CN106544442B - Application of miR-181a specific primer reagent in diagnosis of fatty liver of dairy cow - Google Patents
Application of miR-181a specific primer reagent in diagnosis of fatty liver of dairy cow Download PDFInfo
- Publication number
- CN106544442B CN106544442B CN201611136152.XA CN201611136152A CN106544442B CN 106544442 B CN106544442 B CN 106544442B CN 201611136152 A CN201611136152 A CN 201611136152A CN 106544442 B CN106544442 B CN 106544442B
- Authority
- CN
- China
- Prior art keywords
- mir
- fatty liver
- dairy cow
- liver
- cow
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
An application of a miR-181a specific primer reagent in diagnosing fatty liver of a cow belongs to the field of biological medicine. The invention aims to provide application of a reagent for detecting miR-181a in cow serum in preparation of a kit for serological diagnosis of fatty liver in cows. The invention designs miR-181a specific primers and makes the primers into a reagent for diagnosing the fatty liver of the dairy cow. The kit is simple and easy to diagnose the fatty liver, has little influence on the dairy cow, and can be used for screening and early warning the fatty liver of the dairy cow in the perinatal period of an intensive dairy cow farm on a large scale. Can specifically detect the content of miR-181a in the serum of the dairy cow, and is effectively used for diagnosing the fatty liver of the clinical dairy cow.
Description
Technical Field
The invention belongs to the field of biological medicine.
Background
The fatty liver of the dairy cow is an energy negative balance disease of the high incidence of the dairy cow in the perinatal period, and takes the energy negative balance and the deposition of the liver fat as the pathological characteristics. Perinatal cows experience physiological stress such as pregnancy, parturition and initiation of lactation, and also experience nutritional stress due to conversion of low energy feed to high energy feed, particularly energy negative balance due to decreased dry matter intake and increased energy demand in late gestation and early lactation cows. Due to the reasons, the incidence rate of the fatty liver disease is high, the incidence rate of the fatty liver disease of the dairy cows in China is over 30 percent, and the fatty liver disease tends to rise year by year. After the dairy cattle suffer from fatty liver, the milk yield and the milk quality are reduced to different degrees, in addition, the reproductive system and the immune system can be damaged, the immunosuppression is caused, and the incidence rate of infectious diseases such as cow mastitis and endometritis is increased. Therefore, fatty liver has been classified as an important disease of dairy cows by countries in the world.
Liver biopsy technology is the current gold index for diagnosing fatty liver of dairy cows. According to the content (% wet weight) of Triglyceride (TG) in the liver, the weight of the fatty liver can be judged; the content of TG in the liver is 1-5% of the wet weight of the liver, the content of TG in the liver is mild, the content of TG in the liver is moderate, and the content of TG in the liver is more than 10% of the wet weight of the liver. However, liver biopsy belongs to an interventional diagnosis technology, has large damage and stress on dairy cows, is difficult to be accepted by managers in dairy farms, limits the application of the liver biopsy to a great extent, and finds a non-interventional diagnosis method and technology suitable for clinical needs of veterinarians becomes a hotspot of dairy cow fatty liver research.
Disclosure of Invention
The invention aims to provide application of a reagent for detecting miR-181a in cow serum in preparation of a kit for serological diagnosis of fatty liver in cows.
The invention relates to miR-181a specific primers, wherein PCR amplification primers:
upstream: 5'-ACACTCCAGCTGGGAACATTCAACGCTGTC-3', respectively;
downstream: 5'-GCAGGGTCCGAGGTATTC-3', respectively;
specific reverse transcription primer:
5’- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTCAC-3’。
the preparation method of the miR-181a specific primer comprises the following steps: designing a special reverse transcription primer with a stem-loop structure, directly finishing the extension of a template chain in a reverse transcription reaction,
designing a reverse transcription primer: the whole primer consists of two parts, namely a universal stem-loop structure and five to eight bases which are reversely complementary with the 3' end of the target miRNA, wherein the universal stem-loop structure has the sequence as follows: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC-3', respectively; designing reverse transcription primers of miR-181a according to the above rule, wherein the sequence is 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTCAC-3';
designing PCR amplification primers: the upstream primer is about 25-32 nucleotides, the 3' end of the primer has 11-18 nucleotides complementary to the corresponding miRNA, and each forward primer has a fixed sequence which is: ACACTCCAGCTGGG, adding a base sequence left by removing 6-8 nucleotides from the 3 'end from the 5' end of the miRNA mature sequence after the sequence to change U into T; therefore, the designed miR-181a upstream primer sequence is as follows: 5'-ACACTCCAGCTGGGAACATTCAACGCTGTC-3', the downstream sequence is a universal sequence: 5'-GCAGGGTCCGAGGTATTC-3' are provided.
The miR-181a specific primer kit of the invention comprises: the target nucleic acid is a mature sequence of miR-181a, a specific reverse transcription primer of miR-181a, a specific PCR amplification primer of miR-181a, an oligonucleotide sequence of nematode cel-miR-39-3p, UCACCGGGUGUAAAUCAGCUUG; nematode cel-miR-39-3p specificity PCR amplification primer, upstream: ATGGTTCGTGGGTCACCGGGTGTAAATC, downstream: GCAGGGTCCGAGGTATTC, respectively; the fluorescent dye SYBR-GREEN.
The miR-181a specific primer reagent disclosed by the invention is applied to diagnosis of fatty liver of dairy cows.
The kit is simple and easy to diagnose the fatty liver, has little influence on the dairy cow, and can be used for screening and early warning the fatty liver of the dairy cow in the perinatal period of an intensive dairy cow farm on a large scale. Can specifically detect the content of miR-181a in the serum of the dairy cow, and is effectively used for diagnosing the fatty liver of the clinical dairy cow.
Drawings
FIG. 1 is an amplification curve of an exogenous cel-miR-39-3 p;
FIG. 2 is a dissolution curve of exo-cel-miR-39-3 p;
FIG. 3 is an amplification curve of miR-181 a;
FIG. 4 is a dissolution curve of miR-181 a;
FIG. 5 is cow serum miR-181a expression;
FIG. 6 is cow serum miR-181a expression;
figure 7 is the triglyceride content of the cow liver.
Detailed Description
The invention relates to miR-181a specific primers, wherein PCR amplification primers:
upstream: 5'-ACACTCCAGCTGGGAACATTCAACGCTGTC-3', respectively;
downstream: 5'-GCAGGGTCCGAGGTATTC-3', respectively;
specific reverse transcription primer:
5’- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTCAC-3’。
the preparation method of the miR-181a specific primer comprises the following steps: designing a special reverse transcription primer with a stem-loop structure, directly finishing the extension of a template chain in a reverse transcription reaction, and finally obtaining a pair of primers, wherein the pair of primers refers to an upstream primer and a downstream primer of PCR amplification, and the half of the primers is a reverse transcription primer.
Designing a reverse transcription primer: the stem-loop structure not only can effectively prolong the length of miRNA, but also can avoid the combination with other homologous genes due to the self-complementary conformation, thereby reducing the probability of nonspecific amplification. The whole primer consists of two parts, namely a universal stem-loop structure and five to eight bases which are reversely complementary with the 3' end of the target miRNA, wherein the universal stem-loop structure has the sequence as follows: 5'-GTCGTATCCAGTGCAGGGTC CGAGGTATTCGCACTGGATACGAC-3', respectively; designing reverse transcription primers of miR-181a according to the above rule, wherein the sequence is 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTCAC-3';
designing PCR amplification primers: the upstream primer is about 25-32 nucleotides, the 3' end of the primer has 11-18 nucleotides complementary to the corresponding miRNA, and each forward primer has a fixed sequence which is: ACACTCCAGCTGGG, adding a base sequence left by removing 6-8 nucleotides from the 3 'end from the 5' end of the miRNA mature sequence after the sequence to change U into T; therefore, the designed miR-181a upstream primer sequence is as follows: 5'-ACACTCCAGCTGGGAACATTCAACGCTGTC-3', the downstream sequence is a universal sequence: 5'-GCAGGGTCCGAGGTATTC-3' are provided.
The miR-181a specific primer kit of the invention comprises: the target nucleic acid is a mature sequence of miR-181a, a specific reverse transcription primer of miR-181a, a specific PCR amplification primer of miR-181a, an oligonucleotide sequence of nematode cel-miR-39-3p, UCACCGGGUGUAAAUCAGCUUG; nematode cel-miR-39-3p specificity PCR amplification primer, upstream: ATGGTTCGTGGGTCACCGGGTGTAAATC, downstream: GCAGGGTCCGAGGTATTC, respectively; the fluorescent dye SYBR-GREEN.
The miR-181a specific primer reagent disclosed by the invention is applied to diagnosis of fatty liver of dairy cows.
The invention belongs to the field of biological medicines, and relates to application of micro RNA (miR-181a) in a dairy cow fatty liver serology diagnosis kit, in particular to application of a reagent for detecting miR-181a in a blood sample in preparation of a dairy cow fatty liver diagnosis kit. The miR-181a is sensitive to the fatty liver of the dairy cow, and the kit is simple and easy to diagnose the fatty liver, has small influence on the dairy cow, and can be widely used for screening and early warning the fatty liver of the dairy cow in the perinatal period of an intensive dairy cow farm.
The invention firstly provides application of a reagent for detecting miR-181a in a bovine serum sample in preparation of a diagnostic kit for detecting fatty liver of a bovine to be detected, wherein the reagent is a reagent having specificity to miR-181a, and specifically comprises the following steps: PCR primers with detection specificity to miR-181a, and a detection object of the reagent is a serum sample.
The invention diagnoses whether the cattle to be detected contains fatty liver or not by detecting the content of miR-181a in the serum of the dairy cattle.
The technical scheme adopted by the invention is as follows: extracting RNA in a bovine serum sample to be detected, and adding artificially synthesized nematode cel-miR-39-3p oligonucleotide as a reference substance; synthesizing cDNA by reverse transcription method; detecting the content of miR-181a in the sample by adopting a real-time fluorescent quantitative PCR method; the content of nematode cel-miR-39-3p is used as a reference for standardization. If the content of miR-181a in the serum of the cattle to be detected is obviously increased compared with that of a normal control group, the cattle to be detected is diagnosed to have the fatty liver.
1. Preparation of primers
The primers and oligonucleotide sequences were synthesized by primer synthesis, where the reverse transcription primer of miR-181a, the upstream and downstream primers, and the oligonucleotide sequences of nematode cel-miR-39-3p and the upstream and downstream primers were each 1 nmol. Adding 50 mu LddH to each tube2O, diluted to 20 μ M stock solution. When in use, the solution is diluted into corresponding working solution.
2. Extraction of miRNA from serum
The nematode cel-miR-39-3p oligonucleotide is treated with ddH2Diluting the solution to 1 mu M of working solution by using O; 1mL of serum sample is added with 10 uL of 1 uM cel-miR-39-3p oligonucleotide; 1mL of serum sample is added into 1mL of Trizol, and the mixture is incubated for 5 min at room temperature; adding 0.2 mL of chloroform, shaking for 15 s, and standing at room temperature for 5 min; centrifugation at 12000 rpm for 15 min at 4 ℃ resulted in stratification, and careful pipetting of the upper aqueous phase (approximately 60% of the volume of Trizol) into a fresh 1.5 mL centrifuge tube (no pipetting into the middle white mass); adding isopropanol with the same volume as the supernatant, reversing and mixingPrecipitating at-20 deg.C for more than 1 h; centrifuging at 4 deg.C and 12000 rpm for 15 min to obtain white precipitate at the bottom of the tube, and removing the supernatant; adding 1mL of 75% ethanol, centrifuging at 4 ℃ and 12000 rpm for 15 min; removing supernatant, opening the cover of the centrifuge tube, drying, and dissolving the precipitate in sterile water when the precipitate is translucent.
3. Method for detecting miR-181a in serum
Reverse transcription of cDNA: ddH is used as reverse transcription primer of miR-181a2Diluting the solution to 5 mu M of working solution by using O; establishing a reaction system by taking total RNA extracted from a sample as a template, wherein the kit is purchased from Sharp Bo Biotechnology GmbH, Guangzhou; the systems are mixed evenly, liquid is collected to the bottom of the tube by centrifugation, the temperature is 42 ℃ for 60 min, the temperature is 72 ℃ for 10 min, and the product is the cDNA template.
qRT-PCR: the upstream and downstream primers of miR-181a and cel-miR-39-3p are subjected to ddH2Diluting the solution to 5 mu M of working solution by using O; according to the characteristics of miRNA and the PCR amplification principle, the kit is adopted to detect the content of miR-181a and nematode cel-miR-39-3p in ABI 7500 quantitative PCR.
PCR amplification was performed according to the following procedure: 20 s at 95 ℃; 40 cycles (95 ℃ for 10 s, 60 ℃ for 30s, 70 ℃ for 1 s).
4. Calculation of relative expression amount of miRNA
And (3) verification test:
1. serum and liver sample Collection
50 cows are all from a certain cow farm in Sublyseius city of Heilongjiang, the age and the number of fetuses among the cows have no statistical significance, and the cows have no other diseases; all cows collected blood on an empty stomach in the morning via the tail vein and immediately 3000 fgCentrifugation, 15min, collecting serum; before sampling for liver puncture, shearing off hairs in 11 th or 12 th right intercostal space with a hair shearing scissors, sterilizing with iodine tincture and 75% alcohol, injecting 2% lidocaine for anesthesia subcutaneously, cutting a puncture incision of 3 mm on the skin with a scalpel, inserting the puncture needle into the liver through intercostal muscles, and immediately freezing and storing the taken liver at-80 ℃ for later use.
2. Determination of hepatic triglyceride content
The liver triglyceride content determination kit is purchased from Beijing prilley gene technology Co., Ltd, and the determination steps are as follows: accurately weighing the weight of the liver, adding 20 mu L of lysis solution to each mg of tissue according to the proportion, crushing the tissue by using an electric high-speed homogenizer, homogenizing, and standing for 10 min; transferring a proper amount of supernatant into a 1.5 mL centrifuge tube, heating at 70 ℃ for 10 min, centrifuging at 2000 rpm at room temperature for 5 min, and using the supernatant for triglyceride determination; preparing a working solution, wherein R1 and R2 are prepared according to the proportion of 4:1 and are used as the working solution; diluting with standard substance, and adding ddH2Diluting glycerol standard substance with O strength of 4 mM to 1000, 500, 250, 125, 62.5, 31.25, 15.625 and 7.8125 μ M; loading according to the following table, and incubating at 37 ℃ for 10 min after loading; detecting the absorbance of the sample at 550 nm by using an enzyme-labeling instrument; standard curves were drawn and triglyceride concentrations were calculated, correcting triglyceride content per mg of liver wet weight, and the results are expressed as: % g/g Wet weight of liver
The results are shown in the table, wherein the triglyceride content of 25 bovine livers was within the normal range (less than 1%), 10 bovine mild fatty liver (1-5%), 9 bovine moderate fatty liver (5-10%), 6 bovine severe fatty liver (more than 10%)
3. Preparation of primers
Taking the reverse transcription and upstream and downstream primers of miR-181a in the kit, the oligonucleotide sequence of cel-miR-39-3p and the upstream and downstream primers, and adding 50 mu L ddH into each tube2O, diluted to 20 μ M stock solution. When in use, the solution is diluted into corresponding working solution.
4. Extraction of miRNA from serum
The nematode cel-miR-39-3p oligonucleotide is treated with ddH2Diluting the solution to 1 mu M of working solution by using O; 1mL of serum sample is added with 10 uL of 1 uM cel-miR-39-3p oligonucleotide; 1mL of serum sample is added into 1mL of Trizol, and the mixture is incubated for 5 min at room temperature; adding 0.2 mL of chloroform, shaking for 15 s, and standing at room temperature for 5 min; centrifugation at 12000 rpm for 15 min at 4 ℃ resulted in stratification, and careful pipetting of the upper aqueous phase (approximately 60% of the volume of Trizol) into a fresh 1.5 mL centrifuge tube (no pipetting into the middle white mass); adding isopropanol with the same volume as the supernatant, reversing and mixing uniformly, and precipitating at-20 ℃ for more than 1 h; centrifuging at 4 deg.C and 12000 rpm for 15 min to obtain white precipitate at the bottom of the tube, and removing the supernatant; adding 1mL of 75% ethanol, centrifuging at 4 ℃ and 12000 rpm for 15 min; removing supernatant, opening the cover of the centrifuge tube, drying, and dissolving the precipitate in sterile water when the precipitate is translucent.
5. Method for detecting miR-181a in serum
Reverse transcription of cDNA: ddH is used as reverse transcription primer of miR-181a2Diluting the solution to 5 mu M of working solution by using O; establishing a reaction system by taking total RNA extracted from a sample as a template, wherein the kit is purchased from Sharp Bo Biotechnology GmbH, Guangzhou; mixing the above systems, centrifuging to collect liquid to tube bottom, and collecting product as cDNA template at 42 deg.C for 60 min and 72 deg.C for 10 min
qRT-PCR: the upstream and downstream primers of miR-181a and cel-miR-39-3p are subjected to ddH2Diluting the solution to 5 mu M of working solution by using O; according to the characteristics of miRNA and the PCR amplification principle, the kit is adopted to detect the content of miR-181a and nematode cel-miR-39-3p in ABI 7500 quantitative PCR
PCR amplification was performed according to the following procedure: 20 s at 95 ℃; 40 cycles (95 ℃ for 10 s, 60 ℃ for 30s, 70 ℃ for 1 s).
6. Calculating the relative expression quantity of miRNA, taking a serum sample with normal triglyceride content as a reference sample
7. The results are shown in the following, the expression level of miR-181a in serum of 25 cows is higher than that of a reference sample, the results are consistent with the triglyceride content, and the expression level of miR-181a of cows with higher liver triglyceride content is higher, namely, the expression level of miR-181a in blood and the liver triglyceride content are in a dependency relationship, which shows that the method for diagnosing fatty liver by detecting the expression level of miR-181a in blood by using the kit can completely replace the method for diagnosing fatty liver by detecting the liver triglyceride content, and the use of the kit has the advantages of small stress on cows, small wound and convenient use
Claims (1)
- Application of miR-181a specific primers in preparation of a reagent for diagnosing fatty liver of dairy cows.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611136152.XA CN106544442B (en) | 2016-12-12 | 2016-12-12 | Application of miR-181a specific primer reagent in diagnosis of fatty liver of dairy cow |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611136152.XA CN106544442B (en) | 2016-12-12 | 2016-12-12 | Application of miR-181a specific primer reagent in diagnosis of fatty liver of dairy cow |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106544442A CN106544442A (en) | 2017-03-29 |
| CN106544442B true CN106544442B (en) | 2020-06-02 |
Family
ID=58397570
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611136152.XA Active CN106544442B (en) | 2016-12-12 | 2016-12-12 | Application of miR-181a specific primer reagent in diagnosis of fatty liver of dairy cow |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106544442B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107475424B (en) * | 2017-09-25 | 2021-02-05 | 吉林大学 | Application of mitochondrial DNA detection reagent in diagnosing fatty liver of dairy cow |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101798594A (en) * | 2009-11-13 | 2010-08-11 | 北京命码生科科技有限公司 | Marker, detection method, biological chip and test box for detecting milk quality |
| CN103509789A (en) * | 2012-06-26 | 2014-01-15 | 刘晓光 | Primer for amplifying short-chain RNA (ribonucleic acid) and related method thereof |
| CN105087794A (en) * | 2015-08-17 | 2015-11-25 | 广东省结核病控制中心 | Kit for tuberculosis detection |
-
2016
- 2016-12-12 CN CN201611136152.XA patent/CN106544442B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101798594A (en) * | 2009-11-13 | 2010-08-11 | 北京命码生科科技有限公司 | Marker, detection method, biological chip and test box for detecting milk quality |
| CN103509789A (en) * | 2012-06-26 | 2014-01-15 | 刘晓光 | Primer for amplifying short-chain RNA (ribonucleic acid) and related method thereof |
| CN105087794A (en) * | 2015-08-17 | 2015-11-25 | 广东省结核病控制中心 | Kit for tuberculosis detection |
Non-Patent Citations (2)
| Title |
|---|
| Molecular cloning and expression of bovine nucleoplasmin 2 (NPM2): a maternal effect gene regulated by miR-181a;Brandon M Lingenfelter等;《Reproductive Biology and Endocrinology》;20111231;第1-9页 * |
| 胎衣不下奶牛母体胎盘miRNA-181a异常表达分析及验证;郑程远等;《黑龙江畜牧兽医》;20150831;第21-24页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106544442A (en) | 2017-03-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107586887B (en) | PCR differential diagnosis kit for porcine circovirus type 2 and type 3 and detection method thereof | |
| CN105420405B (en) | The cow's serum microRNA molecule of milk cow Fatty Liver Disease and cow in perinatal period related metabolic diseases label | |
| Palm et al. | Influence of different semen extenders and seminal plasma on PMN migration and on expression of IL-1β, IL-6, TNF-α and COX-2 mRNA in the equine endometrium | |
| Paschoal et al. | Neurocryptococcosis: diagnosis by PCR method | |
| RU2583871C1 (en) | Method for differential diagnosis of gliomas of human brain | |
| CN113832260B (en) | Multiplex nano PCR detection primer pair, kit and application method for goose astrovirus, goose parvovirus and goose embedded cup virus | |
| CN111518877B (en) | One-tube method nest type real-time quantitative PCR detection kit for detecting echinococcus multilocularis and echinococcus granulosus by parting trace samples | |
| CN110804659B (en) | Application of serum exosome ssc-miR-92b-3p as molecular marker for early pregnancy diagnosis of sows | |
| CN103205511A (en) | Primer pair for detecting pigeon torque teno viruses and application of primer pair | |
| CN106544442B (en) | Application of miR-181a specific primer reagent in diagnosis of fatty liver of dairy cow | |
| CN108277279A (en) | A kind of application of lncRNA in diagnosing and/or treating breast cancer | |
| JP7090357B2 (en) | Use of primer sets, kits, and microRNA serum markers and primer sets to identify the sex of sturgeon | |
| CN101575649B (en) | Quick detection technology for H9 type avian influenza virus | |
| CN102876809B (en) | GCRV (grass carp reovirus) RT-PCR (reverse transcription-polymerase chain reaction) detection reagent kit and detection method | |
| CN107475424B (en) | Application of mitochondrial DNA detection reagent in diagnosing fatty liver of dairy cow | |
| CN104232789A (en) | RT-PCR (reverse transcription-polymerase chain reaction) technique capable of simultaneously identifying porcine reproductive and respiratory syndrome virus (PRRSV) | |
| CN111154915A (en) | PCR differential diagnosis kit for porcine circovirus type 4 and type 3 and detection method thereof | |
| CN106011248B (en) | Method and kit for detecting muscular atrophy | |
| CN102002539A (en) | Porcine parvovirus assay kit and application thereof | |
| CN108893547A (en) | It is a kind of for the primer pair of the quick Sex judging of squab, kit and quick Sex judging method | |
| CN109055574B (en) | Detection method for determining pregnancy of sow by using urine of sow | |
| CN111394443A (en) | Gene detection method for evaluating male fertility genetic risk and guiding health management | |
| CN110184385A (en) | Freshwater crayfish the end of a thread virus PCV-87R specific sequence and application | |
| CN112458186B (en) | Primer group and kit for quantitatively detecting toxoplasma gondii and application of primer group and kit | |
| Pornsukarom | Comparison of three different PCR primer sets for psittaciformes sexing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |