15 positive feline calicivirus sera and 40 normal non-diseased and non-immunized feline sera were tested, 14 positive sera were tested in 15 positive sera, 1 negative serum was tested, 1 false positive appeared in 40 negative sera, the sensitivity and specificity were 93.3% and 97.5%, respectively, and the overall percent of concordance was 96.3%.

Part of the test results are shown in FIG. 4, wherein the two lines of the T line and the C line indicate that the test results are positive, and the serum of the cat to be tested contains the feline calicivirus antibody. Only one line of the C line shows that the detection result is negative, and the serum of the cat to be detected does not contain the feline calicivirus antibody.

The result data show that the recombinant feline calicivirus VP1-VP2 fusion protein has good sensitivity and specificity, and can be used as a raw material for manufacturing a recombinant feline calicivirus antibody detection test strip.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Hangzhou Yiminou Biotechnology Ltd

<120> feline calicivirus VP1-VP2 recombinant protein, and preparation method and application thereof

<130> AJ2010231

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 653

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Ala Asp Asp Gly Ser Ile Thr Ala Pro Glu Gln Gly Thr Met Val Gly

1 5 10 15

Gly Val Ile Ala Glu Pro Ser Ala Gln Met Ser Thr Ala Ala Asp Met

20 25 30

Ala Thr Gly Lys Ser Val Asp Ser Glu Trp Glu Ala Phe Phe Ser Phe

35 40 45

His Thr Ser Val Asn Trp Ser Thr Ser Glu Thr Gln Gly Lys Ile Leu

50 55 60

Phe Lys Gln Ser Leu Gly Pro Leu Leu Asn Pro Tyr Leu Glu His Leu

65 70 75 80

Ala Lys Leu Tyr Val Ala Trp Ser Gly Ser Ile Glu Val Arg Phe Ser

85 90 95

Ile Ser Gly Ser Gly Val Phe Gly Gly Lys Leu Ala Ala Ile Val Val

100 105 110

Pro Pro Gly Val Asp Pro Val Gln Ser Thr Ser Met Leu Gln Tyr Pro

115 120 125

His Val Leu Phe Asp Ala Arg Gln Val Glu Pro Val Ile Phe Cys Leu

130 135 140

Pro Asp Leu Arg Ser Thr Leu Tyr His Leu Met Ser Asp Thr Asp Thr

145 150 155 160

Thr Ser Leu Val Ile Met Val Tyr Asn Asp Leu Ile Asn Pro Tyr Ala

165 170 175

Asn Asp Ala Asn Ser Ser Gly Cys Ile Val Thr Val Glu Thr Lys Pro

180 185 190

Gly Pro Asp Phe Lys Phe His Leu Leu Lys Pro Pro Gly Ser Met Leu

195 200 205

Thr His Gly Ser Ile Pro Ser Asp Leu Ile Pro Lys Thr Ser Ser Leu

210 215 220

Trp Ile Gly Asn Arg Tyr Trp Ser Asp Ile Thr Asp Phe Val Ile Arg

225 230 235 240

Pro Phe Val Phe Gln Ala Asn Arg His Phe Asp Phe Asn Gln Glu Thr

245 250 255

Ala Gly Trp Ser Thr Pro Arg Phe Arg Pro Ile Ser Val Thr Ile Thr

260 265 270

Glu Gln Asn Gly Ala Lys Leu Gly Ile Gly Val Ala Thr Asp Tyr Ile

275 280 285

Val Pro Gly Ile Pro Asp Gly Trp Pro Asp Thr Thr Ile Pro Gly Glu

290 295 300

Leu Ile Pro Ala Gly Asp Tyr Ala Ile Thr Asn Gly Thr Gly Asn Asp

305 310 315 320

Ile Thr Thr Ala Thr Gly Tyr Asp Thr Ala Asp Ile Ile Lys Asn Asn

325 330 335

Thr Asn Phe Arg Gly Met Tyr Ile Cys Gly Ser Leu Gln Arg Ala Trp

340 345 350

Gly Asp Lys Lys Ile Ser Asn Thr Ala Phe Ile Thr Thr Ala Thr Leu

355 360 365

Asp Gly Asp Asn Asn Asn Lys Ile Asn Pro Cys Asn Thr Ile Asp Gln

370 375 380

Ser Lys Ile Val Val Phe Gln Asp Asn His Val Gly Lys Lys Ala Gln

385 390 395 400

Thr Ser Asp Asp Thr Leu Ala Leu Leu Gly Tyr Thr Gly Ile Gly Glu

405 410 415

Gln Ala Ile Gly Ser Asp Arg Asp Arg Val Val Arg Ile Ser Thr Leu

420 425 430

Pro Glu Thr Gly Ala Arg Gly Gly Asn His Pro Ile Phe Tyr Lys Asn

435 440 445

Ser Ile Lys Leu Gly Tyr Val Ile Arg Ser Ile Asp Val Phe Asn Ser

450 455 460

Gln Ile Leu His Thr Ser Arg Gln Leu Ser Leu Asn His Tyr Leu Leu

465 470 475 480

Pro Pro Asp Ser Phe Ala Val Tyr Arg Ile Ile Asp Ser Asn Gly Ser

485 490 495

Trp Phe Asp Ile Gly Ile Asp Ser Asp Gly Phe Ser Phe Val Gly Val

500 505 510

Ser Gly Phe Gly Lys Leu Glu Phe Pro Leu Ser Ala Ser Tyr Met Gly

515 520 525

Ile Gln Leu Ala Lys Ile Arg Leu Ala Ser Asn Ile Arg Ser Pro Met

530 535 540

Thr Lys Leu Met Asn Ser Ile Leu Gly Leu Ile Asp Thr Val Thr Asn

545 550 555 560

Thr Ile Gly Lys Ala Gln Gln Ile Glu Leu Asp Lys Ala Ala Leu Gly

565 570 575

Gln Gln Arg Glu Leu Ala Leu Gln Arg Met Asn Leu Asp Arg Gln Ala

580 585 590

Leu Asn Asn Gln Val Glu Gln Phe Asn Lys Leu Leu Glu Gln Arg Val

595 600 605

Gln Gly Pro Ile Gln Ser Val Arg Leu Ala Arg Ala Ala Gly Phe Arg

610 615 620

Val Asp Pro Tyr Ser Tyr Thr Asn Gln Asn Phe Tyr Asp Asp Gln Leu

625 630 635 640

Asn Ala Ile Arg Leu Ser Tyr Arg Asn Leu Phe Lys Ile

645 650

<210> 2

<211> 1959

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gcggatgatg gcagcattac cgcgccggaa cagggcacca tggtgggcgg cgtgattgcg 60

gaaccgagcg cgcagatgag caccgcggcg gatatggcga ccggcaaaag cgtggatagc 120

gaatgggaag cgttttttag ctttcatacc agcgtgaact ggagcaccag cgaaacccag 180

ggcaaaattc tgtttaaaca gagcctgggc ccgctgctga acccgtatct ggaacatctg 240

gcgaaactgt atgtggcgtg gagcggcagc attgaagtgc gctttagcat tagcggcagc 300

ggcgtgtttg gcggcaaact ggcggcgatt gtggtgccgc cgggcgtgga tccggtgcag 360

agcaccagca tgctgcagta tccgcatgtg ctgtttgatg cgcgccaggt ggaaccggtg 420

attttttgcc tgccggatct gcgcagcacc ctgtatcatc tgatgagcga taccgatacc 480

accagcctgg tgattatggt gtataacgat ctgattaacc cgtatgcgaa cgatgcgaac 540

agcagcggct gcattgtgac cgtggaaacc aaaccgggcc cggattttaa atttcatctg 600

ctgaaaccgc cgggcagcat gctgacccat ggcagcattc cgagcgatct gattccgaaa 660

accagcagcc tgtggattgg caaccgctat tggagcgata ttaccgattt tgtgattcgc 720

ccgtttgtgt ttcaggcgaa ccgccatttt gattttaacc aggaaaccgc gggctggagc 780

accccgcgct ttcgcccgat tagcgtgacc attaccgaac agaacggcgc gaaactgggc 840

attggcgtgg cgaccgatta tattgtgccg ggcattccgg atggctggcc ggataccacc 900

attccgggcg aactgattcc ggcgggcgat tatgcgatta ccaacggcac cggcaacgat 960

attaccaccg cgaccggcta tgataccgcg gatattatta aaaacaacac caactttcgc 1020

ggcatgtata tttgcggcag cctgcagcgc gcgtggggcg ataaaaaaat tagcaacacc 1080

gcgtttatta ccaccgcgac cctggatggc gataacaaca acaaaattaa cccgtgcaac 1140

accattgatc agagcaaaat tgtggtgttt caggataacc atgtgggcaa aaaagcgcag 1200

accagcgatg ataccctggc gctgctgggc tataccggca ttggcgaaca ggcgattggc 1260

agcgatcgcg atcgcgtggt gcgcattagc accctgccgg aaaccggcgc gcgcggcggc 1320

aaccatccga ttttttataa aaacagcatt aaactgggct atgtgattcg cagcattgat 1380

gtgtttaaca gccagattct gcataccagc cgccagctga gcctgaacca ttatctgctg 1440

ccgccggata gctttgcggt gtatcgcatt attgatagca acggcagctg gtttgatatt 1500

ggcattgata gcgatggctt tagctttgtg ggcgtgagcg gctttggcaa actggaattt 1560

ccgctgagcg cgagctatat gggcattcag ctggcgaaaa ttcgcctggc gagcaacatt 1620

cgcagcccga tgaccaaact gatgaacagc attctgggcc tgattgatac cgtgaccaac 1680

accattggca aagcgcagca gattgaactg gataaagcgg cgctgggcca gcagcgcgaa 1740

ctggcgctgc agcgcatgaa cctggatcgc caggcgctga acaaccaggt ggaacagttt 1800

aacaaactgc tggaacagcg cgtgcagggc ccgattcaga gcgtgcgcct ggcgcgcgcg 1860

gcgggctttc gcgtggatcc gtatagctat accaaccaga acttttatga tgatcagctg 1920

aacgcgattc gcctgagcta tcgcaacctg tttaaaatt 1959

Claims

1. A feline calicivirus VP1-VP2 recombinant protein is characterized by comprising an amino acid sequence shown as SEQ ID NO. 1.

2. The recombinant protein according to claim 1, consisting of the amino acid sequence shown in SEQ ID No. 1.

3. A gene encoding the recombinant protein of claim 1 or 2, comprising the nucleotide sequence of SEQ ID No. 2.

4. An expression vector comprising the gene of claim 3.

5. A host cell comprising the expression vector of claim 4.

6. A method for producing a recombinant protein according to claim 1 or 2, comprising the step of inducing the host cell according to claim 3 to express the protein.

7. The method of claim 6, wherein the expression vector is pET30a and the host cell is E.coli.

8. The method of claim 7, wherein the step of inducing the host cell to express the protein comprises:

s4, crushing the thallus by using a Buffer Binding Buffer;

9. Use of a recombinant protein according to claim 1 or 2 for the preparation of a kit for the detection of feline calicivirus antibodies.

10. A kit for detecting feline calicivirus antibodies comprising the recombinant protein of claim 1 or 2.