CN110699441A - Biomarker for detecting osteoporosis, application of biomarker and detection method - Google Patents

Abstract

The invention discovers that the differential expression of the biomarker with the nucleotide sequence of SEQ ID NO.1 is related to the occurrence and development of osteoporosis patients for the first time. The application of the biomarker in preparing a reagent for auxiliary diagnosis or curative effect prediction of osteoporosis is provided, and a detection kit and a detection method for detecting the biomarker are designed. The invention provides a new means for clinical diagnosis and treatment of osteoporosis, provides a theoretical basis for the research of osteoporosis mechanism, and provides a new way for the personalized treatment of osteoporosis.

Description

Biomarker for detecting osteoporosis, application of biomarker and detection method

Technical Field

The invention relates to the field of medical detection, in particular to a biomarker for detecting osteoporosis, and application and a detection method of the biomarker.

Background

Osteoporosis (OP) is a systemic bone disease in which bone density is reduced, bone tissue microstructure deteriorates, bone fragility increases, resulting in increased bone fragility and an increased risk of fracture. Statistically, there are about 2 million osteoporosis patients worldwide, with more women than men (US Department of Health and HumanService, 2004). In 2006 and 2007, about 2 million female osteoporosis patients are around the world, causing 890 thousands of fractures, and fractures caused by osteoporosis occur together every 3 seconds on average. With the increasing aging of the population, osteoporosis becomes a serious worldwide health problem. The medicine has high morbidity and great harm, deeply studies the pathogenesis of the medicine, promotes the progress of the prevention and treatment scheme of osteoporosis, improves the health level of people, and has important social significance.

The synergy between bone cells and cellular communication play an important role in bone health and homeostasis. In the process of cell communication, extracellular vesicles with a size of 30-200 nm secreted by cells play an important role, and among them, vesicles called exosomes (exosomes) are more widely noticed in recent years. Exosomes are membrane vesicles of about 30-120nm in diameter that are released into the extracellular matrix after fusion of the cell membrane with intracellular multivesicular bodies (MVBs). It was first discovered by researchers of Johnstone et al when studying the process of transforming reticulocytes into mature red blood cells. Later researches show that blood cells such as T cells, B cells, platelets, dendritic cells and mast cells, epithelial cells and other non-blood-derived cells such as tumor cells secrete exosomes, and the secreted exosomes enter body fluids such as blood, saliva, urine and breast milk and reach other cells and tissues through a circulatory system to generate a remote regulation effect.

Exosomes can carry proteins, various RNA molecules including mRNA, miRNA, LncRNA, etc. as "cargo" during cellular communication and transport these "cargo" to target cells. At present, the detection technology related to the osteoporosis patient screening and early diagnosis is deficient, and no clear molecular diagnosis index exists.

Disclosure of Invention

The invention provides a biomarker for detecting osteoporosis and a detection method aiming at the technical problems in the prior art, the biomarker provided by the invention has higher specificity on human osteoporosis, and can be used as a novel biomarker for detecting and treating osteoporosis patients.

The technical scheme for solving the technical problems is as follows: a biomarker for detecting osteoporosis, wherein the nucleotide sequence of the biomarker is SEQ ID NO. 1.

The invention also provides application of the biomarker for detecting osteoporosis in preparation of a reagent for auxiliary diagnosis or curative effect prediction of osteoporosis.

On the basis of the technical scheme, the invention can be further improved as follows.

Furthermore, the reagent for the auxiliary diagnosis or the curative effect prediction of the osteoporosis is a real-time quantitative PCR detection reagent.

Further, the reagent comprises a detection primer with a detection nucleotide sequence of SEQ ID NO. 1.

Further, the detection primer comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is SEQ ID NO.2, and the nucleotide sequence of the downstream primer is SEQ ID NO. 3.

The invention also provides a detection kit for detecting the biomarkers, the kit comprises a DNA extracting solution, fluorescent quantitative PCR reaction liquid, a standard positive template pU-SJ and a negative quality control standard substance, and the fluorescent quantitative PCR reaction liquid comprises a detection primer with a detection nucleotide sequence of SEQ ID NO.1, a buffer solution and a fluorescent probe.

Further, the fluorescent quantitative PCR reaction solution also comprises MgCl₂。

Further, the fluorescent quantitative PCR reaction solution also comprises dNTPs and sterile double distilled water.

Further, the fluorescent quantitative PCR reaction solution also comprises a Schistosoma japonicum specific primer pair.

The invention also provides a detection method for detecting the biomarker based on the kit, which comprises the following steps:

1) extraction of total RNA of the sample: total RNA of a blood sample of an osteoporosis patient was extracted according to reagents and procedures required for a kit of Life Technologies corporation; then, quantifying the purity and concentration of the extracted RNA by using a NanoDrop ND-1000 nucleic acid quantifier, and carrying out electrophoresis quality inspection on the formaldehyde denatured gel to ensure the integrity of the extracted RNA;

2) preparation of sample cDNA: reverse transcription of the total RNA extracted by using a TaKaRa Kit PrimeScriptTM RT reagent Kit with DNAeraser to synthesize cDNA; the kit contains RNase-Free DNase, and can effectively remove mixed genome DNA;

3) amplification of lncRNA: the detection kit provided by the invention is used for carrying out fluorescence quantitative PCR amplification by taking reverse transcription cDNA as a template.

The invention has the beneficial effects that: the invention discovers for the first time that the biomarker with the nucleotide sequence of SEQ ID NO.1 has higher specificity to the osteoporosis of human beings, and can carry out quick noninvasive diagnosis and screening on osteoporosis patients by detecting the expression level of the biomarker in serum Exosomes of a subject; the invention designs an application scheme, a detection kit and a detection method of the marker in preparing a reagent for the auxiliary diagnosis or the curative effect prediction of osteoporosis based on the marker, compared with the traditional detection means, the invention has the advantages of more timely and sensitive diagnosis and can realize the early auxiliary diagnosis or the curative effect prediction of osteoporosis.

Drawings

FIG. 1 is an exosome electroscope examination map;

FIG. 2 is a graph showing the measurement results of the particle size of exosomes;

FIG. 3 is a diagram of analysis of statistical results of tests on normal serum and osteoporotic serum.

Detailed Description

The principles and features of this invention are described below in conjunction with the following drawings, which are set forth by way of illustration only and are not intended to limit the scope of the invention.

The nucleotide sequence of the biomarker for detecting osteoporosis is SEQ ID NO. 1. The biomarker can be applied to preparation of reagents for auxiliary diagnosis or curative effect prediction of osteoporosis. The detection reagent is adopted to detect the expression level of the biomarker in the blood serum Exosomes of the subject, and the rapid noninvasive diagnosis and screening can be performed on osteoporosis patients.

The invention also provides an improved technical scheme, and in the improved technical scheme, the reagent is preferably a real-time quantitative PCR detection reagent.

The present invention may include a detection primer designed based on the nucleotide sequence of the biomarker of the present invention added to the reagent.

The detection primer of the invention can comprise an upstream primer and a downstream primer, wherein the upstream primer preferably adopts a primer with a nucleotide sequence of SEQ ID NO.2, and the downstream primer preferably adopts a primer with a nucleotide sequence of SEQ ID NO. 3. The upstream primer and the downstream primer are suitable for detection of SYBR Green, TaqMan probes, molecular beacons, double-hybrid probes, composite probes and the like.

Based on the research of the biomarker and the detection primer, the invention also designs a special detection kit. The kit comprises a DNA extracting solution, a fluorescent quantitative PCR reaction solution, a standard positive template pU-SJ and a negative quality control standard substance. The fluorescent quantitative PCR reaction solution comprises a detection primer with a detection nucleotide sequence of SEQ ID NO.1, a buffer solution and a fluorescent probe.

In order to optimize the detection effect, the invention also provides another improved technical scheme, and in the improved technical scheme, MgCl can be further added into the fluorescent quantitative PCR reaction solution₂dNTPs and sterile double distilled water.

In order to optimize the detection effect, the invention also provides another improved technical scheme, and in the improved technical scheme, the fluorescent quantitative PCR reaction solution also comprises a Schistosoma japonicum specific primer pair.

The kit of the invention comprises the following components in a preferable composition: 10 XPCR buffer solution, Taq enzyme, 10 mu mol/L of upstream primer with the nucleotide sequence of SEQ ID NO.2, 10 mu mol/L of downstream primer with the nucleotide sequence of SEQ ID NO.3, 10 mu mol/L of fluorescent probe, 25mmol/L MgCl2, 10mmol/L dNTPs and sterile double distilled water. The fluorescent quantitative PCR reaction solution needs to contain a specific primer pair of the schistosoma japonicum. SYBR Green II is preferably selected as the fluorescent dye of the fluorescent quantitative PCR reaction solution, and hot-start enzyme is preferably selected as Taq enzyme.

The detection of the biomarker with the nucleotide sequence of SEQ ID NO.1 mainly comprises the following steps: extracting a sample exosome, extracting RNA, preparing sample cDNA, and carrying out amplification detection.

The following method can be adopted for extracting the exosome from the sample:

serum exosomes were ultracentrifuged, directly at 10000g for 20 min. The precipitate was discarded, and the supernatant was added to a centrifuge tube, sealed, and centrifuged at 300000g at 4 ℃ for 2 hours. After centrifugation, the tube was removed, the opening was immediately cut with scissors, the supernatant discarded, and the residual liquid was aspirated with a pipette to avoid the precipitate from hanging up. Immediately dissolving the precipitate with 1 time of PBS, subpackaging and carrying out related detection.

After the exosomes are extracted, the exosomes need to be identified by the following method:

observation by electron microscope

(1) The exosome is resuspended in 50-100. mu.L of 2% paraformaldehyde (which can be stored for one week at 4 ℃);

(2) dripping 5 μ L of exosome suspension onto a copper net, and standing at room temperature for 20 min;

(3) rinsing with PBS for 5min for 3 times;

(4) fixing with 1% glutaraldehyde for 5 min;

(5) rinsing with ddH2O for 2min for 10 times;

(6) 4% uranyl acetate is negatively dyed for 5 min;

(7) absorbing residual liquid by filter paper, and airing at room temperature;

(8) and (4) operating on a machine for observation, wherein the machine model is as follows: FEI TECNAI G2, voltage: 120 KV.

The results of the observation are shown in FIG. 1.

NTA particle size measurement

Particle size measurements of exosome samples were performed using a malvern nanoparticle tracking analyzer NanoSight NS 300. The measurement results are shown in fig. 2.

The RNA extraction can be carried out by a TRIzol method, and the specific flow is as follows:

① collecting the exosome precipitate, adding 1ml Trizol for cracking, and repeatedly blowing or violently shaking;

② standing the lysate at 15-30 deg.C for 5 min;

③ adding 200 μ L chloroform, shaking by reversing the front and back of hand for 15s, standing at room temperature for 2-3min, centrifuging at 12000rpm at 4 deg.C for 15 min;

④ placing the upper water phase in a new EP tube, adding 500 μ L isopropanol, gently inverting and mixing, standing at room temperature for 10min, 12000rpm, centrifuging at 4 deg.C for 10min, and discarding the supernatant;

⑤ adding 1ml 75% ethanol (precooled in advance) into the precipitate, vortex mixing, washing, centrifuging at 7500rpm at 4 ℃ for 5min, and discarding the supernatant;

⑥ naturally drying the RNA precipitate at room temperature (5-10min), taking care not to dry it too much, otherwise the RNA is less soluble;

⑦ adding 50-100 μ L RNase-free water to dissolve the RNA precipitate, and standing at-80 deg.C for use.

To simplify the operation, the following method can be used to extract total RNA:

total RNA of a blood sample of an osteoporosis patient was extracted according to reagents and procedures required for a kit of Life Technologies corporation; then, the purity and concentration of the extracted RNA are quantified by a NanoDrop ND-1000 nucleic acid quantifier, and the integrity of the extracted RNA is ensured by formaldehyde denaturing gel electrophoresis quality inspection.

The sample cDNA can be prepared by the following method:

reverse transcription is carried out on the extracted total RNA by adopting a TaKaRa Kit PrimeScriptTM RT reagent Kit with gDNAeraser to synthesize cDNA; the kit contains RNase-Free DNase, and can effectively remove mixed genome DNA.

The amplification detection can adopt the detection kit of the invention to carry out fluorescence quantitative PCR amplification by taking the reverse transcription cDNA as a template.

Examples

The exosome RNA is extracted from the serum of 30 patients and 30 normal patients, and the detection method and the kit are adopted for detection.

And SPSS software is used for detection results, the related data are subjected to Normal test, Mann-Whitney test is selected according to the data type for data analysis, and the difference expression of the index is considered to have statistical significance if P is less than 0.05. QRTPCR results analysis the expression level of the biomarkers of the invention was significantly higher in 30 osteoporosis samples than in paired normal serum samples. The results of the single pair of subjects are shown in FIG. 3.

And (3) detection results: one of the normal persons was used as a control, and the expression level was considered to be 1, and as a result, the expression level was found to be 1. + -. 0.5 in 30 normal persons, and high expression (. gtoreq.2) of the biomarker of the present invention was detected in 27 of 30 patients with osteoporosis, and the results are shown in Table 1.

Normal group	Osteoporosis group	Normal group	Osteoporosis group
				1.3	5.4	0.7	4.6
1.2	4.7	1.5	3.6
				0.9	2.3	0.5	3.5
0.7	5.5	0.9	5.5
				1.1	4.6	0.9	3.3
1.3	5.5	0.9	2.9
				1	4	0.8	3.9
0.6	3.4	1.1	3.8
				1.4	4.5	1.2	3.2
1.2	4.9	0.6	4.1
				0.7	3.7	1.4	3.2
0.9	4.8	0.6	2.6
				1.1	2.2	1.3	1.7
1.2	3.6	1	1.9
				1	1.7

TABLE 1 test results comparison Table

According to the detection results in table 1, the biomarker of the present invention can become a diagnosis-related biomarker, and is more expected to become a new osteoporosis treatment target to improve and enhance the clinical osteoporosis treatment effect.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

SEQ ID NO.1：

cttccttccttccttctttccttccttccttcctaccttccttctttccttccttccttccttcctCCAATTTCTCTCTTACTCCTTCTGCCCTCTCTCTTTCATATGCCTTAGGTGCATCCCACATTCTGCGTTTTTTTGGGGAAATCCTCCACAGGTGCAGGAAAATTGTGTTATTGTAACTATTTACCGCTATCTCTCTTTCACGGCTCTCCATCAGTTGTGAACATCTATTGGTTTATCCCAAGTCACTAAGCATATTTTTATTAGGTACACCTGTTTTTCCTTATACAGCTGTTTCTGGAGTATAGGGTCGCATACTCATAAACCCAGTGTAACTCAGAACCGCATCtcatattccaataaacccatcataacgttgaaaaatcatgaatcaaaccatcataagtcacggtttgtccgTGGATATGGGTGTCATCAATTCCATTGTATACAGTAATGCTGTACACCATTAACAATGGCATACTGATTGGGAGTGGATATTGATAGCATTATAAAAGTCAGTTATTAGAGGGATACTTCTTTAACCTCACTGAAGAACTGATCTAATGGCTTTAGTGCAGTGCATGATTATGTGAGATGTTTTGAGACAGATTAGTACATTTGTGAATGAAATTTTATGGCTTTTTTTCACTTAGTAGGAACCATTGTGTGTGGAAAAGTGAGAAAATTGCTTTCTGCTGTAGAGTCTGGCATTCATTGTAGATTTAAGCCTATTTTTCTGTGAGCAAATCTTATTCAATAAA

SEQ ID NO.2：

TTCACGGCTCTCCATCAGTT

SEQ ID NO.3：

GACACCCATATCCAcggaca

Sequence listing

<120> biomarker for detecting osteoporosis, application of the biomarker and detection method

<140>201910525451X

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>767

<212>DNA

<213> human source (Artificial Sequence)

<400>1

cttccttcct tccttctttc cttccttcct tcctaccttc cttctttcct tccttccttc 60

cttcctccaa tttctctctt actccttctg ccctctctct ttcatatgcc ttaggtgcat 120

cccacattct gcgttttttt ggggaaatcc tccacaggtg caggaaaatt gtgttattgt 180

aactatttac cgctatctct ctttcacggc tctccatcag ttgtgaacat ctattggttt 240

atcccaagtc actaagcata tttttattag gtacacctgt ttttccttat acagctgttt 300

ctggagtata gggtcgcata ctcataaacc cagtgtaact cagaaccgca tctcatattc 360

caataaaccc atcataacgt tgaaaaatca tgaatcaaac catcataagt cacggtttgt 420

ccgtggatat gggtgtcatc aattccattg tatacagtaa tgctgtacac cattaacaat 480

ggcatactga ttgggagtgg atattgatag cattataaaa gtcagttatt agagggatac 540

ttctttaacc tcactgaaga actgatctaa tggctttagt gcagtgcatg attatgtgag 600

atgttttgag acagattagt acatttgtga atgaaatttt atggcttttt ttcacttagt 660

aggaaccatt gtgtgtggaa aagtgagaaa attgctttct gctgtagagt ctggcattca 720

ttgtagattt aagcctattt ttctgtgagc aaatcttatt caataaa 767

<210>2

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ttcacggctc tccatcagtt 20

<210>3

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gacacccata tccacggaca 20

Claims (10)

1. A biomarker for detecting osteoporosis, comprising: the nucleotide sequence of the marker is SEQID NO. 1.

2. Use of the biomarker for detecting osteoporosis of claim 1 in the preparation of a reagent for the auxiliary diagnosis or efficacy prediction of osteoporosis.

3. Use according to claim 2, characterized in that: the reagent for the auxiliary diagnosis or the curative effect prediction of the osteoporosis is a real-time quantitative PCR detection reagent.

4. Use according to claim 3, characterized in that: the reagent comprises a detection primer with a detection nucleotide sequence of SEQ ID NO. 1.

5. Use according to claim 4, characterized in that: the detection primer comprises an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is SEQ ID NO.2, and the nucleotide sequence of the downstream primer is SEQ ID NO. 3.

6. A test kit for detecting the biomarker for osteoporosis of claim 1, wherein: the kit comprises a DNA extracting solution, fluorescent quantitative PCR reaction liquid, a standard positive template pU-SJ and a negative quality control standard substance, wherein the fluorescent quantitative PCR reaction liquid comprises a detection primer with a detection nucleotide sequence of SEQ ID NO.1, a buffer solution and a fluorescent probe.

7. The detection kit according to claim 6, characterized in that: the fluorescent quantitative PCR reaction solution also comprises MgCl₂。

8. The test kit according to claim 7, characterized in that: the fluorescent quantitative PCR reaction solution also comprises dNTPs and sterile double distilled water.

9. The detection kit according to claim 8, characterized in that: the fluorescent quantitative PCR reaction solution also comprises a schistosoma japonicum specific primer pair.

10. A method of using the test kit of claim 6, comprising the steps of:

1) extraction of total RNA of the sample: total RNA of a blood sample of an osteoporosis patient was extracted according to reagents and procedures required for a kit of Life Technologies corporation; then, quantifying the purity and concentration of the extracted RNA by using a NanoDrop ND-1000 nucleic acid quantifier, and carrying out electrophoresis quality inspection on the formaldehyde denatured gel to ensure the integrity of the extracted RNA;

2) preparation of sample cDNA: reverse transcription of the total RNA extracted by using a TaKaRa Kit PrimeScriptTM RT reagent Kit with DNAeraser to synthesize cDNA; the kit contains RNase-Free DNase, and can effectively remove mixed genome DNA;

3) amplification of lncRNA: the detection kit according to claim 6, wherein the reverse transcribed cDNA is used as a template for carrying out fluorescent quantitative PCR amplification.

Images