CN110184385A - Freshwater crayfish the end of a thread virus PCV-87R specific sequence and application - Google Patents
Freshwater crayfish the end of a thread virus PCV-87R specific sequence and application Download PDFInfo
- Publication number
- CN110184385A CN110184385A CN201910307663.0A CN201910307663A CN110184385A CN 110184385 A CN110184385 A CN 110184385A CN 201910307663 A CN201910307663 A CN 201910307663A CN 110184385 A CN110184385 A CN 110184385A
- Authority
- CN
- China
- Prior art keywords
- pcv
- virus
- thread
- primer
- freshwater crayfish
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to fields, specifically disclose freshwater crayfish the end of a thread virus PCV-87R specific sequence and application, the cray virusPCV‑87RSpecific sequence is shown in SEQ ID NO.1, and for the sequence, applicant devises detection primerPCV‑87R- F andPCV‑87R- R, it is diagnosable to be infected by cray the end of a thread virus PCV when nucleic acid fragment of the primer amplification to 709 bp sizes；When detecting the nucleic acid fragment of 4810 bp sizes, then it is believed that being infected by shrimp white spot syndrome virus WSSV.Gene order provided by the invention and primer are particularly suitable for gene diagnosis and Molecule Epidemiology Investigation to the asymptomatic high mortality virosis of cray, apply also for the monitoring and warning to different aquatic livestock the end of a thread viruses.
Description
Technical field
The invention belongs to virology, fisheries biology technology and aquatic livestock medical domains, are more particularly to freshwater crayfish
The end of a thread virus PCV-87R specific gene and application.
Background technique
The aquatic livestocks such as freshwater crayfish (Red swamp crayfish Procambarus clarkia) are global foods
Become more and more important in object and protein source component part [Hammond et al.Aquaculture, 2006,251 (2-4),
271-279], they influence human health there are also significant ecological effect.It is reported that: freshwater crayfish is in aquatic food products
Also there is important and unique status in net, when insecticide killing fish rely the cray made a living, also increase mankind's blood
Risk [Halstead the et al, 2018, Nat Commun.9 (1): 837] of fluke disease prevalence.On more ground such as Europe, the United States, Asia,
The existing positive cultural process of cray industry, and have huge economic benefit [McClain et al.World
Aquaculture,2004.35(4):31-35,60-61].[FAO 2011] is reported according to the World Food Programme, and China is in the world
Maximum cultivation cray producing country [Ethier is V.2013].But regrettably virosis causes cultivation and wild cray big
It is still generally existing [Baumgartner et al.2009, Dis Aquat Organ.85 (1): 15-22] to measure dead phenomenon,
Main virus causing disease is unclear.
Some countries propose countermeasure [the Coughran et al.2012.Crustacean of protection freshwater crayfish
Research,2012,25–34].Though it has been reported that being because of shrimp white spot syndrome virus (white spot syndrome
Virus, WSSV) caused [Soowannayan et al.2011.Aquaculture, 319 (1-2): 5-10].However, fresh water
Cray virosis is usually the quick epidemic disease of burst high mortality without body surface diseases.This with prawn's virus WSSV because
Sick characterization feature [Claverie et al, 2010.Desk the Encyclopedia of for causing prawn " hickie " and gaining the name
General Virology (1ed.) .Oxford:Academic Press.p.189] obviously it is not inconsistent.It will be to very harmful small
Lobster carries out diagnosis and fashion trend early warning without illness, burst high mortality epizootic disease viral disease, not only significant and rich
Challenge.
In view of the above-mentioned problems, applicant isolates one plant of freshwater crayfish the end of a thread virus, the virus from freshwater crayfish
It is the Causative virus for directly resulting in the feature for asymptomatic death occur, the Envelope Protein Gene PCV-87R of the specificity of the virus
Not only will at home and abroad cultivate freshwater crayfish virus diagnostic, fashion trend investigation and early warning etc. has extensive use, also
The blocking and virosis prevention and control infected shell-fish the end of a thread virosis there is into huge potential.
Summary of the invention
The object of the present invention is to provide freshwater crayfish the end of a thread virus-specific sequence PCV-87R, sequence SEQ
Shown in I D NO.1.
Another object of the present invention is to be the provision of the primer based on the design of PCV-87R specific gene.
Final object of the present invention is to be the provision of sequence shown in SEQ ID NO.1 or for SEQ ID NO.1
The primer of design is preparing the application in freshwater crayfish the end of a thread viral diagnosis reagent.
In order to achieve the above object, the present invention takes following technical measures:
Applicant carries out cause of disease inspection since acquiring asymptomatic dying freshwater crayfish in different breeding field or natural water
Survey, separation and the observation of micro- and ultra micro, show in the cell of these crays there are a large amount of both ends blunt circles, have cyst membrane, it is average
The baculovirus particles that diameter is about 250 × 100nm, further progress purifying sequencing, the gene of discovery and existing the end of a thread virus
Group sequence is different, therefore is named as freshwater crayfish the end of a thread virus (Procambarus clarkia nimavirus, PCV), benefit
It is compared, is finally obtained shown in SEQ ID NO.1 with the genome of the virus with the genome of other shrimp susceptible virus
Specific sequence.
It is also protection content of the invention, described draws for the primer of the design of specific sequence shown in SEQ ID NO.1
Object is preferred, is PCV-87R-F:taggctagtgtcgaaaggtacattt and PCV-87R-R:
agctgttccaccttttgcttatctc。
One kind can detect simultaneously freshwater crayfish the end of a thread virus PCV (Procambarus clarkia nimavirus) and
The detection kit of White Spot Syndrome Virus WSSV (white spot syndrome virus), including primer: PCV-
87R-F:tag gctagtgtcgaaaggtacattt, PCV-87R-R:agctgttccaccttttgcttatctc and wsv-
238-F:cgtcaggtcccgtattat ataggac.
Sequence shown in SEQ ID NO.1 is preparing freshwater crayfish the end of a thread disease for the primer of SEQ ID NO.1 design
Application in malicious diagnostic reagent detects in testing gene group whether contain SEQ ID including the use of the usual manner of this field
Sequence shown in NO.1.
Compared with prior art, the invention has the following advantages that
1) present invention realizes, burst high mortality virosis asymptomatic to freshwater crayfish and efficiently and accurately diagnoses.
2) present invention be based on the small imperial the end of a thread virus PCV whole genome sequence of the fresh water that newly measures and with various prawn hickie
Syndrome virus WSSV full-length genome and homologous gene compare, and the two pairs of combinations constituted using 3 primers carry out PCR amplification
Strategy, improving efficiency, simplifying process, while reduce cost, moreover it is possible to which freshwater crayfish the end of a thread virus PC V is distinguished in detection
With shrimp white spot syndrome virus WSSV, to obtain richer and more accurate information and date.
3) gene order provided by the invention or its primer, can research and develop accurate, quick, convenient and fast immunoassay technology and/
Or preparation, it is widely used in the health evaluating of freshwater crayfish at home and abroad or virosis prevalence study and early warning.
5) sensitive using PCR detection method provided by the invention, gene dosage containing PCV is that 0.1ng/ μ L can be examined in measuring samples
Out；Or gene dosage containing WSSV is that 10pg/ μ L can be detected.
6) the gene PCV-87R expanded has predictable function or conserved domain；Gene size is moderate, after amplification
It is easy to analyze and judge.
Detailed description of the invention
Fig. 1 is the ultra-thin section transmission electron microscope picture schematic diagram of the dying cray gill；
It is shown in the ultra-thin section of the dying cray gill, there are viral (PCV) particles of flood tide the end of a thread.
The amino acid sequence multiple alignment schematic diagram of Fig. 2 PCV-87R and its homologous protein；
In these viruses listed on the left of figure, the host of PCV and CN02 are freshwater crayfish, and the host of other viruses
It is seawater prawn."-: " indicates to lack corresponding amino acid.PCV-87R(MH663976),WSSV-CN02(KT995470),
WSSV-CN01(KT995472),WSSV-CN(AF332093),WSSV-TH(AF369029),WSSV-MX(KU216744),
WSSV-TW(AF440570),WSSV-KR(JX515788).Having gray background area is structural domain, wherein PI3K RBD: phosphatidyl
3 kinases ras binding domain of inositol all has the structural domain in all viral homologous proteins being compared.TMD: transmembrane domain, two kinds
The virus protein (PCV-87R and WSSV-CN02) separated from freshwater crayfish lacks the structural domain.
Fig. 3 carries out the electrophoretogram of pcr amplification product with different primers；
Measuring samples are respectively PCV: freshwater crayfish the end of a thread virus (Procambarus clarkia nima
virus)；WS SV: shrimp white spot syndrome virus (white spot syndrome virus)；
The primer is 87R-R/87R-F and 87R-R/wsv-238-F respectively.M:1kb ladder plus.As a result big
Small is respectively to amplify a specific nucleic acid bands at 4810bp, 1600bp and 709bp.
PCR products electrophoresis map of Fig. 4 different primers to PCV or WSSV；
Upper figure: primer PCV-87R-F/PCV-87R-R is to PCV and WSSV PCR amplification figure, the following figure: primer wsv-238-F/
PCV-87R-R is to PCV and WSSV PCR amplification figure；
Template DNA concentration to be checked is followed successively by (100、10-1、10-2、10-3Or 10-4)×0.1ng/μL。
Specific embodiment
Technical solution of the present invention, such as special standby explanation is the conventional scheme of this field, the reagent or material,
Such as not special standby explanation, commercial channel is derived from.
Embodiment 1:
The discovery of freshwater crayfish the end of a thread virus and the acquisition of specific sequence:
Applicant carries out cause of disease inspection since acquiring asymptomatic dying freshwater crayfish in different breeding field or natural water
It surveys, separation and micro- and ultra micro are observed.As the result is shown the necrosis of hepatopancrease tubule cells, the damage of small inside pipe wall of these crays and
Clasmatosis；And gill tissue's swelling, hyperemia.Ultra micro sections observation is shown: there are a large amount of both ends are blunt in the cell of these crays
Circle, have cyst membrane, baculovirus particles that average diameter is about 250 × 100nm, gill, intestines and hepatopancrease of cray etc. no
With being distributed in tissue, especially there are a large amount of virus multiplications in gill tissue, further negative staining Electron microscope showed, viral magnetic tape trailer is attached
Device, the characteristic feature with the end of a thread Viraceae is different from the genome sequence of existing the end of a thread virus after being sequenced, therefore names
It is viral (Procambarus clarkia nimavirus, PCV) (Fig. 1) for freshwater crayfish the end of a thread.It can be used for expanding because there is no
The cell line of PCV, PCV of the invention be by by after the virus inoculation to cray, then take its tissue carry out PCV separation and
It purifies and obtains through isopycnic gradient centrifugation.
PCV suspension annotation was inoculated into normal cray body after 3~7 days, cray can be caused dead.Collection manually connects
Dying cray tissue after kind of PCV, carry out the observation of micro- and ultra micro, lesion characteristics and contained morphology of virus feature with from epidemic disease
The detection feature that area directly acquires cray disease sample is identical.
Preparation PCV genomic nucleic acids, complete its genome sequencing after, through analyse in depth and with known prawn's virus
WSSVs genome sequence compares, the genetic evolution branding that discovery PCV has its special.PCV complete genome DNA contains 287,179bp,
Presumption 180 open reading frame (ORF) of coding.PCV genome and each shrimp white spot syndrome virus strain (WSSVs) known are all
It has differences, such as insertion, missing and single nucleotide mutation gene variation occurs, lacked including compared with homologous gene
The PCV-87R specific gene of encoding transmembrane domain (TMD).Display is further analysed in depth, PCV is in addition in the more of gene framework
Become region sequence and WSSV is dramatically different outer, encodes the key gene PCV-87R of viral envelope proteins (Envelope protein)
It is a unique gene, sequential structure is only consistent with another Strain (CN02) homologous gene being separated to from cray,
But there were significant differences for homologous gene vp51A (vp52A) corresponding to known seawater shrimp white spot syndrome virus WSSV, missing
287 amino acid (Fig. 2) including transmembrane domain (TMD).
Through sequence alignment, it is finally obtained the specific sequence PCV-87R of freshwater crayfish the end of a thread virus, sequence is
Shown in SEQID NO.1, which can be used for the identification of freshwater crayfish the end of a thread virus.
Embodiment 2:
Specific sequence for PCV-87R is preparing freshwater crayfish the end of a thread virus for the primer of the sequence design
Application in (Procambarus clarkia nimavirus, PCV) detection kit:
For the primer of sequence design shown in SEQ ID NO.1 are as follows: PCV-87R-F:
Taggctagtgtcgaaaggtacattt and PCV-87R-R:agctgttccaccttttgcttatctc.
Amplification system are as follows:
Measuring samples DNA1 μ l (0.1 μ g), primer PCV-87R-R/PCV-87R-F every respectively add 10 μM of 1 μ l；Add 2 μ l,
The dNTP Mix of 10mM；Add 5 μ l 10 × TranStart Taq Buffer (Mg2+) and 1 μ l TranStart Taq DNA
Polymerase (Beijing Quanshijin Biotechnology Co., Ltd's product), adds ddH2O, makes 50 μ l of final volume, after mixing, centrifugation
15s makes reactive component concentrate on tube bottom.
Carry out PCR amplification, cyclic program are as follows: 94 DEG C of initial denaturation 5min, 94 DEG C of denaturation 30s, 55 DEG C of renaturation 30s, 72 DEG C are prolonged
Stretch 1.5min, 32 circulations, 72 DEG C of extension 5min, 12 DEG C of preservations.
After amplification, 3 μ l 6 × Loading buffer are added into system, mixes, takes 5 μ l loadings to 1% concentration
In Ago-Gel hole, 199V, 97mA, electrophoresis 30min.After electrophoresis, Ago-Gel is put into the EB liquid of 1% concentration
In, 5min is impregnated, in gel imaging system (imaging of GBOX full automatic gel and analysis system, the production of SYNGENE company, the U.S.)
Middle imaging.
Determine:
It is expanded by primer PCV-87R-R and PCV-87R-F, after gene containing PCV in DNA sample to be checked, product electrophoresis
There is the nucleic acid belt that 1 molecular weight is 709bp；Occurs 1 point after gene containing WSSV in DNA sample to be checked, product electrophoresis
The nucleic acid belt that son amount is 4810bp.
Embodiment 3:
For the sensitivity of the primer of the specific sequence design of PCV-87R:
By freshwater crayfish the end of a thread virus PCV (Procambarus clarkia nimavirus) genomic DNA successively 10
It is serially diluted again: stoste 0.1ng/ μ L, 10-1... to 10-4, as template DNA.
2) PCR amplification is carried out according to the method in embodiment 2；
4) detection of primer pair PCV is limited up to 0.1ng/ μ L, and is limited up to 10pg/ μ L (in Fig. 4 the detection of WSSV
Upper figure).
Embodiment 4:
For the specificity of the primer of the specific sequence design of PCV-87R:
For other viruses of latent infection cray, such as the end of a thread virus, yellow head virus, infectious subcutaneous and hematopoietic tissue
Necrosis virus and Taura syndrome design primer (being shown in Table 1), with the primer and method of embodiment 2 to the viral core to be checked in table 1
Sour sample is expanded.As a result except (but stripe size is not for capable of being amplified of the end of a thread viral (encoding homologous Viral structural protein VP2 8)
709 or 4810bp), other primer amplification results are feminine gender.
The different shrimp Virus Infos of table 1
Embodiment 5:
One kind can detect simultaneously freshwater crayfish the end of a thread virus PCV (Procambarus clarkia nimavirus) and
The detection kit of White Spot Syndrome Virus WSSV (white spot syndrome virus):
Kit includes primer:
PCV-87R-F:taggctagtgtcgaaaggtacattt, PCV-87R-R:
Agctgttccaccttttgcttatctc and wsv-238-F:cgtcaggtcccgtattatataggac.
It is right respectively with primer PCV-87R-F and PCV-87R-R, PCV-87R-R and wsv-238-F with the method for embodiment 2
DNA to be measured carries out PCR amplification；
The testing result of PCV-87R-F and PCV-87R-R: after gene containing PCV in DNA sample to be checked, product electrophoresis
There is the nucleic acid belt that 1 molecular weight is 709bp (shown in SEQ ID NO.1)；When gene containing WSSV in DNA sample to be checked, produce
Occurs the nucleic acid belt that 1 molecular weight is 4810bp after object electrophoresis (shown in SEQ ID NO.3).
The testing result of PCV-87R-R and wsv-238-F: if only amplifying a size is 1600bp (SEQ ID NO.2
It is shown) nucleic acid belt, show that sample is infected by WSSV；Gene containing PCV in DNA sample to be checked, then expand without band.
The amplification of primer combination can be mutually authenticated, it is ensured that diagnose accurate (Fig. 3), detect to the kit
The judgement of limit, as a result as shown in Figure 4.
Embodiment 6:
One kind can detect simultaneously freshwater crayfish the end of a thread virus PCV (Procambarus clarkia nima virus) and
The application of the detection kit of White Spot Syndrome Virus WSSV (white spot syndrome virus):
The PVC suspension that embodiment 1 obtains is seeded in healthy freshwater crayfish, selection acquisition is asymptomatic dying after 7 days
Freshwater crayfish carries out Pathogen test and carries out the extraction of gill tissue DNA；The shrimp cheek tissue DNA of infection WSSV is extracted simultaneously.
The extracting mode of shrimp gill tissue DNA are as follows: take its gill tissue, use DNA extraction kit (TaKaRa MiniBEST
Universal Genomic DNA Extraction Kit Ver.5.0, Clontech Products) extract cray gill group
The DNA knitted.Extracting method is referring to specification.Extracted shrimp gill DNA concentration is 5~8 μ g/mL, is frozen spare；Or it is diluted to
0.1~1ng/ μ L carries out PCR amplification as template DNA, using the method for embodiment 2.
The results show that being shown by the shrimp tissue ultra micro sections observation that PCV infects: existing in the cell of these crays a large amount of
Both ends blunt circle, have cyst membrane, baculovirus particles that average diameter is about 250 × 100nm, be sequenced as the embodiment of the present invention 1
Freshwater crayfish the end of a thread virus；PCR amplification is carried out to the shrimp cheek tissue after infection PCV using the method for embodiment 5, only
Amplification obtains the band of one section of 709bp；The DNA is detected using PCV-87R-R and wsv-238-F simultaneously, no band expands
Out.
And after being expanded using shrimp cheek tissue DNA of the method for embodiment 2 to infection WSSV, it is only capable of amplification and obtains one section
The band of 4810bp, at the same using in embodiment 5 PCV-87R-R and wsv-238-F the DNA is detected, be only capable of expanding
Obtain the band of a 1600bp.
Sequence table
<110>Inst. of Hydrobiology, Chinese Academy of Sciences
<120>freshwater crayfish the end of a thread virus PCV-87R specific sequence and application
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 709
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
taggctagtg tcgaaaggta catttcaatg cttgcagcag aagggtgtgc gctccttgca 60
gaaacgcccg ccactcatga gattgagttt gagagatgca taattctagt agaggatttt 120
aatagtggaa ctattacttc aaacactatg cagtacaggt ccaacgctta caaaatcaga 180
gtagtagaag gatcaacaac agatccaggg gaagttgtcc ctgatgattg tttggttttt 240
gccgtagtag taaataagga acaacattct ctagaaatat ctgcaactaa cagatgccaa 300
gacatatgct ttgtaattat tcctcgttta tccgcaatag gaaaaaatgc taccatggta 360
ataaggaaag gtgatgaaat taaacaagaa acctatctgt ttgtggccaa taagaatgac 420
actactcatt tttcaatcat cacagacaag gatgaatctg ttggaataga attaaacatg 480
ctcattttct cagaaagaat tctccccact ttgagtgacc ctgcaaccgt tccaagacct 540
ttgactgacg ccaacgtact gtcagcctac ggaaagcgcc taggtgttgg tgcctttaca 600
gacaaaaatt tattgtccag ccaataaaaa aaatataaaa aaagattgat tgttttattt 660
tcaaaaaaaa ataaaacacc atgggagata agcaaaaggt ggaacagct 709
<210> 2
<211> 1600
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
agctgttcca ccttttgctt atctcccatg gtgttttatt ttttttgaaa ataaaacaat 60
caatcttttt ttatattttt tttattggct ggacaataaa tttttgtctg taaaggcacc 120
aacacctagg cgctttccgt aggctgacag tacgttggcg tcagtcaaag gtcttggaac 180
ggttgcaggg tctctcaaag tggggagaat tctttctgag aaaatgagca tgtttaattc 240
tattccaaca gattcatcct tgtctgtgat gattgaaaaa tgagtagtgt cattcttatt 300
ggccacaaac agataggttt cttgtttaat ttcatcacct ttccttatta ccatggtagc 360
attttttcct attgcggata aacgaggaat aattacaaag catatgtctt ggcatctgtt 420
agttgcagat atttctagag aatgttgttc cttatttact actacggcaa aaaccaaaca 480
atcatcaggg acaacttccc ctggatctgt tgttgatcct tctactactc tgattttgta 540
agcgttggac ctgtactgca tagtgtttga agtaatagtt ccactattaa aatcctctac 600
tagaattatg catctctcaa actcaatctc atgagggaaa gccttttcaa tagtttctcc 660
tactaaaaga cccacttcat ggtttgtgta tttagtaaca agattaagac tattggaaaa 720
atcagctctt tcctcgggtg tggcatattt tccatcgtat tcatcgttga tgtgtttttc 780
tcttagttga cttaatattg tttgtgcaat ttcttcctca tttatattac gggcacggtc 840
ttccgctttg cggatagtgg taccttctaa aaaggccgat gaaacacctg cgagcttgaa 900
caaataatcc cttggttttc cttgtagagt gtctgaggcg tccaattcta attggtcgtc 960
atcaattatt atagtttggg tagaatcatc tcgagataat tgtaaggcag tttctacctc 1020
tgcagatacg aatgcttcat agtattcttt aggttttgaa gatatggaat taagtagacg 1080
ttcttttaga agggctggcg taggctcaaa atcgtctgtg tctgtatccc ctccatttcc 1140
atttccattt ccatttcctc ctccatttcc atttcctcct ccatttgttc caccaccacc 1200
tccttctcct ccacctcctc ctccgtttgt tgttccagaa ccatttccat ttgttccacc 1260
accacctcct tctcctccac ctcctcctcc gcttgttgtt ccagttccat ttccatttgt 1320
tccaccacca cctccttctc ctccacctcc tcctcctccg tttgttgttc cagttcctcc 1380
gtctatgccg tcaccactct cactggtacg atatctcttc ctcttcctcc ttttcctaaa 1440
aggttgagag tcgattgttt ttgcaccatc taaaattgtt attgagacga aaagaaggaa 1500
gaagaataac accaatgacg tagctatgct tatgacgaac attttttctc ttcaaacaga 1560
gtgttgtgcc ttatagtcct atataatacg ggacctgacg 1600
<210> 3
<211> 4810
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
taggctagtg tcgaaaggta catttcaatg cttgcagcag aagggtgtgc gctccttgca 60
aaaacgcccg ccaccataaa caagggaaca atcaagcaat gtgaagaatg gctcttgaaa 120
ataggattgg ctatatattc tcctttgtaa tgggtacggt gacaaatttc aaccaatggg 180
accatcatat ccttgaaacc atgtttctgc atagttctct ccattgactt taaagcgtgc 240
gtgacgttca ttgtactgaa acctaaaccg attaagaaat cggaacttat tatcatacaa 300
tcgtgttttt tttctactgc ttcagaaaga ctattgctca tgtacctgta taattgactg 360
aatttaaagt ccttgtcttt tcgttttaat ttttccttga ctattgtatt gattttacgc 420
acgtcttctt cttgcgttgc aagccattcc tcgtcagtaa cgtgcccagc atcatctttg 480
aataaatgtc caggttcagg aggggcacaa cttatccgtt caattcttaa agagtcatct 540
tctaccaatt cttgtaatct ttttaaccct cttgcgaatt tgagttgttt atctttcttc 600
acatgtacaa caaatgtgtc ttcggacaat tcgctttgtc ttatagattc gatagcttca 660
taaacaccca tgacttgctc atatttactt gttttcttcc cgatcatcag gaatgacgat 720
cttagtttta actccttttc tgatacactt tcattactaa cagggttatt gtttttctct 780
ccaatgtatt ccatatttat cttcttcaaa acaacaacgg aaaatacagt tttcttttaa 840
gaaatatagg ttacaatact gtggattgat aattttactc acagctttgt tcaaaactta 900
actacgtggt tcggcccatt ttgcaccaga tctgttttaa aggaactggg taaaatacac 960
atgaaaacac tccttttgaa caaattcaga tttatatgta tttgtcgatt tttattaata 1020
ttaataaagt atatttttaa aaattaggat ggggacagat ggtgtagatt gatacagtga 1080
ccgtccctgt tattttacct taattttttt tccctataat acaaataatt ggtatcagtt 1140
taggaaaaca tatttttaaa atgaaggtta tcatatcaac taaacacttt tatttacccc 1200
cttttcacct cagaaatatc ctcacataat cgcatgcaag acttgcgcat ttcttccctg 1260
ccgtacaaat caatagcaaa cgctaacgcc aacagatacg tctccacttc tagagatggg 1320
ggttgaacat tacgggaaaa catgtaccct agatacacca gtggaataac taggcaatgg 1380
gaatgataac tcttgaaaat ggggtttaca acaatatcac ccttgtattt tttgagatgg 1440
cacacttcgg ccacaggcac ccatgtatat ttcagaccac ttttccgcat atttccctct 1500
atcgctatta atttttccat gacatcatca gcactaaaac cgagaccaat caaaaaatct 1560
gtgctaacaa caaaacgttc ctcttccccg aaaggtattt gaggaagact ttttgttata 1620
tacctgtaag ttggactgaa ataaaaccct ctaaacaaca tccgtgtctt ttcctttacg 1680
agcttattta cttcctgtac gtctttgtct tgagaagcaa gccactcgtc atcagtagtt 1740
gtagacgtgt ttttaagtat aacgtgtcct ttctcaggct taatagagga taataatgat 1800
tctatcttga gggaattgtc ccctgtgagc tctcttaatt ctttcagtcc cccttcaaaa 1860
gtaatgcgtt tattttcctt taattgtaca atgaaaacgc cgtctctaaa ttcactcttt 1920
cggatagttt caactgcttc aaatgtactc attacttctt catacttttc atattgtttt 1980
tctccaatca ttagaaaaga agagcgtagc tgtaactcgt cttcttcagg tgtctcatcc 2040
aggagattta tcagtttttg ttcccctata tactccatgg tttatttggt cagttgattt 2100
atttttctct ttgacacagt ttttatggta ctctgggatt actttactca aaaatttact 2160
cacatgttgt taaaagtttg agtgtattct tttgtggtaa accaacaatg aagtacattt 2220
cttagtaaat gaggtaggta ctgattcgtg atggataacg atggcgtccc atgtctagtg 2280
atgtgagtca cataataaaa agggaaataa aaataagaac tagtaacata ttttttattt 2340
tatccttctc aatatgttgt ttgatttctt tctaaaaatg gctgctgcaa aaatggacgc 2400
tatccttgcg gatattaatg ggaatgatac agatttatcc aagctaatca cagacgtgat 2460
tcaaaagaga gccaaggctg tcatggatag aaatagggct aaaatggaca tgaatagaag 2520
agtagatgag gctattcagg aagccgtagc ggccaagaaa caaaaagcat tagtggtatt 2580
tgataaactc gtggaagaaa ctgacagcgg acaaagtgtc cctccaacat tatcgggatc 2640
cgattacgac gcgtgggtag acagagccat gccttcgcat attgaacttg tagagagtgt 2700
tgagggagat tctttgtatg ataaactccc tccttttaac gtacaagaca tagacgacca 2760
aatcggtgat gagatagata caccaatatc ttaccttgcc atggtagtgg taaaagtcga 2820
ctgtgaaact ggggatatcg aagaagagta caatcttgct cctacctttg gtgtgacaca 2880
aaataataaa atatacagag atgaaagaga ccagattttt acaaaggctg ataaatctgt 2940
gcgtattttt aaacttgcta aattggatag tatatcaggt aaaagtagac aactgacgta 3000
tgcggtaaaa aataacaatg agtatacaga gtttgtctgt agcgtctttg cagagtttga 3060
atctgacagt gacactacta aatcaggtat aggtattcgt gaatatgaca aacctaaaaa 3120
tgaattcgaa tatgaggagc gagagatctt tacatttttt attccaatac aacccgcagg 3180
gacgaaatta ttgttatact ttttggtgga cgtcaggtcc cgtattatat aggactataa 3240
ggcacaacac tctgtttgaa gagaaaaaat gttcgtcata agcatagcta cgtcattggt 3300
gttattcttc ttccttcttt tcgtctcaat aacaatttta gatggtgcaa aaacaatcga 3360
ctctcaacct tttaggaaaa ggaggaagag gaagagatat cgtaccagtg agagtggtga 3420
cggcatagac ggaggaactg gaacaacaaa cggaggagga ggaggtggag gagaaggagg 3480
tggtggtgga acaaatggaa atggaactgg aacaacaaac ggaggaggag gtggaggaga 3540
aggaggtggt ggtggaacaa atggaaatgg ttctggaaca acaaacggag gaggaggtgg 3600
aggagaagga ggtggtggtg gaacaaatgg aggaggaaat ggaaatggag gaggaaatgg 3660
aaatggaaat ggaaatggag gggatacaga cacagacgat tttgagccta cgccagccct 3720
tctaaaagaa cgtctactta attccatatc ttcaaaacct aaagaatact atgaagcatt 3780
cgtatctgca gaggtagaaa ctgccttaca attatctcga gatgattcta cccaaactat 3840
aataattgat gacgaccaat tagaattgga cgcctcagac actctacaag gaaaaccaag 3900
ggattatttg ttcaagctcg caggtgtttc atcggccttt ttagaaggta ccactatccg 3960
caaagcggaa gaccgtgccc gtaatataaa tgaggaagaa attgcacaaa caatattaag 4020
tcaactaaga gaaaaacaca tcaacgatga atacgatgga aaatatgcca cacccgagga 4080
aagagctgat ttttccaata gtcttaatct tgttactaaa tacacaaacc atgaagtggg 4140
tcttttagta ggagaaacta ttgaaaaggc tttccctcat gagattgagt ttgagagatg 4200
cataattcta gtagaggatt ttaatagtgg aactattact tcaaacacta tgcagtacag 4260
gtccaacgct tacaaaatca gagtagtaga aggatcaaca acagatccag gggaagttgt 4320
ccctgatgat tgtttggttt ttgccgtagt agtaaataag gaacaacatt ctctagaaat 4380
atctgcaact aacagatgcc aagacatatg ctttgtaatt attcctcgtt tatccgcaat 4440
aggaaaaaat gctaccatgg taataaggaa aggtgatgaa attaaacaag aaacctatct 4500
gtttgtggcc aataagaatg acactactca tttttcaatc atcacagaca aggatgaatc 4560
tgttggaata gaattaaaca tgctcatttt ctcagaaaga attctcccca ctttgagaga 4620
ccctgcaacc gttccaagac ctttgactga cgccaacgta ctgtcagcct acggaaagcg 4680
cctaggtgtt ggtgccttta cagacaaaaa tttattgtcc agccaataaa aaaaatataa 4740
aaaaagattg attgttttat tttcaaaaaa aataaaacac catgggagat aagcaaaagg 4800
tggaacagct 4810
<210> 4
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
taggctagtg tcgaaaggta cattt 25
<210> 5
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
agctgttcca ccttttgctt atctc 25
<210> 6
<211> 25
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
cgtcaggtcc cgtattatat aggac 25
Claims (6)
1. a kind of freshwater crayfish the end of a thread virus PCV-87R specific sequence, sequence is shown in SEQ ID NO.1.
2. the primer based on sequence design described in claim 1.
3. primer according to claim 2, primer are as follows:PCV-87R- F:taggctagtgtcgaaaggtacattt andPCV-87R- R:agctgttccaccttttgcttatctc.
4. specific sequence described in claim 1 or primer as claimed in claim 2 are examined preparing freshwater crayfish virosis
Application in disconnected reagent.
5. a kind of freshwater crayfish virus diagnostic kit, including primer:PCV-87R- F:
taggctagtgtcgaaaggtacattt、PCV-87R- R:agctgttccaccttttgcttatctc andwsv-238- F:
cgtcaggtcccgtattatataggac。
6. kit described in claim 5 is preparing while detecting freshwater crayfish the end of a thread virus and white spot syndrome disease
Application in malicious detection kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910307663.0A CN110184385B (en) | 2019-04-16 | 2019-04-16 | Freshwater crayfish thrum virus PCV-87R specific sequence and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910307663.0A CN110184385B (en) | 2019-04-16 | 2019-04-16 | Freshwater crayfish thrum virus PCV-87R specific sequence and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110184385A true CN110184385A (en) | 2019-08-30 |
| CN110184385B CN110184385B (en) | 2022-12-06 |
Family
ID=67714640
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910307663.0A Active CN110184385B (en) | 2019-04-16 | 2019-04-16 | Freshwater crayfish thrum virus PCV-87R specific sequence and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110184385B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110540996A (en) * | 2019-08-29 | 2019-12-06 | 华中农业大学 | Procambarus clarkii i-type lysozyme gLysi2 gene, gLysi2 protein coded by same and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1873026A (en) * | 2006-04-11 | 2006-12-06 | 浙江大学 | Two-temperature multiple PCR detectionmethod for prawn leukoplakia and taura syndrome virus |
| CN107287354A (en) * | 2017-08-09 | 2017-10-24 | 集美大学 | A kind of method that ring mediated isothermal amplification method detects WSSV |
| CN109234454A (en) * | 2018-09-30 | 2019-01-18 | 广西壮族自治区兽医研究所 | A kind of the duplex PCR detection primer group and kit of quick differentiation PCV3 and Mhp |
-
2019
- 2019-04-16 CN CN201910307663.0A patent/CN110184385B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1873026A (en) * | 2006-04-11 | 2006-12-06 | 浙江大学 | Two-temperature multiple PCR detectionmethod for prawn leukoplakia and taura syndrome virus |
| CN107287354A (en) * | 2017-08-09 | 2017-10-24 | 集美大学 | A kind of method that ring mediated isothermal amplification method detects WSSV |
| CN109234454A (en) * | 2018-09-30 | 2019-01-18 | 广西壮族自治区兽医研究所 | A kind of the duplex PCR detection primer group and kit of quick differentiation PCV3 and Mhp |
Non-Patent Citations (3)
| Title |
|---|
| 张奇亚: "国内外对虾病毒病研究综述", 《现代渔业信息》 * |
| 张奇亚: "淡水生态系统中几种大DNA病毒研究概述", 《水生生物学报》 * |
| 黄灿华等: "对虾白斑综合征杆状病毒同源性比较的研究", 《中国病毒学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110540996A (en) * | 2019-08-29 | 2019-12-06 | 华中农业大学 | Procambarus clarkii i-type lysozyme gLysi2 gene, gLysi2 protein coded by same and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110184385B (en) | 2022-12-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Friedman et al. | Herpes virus in juvenile Pacific oysters Crassostrea gigas from Tomales Bay, California, coincides with summer mortality episodes | |
| Gilad et al. | Initial characteristics of koi herpesvirus and development of a polymerase chain reaction assay to detect the virus in koi, Cyprinus carpio koi | |
| CN103966358B (en) | A kind of mandarin fish infectious spleen and kidney necrosis virus fluorescent quantificationally PCR detecting kit and detection method | |
| CN108384899B (en) | Fluorescent quantitative PCR kit for detecting novel goose astrovirus and application thereof | |
| CN109234450B (en) | Monopterus albus rhabdovirus CrERV RT-CPA detection primer and application | |
| CN107385111A (en) | The real-time fluorescence quantitative PCR detection primer and its kit of a kind of goose astrovirus | |
| CN104372104B (en) | A kind of LAMP detection primer composition of camphor tree phytophthora and LAMP detection kit thereof and LAMP detection method | |
| CN107012261A (en) | Ana 1 aviadenovirus A types and the dual EvaGreen real-time fluorescence quantitative PCRs detection primer of 2 types | |
| CN109609688A (en) | Goose astrovirus, goose's paramyxovirus, goose parvovirus multiple PCR detection primer pair and detection method and application | |
| CN111676296A (en) | Test strip RPA primer for detecting potato rot stem nematode and detection kit thereof | |
| CN109207641A (en) | A kind of multiple RT-PCR detection kit and application | |
| CN105002298B (en) | A kind of fluorescent quantitative PCR detection method of huichun viremia virus | |
| Poulos et al. | Use of non-radioactively labeled DNA probes for the detection of a baculovirus from Penaeus monodon by in situ hybridization on fixed tissue | |
| CN103205511A (en) | Primer pair for detecting pigeon torque teno viruses and application of primer pair | |
| CN101514373B (en) | Method for quickly detecting duck viral enteritis by real-time fluorescence quantitative PCR and kit thereof | |
| Qiu et al. | Confirmation of susceptibility of swimming crab to infection with decapod iridescent virus 1 | |
| Gould et al. | A polymerase chain reaction (PCR) to detect epizootic haematopoietic necrosis virus and Bohle iridovirus | |
| CN110184385A (en) | Freshwater crayfish the end of a thread virus PCV-87R specific sequence and application | |
| CN102876809B (en) | GCRV (grass carp reovirus) RT-PCR (reverse transcription-polymerase chain reaction) detection reagent kit and detection method | |
| CN109266785B (en) | Monopterus albus rhabdovirus CrERV RT-LAMP detection primer and application | |
| CN101886128A (en) | Real-time fluorescence PCR assay kit for Chinese sturgeon and detection method thereof | |
| CN109187970B (en) | It is a kind of quickly to detect aquatic products disease gold mark nucleic acid test strip and preparation method thereof | |
| Murray et al. | Aquatic bird Bornavirus-associated disease in free-living Canada geese (Branta canadensis) in the northeastern USA | |
| CN109234451A (en) | A kind of Tilapia mossambica parvovirus TiPV CPA detection primer and application | |
| CN112094854B (en) | Specific primer, probe and kit for detecting pelodiscus sinensis flavivirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |