CN109234450B - Monopterus albus rhabdovirus CrERV RT-CPA detection primer and application - Google Patents
Monopterus albus rhabdovirus CrERV RT-CPA detection primer and application Download PDFInfo
- Publication number
- CN109234450B CN109234450B CN201811047925.6A CN201811047925A CN109234450B CN 109234450 B CN109234450 B CN 109234450B CN 201811047925 A CN201811047925 A CN 201811047925A CN 109234450 B CN109234450 B CN 109234450B
- Authority
- CN
- China
- Prior art keywords
- rhabdovirus
- crerv
- cpa
- eel
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to the field of virus detection, and particularly discloses a finless eel rhabdovirus CrERV RT-CPA detection primer and application thereof.
Description
Technical Field
The invention belongs to the technical field of virus molecule detection, and particularly relates to a ricefield eel rhabdovirus CrERV RT-CPA detection primer and application thereof.
Technical Field
Rhabdoviridae (Rhabdoviridae) are a class of negative strand RNA viruses with a broad host range, the particles of which are bullet-shaped or rod-shaped. The Rabies virus (Rabies virus) is the best known and can cause Rabies of human beings or other warm-blooded animals, the fatality rate is almost 100 percent, the wide attention in the world is caused, and the panic of the society on the safety of cultured pets is caused. Therefore, the intensive study of rhabdoviruses is of great significance. In addition, rhabdoviruses can cause a variety of acute infectious diseases in livestock (e.g., bovine epizootic fever), as well as infectious diseases in fish and various crops. The International Committee for virus Taxonomy (International Committee on Taxonomy of Viruses, ICTV) published the tenth report of the latest virus Taxonomy in 2017, dividing the Rhabdoviridae (Rhabdoviridae) into 18 genera, among which the rhabdoviruses capable of infecting fish are three genera, perhabdivirus, Sprivivirus and novirhabdivirus. At present, the three genera can infect various cultured fishes, have strong pathogenicity, the death rate can reach 100 percent, and cause great economic loss to the global sea fresh water culture industry, particularly, according to the inspection and quarantine protocol of live aquatic animals at the entrance and exit, the cultured fishes entering and exiting the border, such as culture and fingerling of weever, carp, rainbow trout, crucian, paralichthys olivaceus and the like, are subjected to rhabdovirus (IHNV, SVC V, HIRRV) epidemic disease detection, the entrance and exit safety significance is great, and the economic trade of the entrance and exit is influenced.
the current research on the Rhabdoviridae infected with fish mainly focuses on two genera, Sprivivirus and Novirrabdvovirus, while the genus Perhabdovirus is a newly named genus of the Rhabdoviridae in 2017, and the research on the genus is very little. Currently, the genus includes mandarin fish rhabdovirus, which is capable of causing massive death of mandarin fish. At present, the full-length sequence of the ricefield eel rhabdovirus (CrERV) has not been reported publicly, and an effective detection method is not available.
the application separates and obtains ricefield eel rhabdovirus (CrERV) from infected ricefield eels for the first time, designs specific primers aiming at the difference of the mandarin fish rhabdovirus and the ricefield eel rhabdovirus in P gene structure, establishes an RT-CPA detection method which is not only used for detecting and monitoring the health condition of the cultured ricefield eels, but also can distinguish the ricefield eel rhabdovirus from the mandarin fish rhabdovirus through sequence comparison. Provides guarantee for early pathogen detection and monitoring in finless eel and mandarin fish culture.
Disclosure of Invention
the invention aims to provide a ricefield eel rhabdovirus CrERV RT-CPA detection primer, wherein the primer is 1s: CAGGATATACGACCCAATC;2a1s: TAACTCTTTGAGCAGGCCTCAGGATATACGACCCAATC; 2a: TAACTCTTTGAGCAGGCCT; CATCAGATTCATGTGTACA a; CAGAAGTCTCAGGACCACCA for 4 s; AGGGATGGGCTGCCTTGGAGC a.
The invention also aims to provide application of the ricefield eel rhabdovirus CrERV RT-CPA detection primer, which comprises the step of preparing the ricefield eel rhabdovirus detection kit by using the primer.
In order to achieve the purpose, the invention adopts the following technical measures:
A detection primer of ricefield eel rhabdovirus CrERV RT-CPA comprises 1s: CAGGATATACGACCCAATC;2a1s: TAACTCTTTGAGCAGGCCTCAGGATATACGACCCAATC; 2a: TAACTCTTTGAGCAGGCCT; CATCAGATTCATGTGTACA a; CAGAAGTCTCAGGACCACCA for 4 s; AG GGATGGGCTGCCTTGGAGC, wherein the preservation number of the ricefield eel rhabdovirus CrERV is as follows: CCTCC NO: v201819.
An application of a finless eel rhabdovirus CrERV RT-CPA detection primer comprises the steps of preparing a detection kit for detecting finless eel rhabdovirus by using the primer or directly detecting the finless eel rhabdovirus, wherein the preservation number of the finless eel rhabdovirus CrERV is as follows: CCTCC NO: v201819.
A non-diagnostic detection method of ricefield eel rhabdovirus comprises the following steps:
After the RT-CPA detection primer provided by the invention is detected to be positive, the judgment is carried out according to clinical symptoms after the finless eel is infected, and if the finless eel is swollen in head, the finless eel rhabdovirus CrERV is judged to be infected; if the ricefield eel has a bleeding phenomenon, the ricefield eel is judged to be infected by the mandarin fish rhabdovirus, and the preservation number of the ricefield eel rhabdovirus CrERV is as follows: CCTCC NO: v201819.
Compared with the prior art, the invention has the following advantages:
1. The invention separates and clones the full-length sequence of the rhabdovirus from the finless eel for the first time, and has pioneering significance for the research of the finless eel rhabdovirus.
2. The method of the invention is rapid, simple and convenient: the RT-CPA method established by the invention only needs 1h, and greatly improves the detection efficiency compared with the traditional virus separation method for several days and the traditional RT-PCR for several hours.
3. The method of the invention has strong specificity: the recognition of the primer to the specific sequence area of the target sequence ensures the high specificity of the amplification of the RT-CPA method.
Drawings
FIG. 1 is a schematic diagram showing that the main clinical symptom of the finless eel fries infected with the finless eel rhabdovirus provided by the invention is head swelling.
Detailed Description
the technical scheme of the invention is a conventional scheme in the field if not specifically stated, and the used reagents or raw materials are purchased from commercial sources or published if not specifically stated.
example 1:
a finless eel rhabdovirus CrERV is isolated as follows:
1) Taking out and grinding the tissues of the spleen, the kidney and the like of the finless eel carrying the virus, diluting the culture medium by 100 times, centrifuging at 2000rpm, taking the supernatant for filtering, inoculating the supernatant to a crucian carp brain cell line (GibelC Captain, GiCB) monolayer, and culturing at 25 ℃ for 7 days to generate cytopathic effect (CPE), so that the shrinkage and rounding of the GiCB cell and the increase of the refractivity can be seen, part of the cells begin to fall off, and the cell monolayer begins to break.
culture medium: m199, 10% fetal bovine serum, pH 7.0-7.2
2) collecting pathological cells, and performing morphological identification by using a transmission electron microscope.
3) And collecting the virus, and carrying out whole genome sequencing on the virus, wherein the sequence is shown as SEQ ID NO. 1.
Morphological characteristics of ricefield eel rhabdovirus: the virus is bullet-shaped or spindle-shaped, has a double-layer lipid envelope and conforms to the shape of a typical rhabdovirus, and is delivered to the China center for type culture Collection for storage at 24 months 4 and 2018, and is classified and named as follows: finless eel rhabdovirus (Chinese rice-field eel rhabdovirus) CrERV, accession number: CCTCC N O: v201819, address: wuhan university in Wuhan, China.
Research shows that the mandarin fish rhabdovirus can infect the ricefield eels, but clinical symptom characteristic comparison results show that the ricefield eels infected with the mandarin fish rhabdovirus mainly have bleeding phenomena, however, the clinical symptoms of rhabdovirus isolated from diseased finless eels in the application are mainly head enlargement, the two clearly contrast (figure 1), the complete sequence analysis result shows that the homology of the mandarin fish rhabdovirus and the finless eels rhabdovirus isolated and identified in the application is 92 percent at most, however, the phosphoprotein gene (P) of finless eel rhabdovirus isolated and identified in the present application was found to consist of one large Open Reading Frame (ORF) (864bp) by gene structure analysis, the gene is obviously different from two ORFs contained in the P gene of the mandarin fish rhabdovirus (the large ORF size is 849bp, the small ORF size is 219bp), and the sizes of the open reading frames of the two rhabdoviruses are different. The two viruses have different tendencies to infect hosts and have obvious difference in clinical symptoms after infection, so that the two viruses cannot be classified as one virus. Wherein, the classification status of the finless eel rhabdovirus related in the application belongs to the genus Perhabdov irus,
Example 2:
Primers designed based on the difference between the complete sequence of the ricefield eel rhabdovirus CrERV (shown in SEQ ID NO. 1) and the complete sequences of other viruses:
A detection primer of ricefield eel rhabdovirus CrERV RT-CPA comprises 1s: CAGGATATACGACCCAATC;2a1s: TAACTCTTTGAGCAGGCCTCAGGATATACGACCCAATC; 2a: TAACTCTTTGAGCAGGCCT; CATCAGATTCATGTGTACA a; CAGAAGTCTCAGGACCACCA for 4 s; AG GGATGGGCTGCCTTGGAGC a.
example 3:
The method for detecting the ricefield eel rhabdovirus by utilizing the ricefield eel rhabdovirus CrERV RT-CPA detection primer comprises the following steps:
1. Extracting total RNA of the finless eel tissues or infected cells and synthesizing cDNA: the total RNA of the sample to be detected is extracted. Configuring a reverse transcription reaction system: mu.L of total RNA, 1 mu.L of oligo (dT)18primer, 8 mu.L of sterilized double distilled water, uniformly mixing, and immediately performing ice bath at 65 ℃ for 5 min; adding 4 ul of 5 × Reaction Buffer, 1 ul of RNase inhibitor, 2 ul of 5mM dNTP Ps and 1 ul of M-MLV reverse transcriptase into the Reaction solution in the ice bath, uniformly mixing, and storing the obtained cDNA template at-20 ℃ for later use at 1h at 42 ℃ and 5min at 95 ℃.
2. polymerase chain reaction amplification:
A25. mu.l reaction was used: reaction Buffer 2.5. mu.L, Betaine 0.7mol/L, Bst DNA polymerase 8U, primer 2a1s 1.0.0. mu. mol/L, primers 2a, 3a each 0.5. mu. mol/L, primers 4s, 5a each 0.6. mu. mol/L, Mg2+8.0mmol/L, dNTPs 1.2mmol/L, template DNA 1. mu.L, and nuclease-free water to 25. mu.L. The optimal reaction condition is isothermal amplification at 63 ℃ for 60 min.
1s:CAGGATATACGACCCAATC;2a1s:TAACTCTTTGAGCAGGCCTCAGGATATACGACCCAATC;
2a:TAACTCTTTGAGCAGGCCT;3a:CATCAGATTCATGTGTACA;4s:CAGAAGTCTCAGGACCACCA;5a:
AGGGATGGGCTGCCTTGGAGC。
Analysis of amplification products of RT-CPA reaction:
1. Taking 5 mu L of amplification product, carrying out electrophoresis by using 2% agarose gel, then placing the amplification product in a gel imaging system for imaging, wherein an electrophoresis picture shows a ladder-shaped CPA characteristic band, and the result is positive; if there is no band, the result is negative.
2. And (3) carrying out visual detection on the reaction product by using a nucleic acid detection test strip after the reaction is finished, dripping the product into 5 mu L of the test strip, standing for 1-5 min, and observing the result, wherein if two red lines appear: one is located in the detection area (T), the other is located in the quality control area (C), the detection is judged to be positive, namely, a reaction occurs; if only one red line located in the quality control area appears, judging that the test result is negative; if no red line appears, the detection result is invalid.
Example 4:
Monopterus albus rhabdovirus RT-CPA detection primer specificity test
By using the method described in embodiment 3, the virus sample to be detected in table 1 is detected, and a negative control group (double distilled water) and a positive control group (CrERV) are set at the same time, wherein the virus sample to be detected specifically comprises: spring Viremia of Carp Virus (SVCV), grass carp reovirus 873(GCRV-873), mandarin fish rhabdovirus (SCRV), Infectious Hematopoietic Necrosis Virus (IHNV).
TABLE 1 specificity test of Monopteri albi rhabdovirus RT-CPA detection kit
The results are shown in table 1, only the positive control group (CrERV) and the mandarin fish rhabdovirus (SCRV) can detect characteristic bands, and the rest groups have no characteristic bands, which indicates that the finless eel rhabdovirus CrERVRT-CPA detection primer has strong specificity. Through the analysis of the characterization characteristic results of the finless eel infected by the finless eel rhabdovirus and the finless eel infected by the mandarin fish rhabdovirus, the diseased finless eel infected by the finless eel rhabdovirus mainly shows head swelling, particularly, the head swelling of fries is obvious, and no bleeding phenomenon is found at present; siniperca chuatsi rhabdovirus infected by the Siniperca chuatsi rhabdovirus mainly presents a body surface bleeding symptom, and the Siniperca chuatsi rhabdovirus can be distinguished from the Siniperca chuatsi rhabdovirus through the analysis of the clinical symptom result.
Example 5:
sensitivity of ricefield eel rhabdovirus RT-CPA detection primer
The CrERVcDNA template with the concentration of 1500 ng/mu L is diluted by 10 times in a gradient manner, the method of the embodiment 3 is utilized to detect the detection limit of the primer RT-CPA provided by the invention, and a target band can be detected by 106 times of dilution, namely the cDNA template with the lowest detectable concentration of 30.00 pg/mu L.
example 6:
The application of the ricefield eel rhabdovirus RT-CPA detection primer in the preparation of the ricefield eel rhabdovirus detection kit comprises the following steps:
1. Extracting total RNA of the finless eel tissues and synthesizing cDNA: the total RNA of the spleen and kidney and other visceral tissues of the finless eel infected with the finless eel rhabdovirus is extracted. Configuring a reverse transcription reaction system: mu.L of total RNA, oligo (dT)18prime r 1 mu.L, 8 mu.L of sterilized double distilled water, uniformly mixed at 65 ℃ for 5min and immediately subjected to ice bath; adding 4 ul of 5 × Reaction Buffer, 1 ul of RNase inhibitor, 2 ul of 5mM dNTPs and 1 ul of M-MLV reverse transcriptase into the Reaction solution in the ice bath, uniformly mixing, and storing the obtained cDNA template at-20 ℃ for later use at 1h at 42 ℃ and 5min at 95 ℃.
RT-CPA reaction amplification:
A25. mu.l reaction was used: reaction Buffer 2.5. mu.L, Betaine 0.7mol/L, Bst DNA polymerase 8U, primer 2a1s 1.0.0. mu. mol/L, primers 2a, 3a each 0.5. mu. mol/L, primers 4s, 5a each 0.6. mu. mol/L, Mg2+8.0mmol/L, dNTPs 1.2mmol/L, template DNA 1. mu.L, and nuclease-free water to 25. mu.L. The optimal reaction condition is isothermal amplification at 63 ℃ for 60 min.
1s:CAGGATATACGACCCAATC;2a1s:TAACTCTTTGAGCAGGCCTCAGGATATACGACCCAATC;
2a:TAACTCTTTGAGCAGGCCT;3a:CATCAGATTCATGTGTACA;4s: CAGAAGTCTCAGGACCACCA;5a:
AGGGATGGGCTGCCTTGGAGC。
RT-CPA reaction amplification product analysis:
1. Taking 5 mu L of amplification product, carrying out electrophoresis by using 2% agarose gel, then placing the amplification product in a gel imaging system for imaging, wherein an electrophoresis picture shows a ladder-shaped CPA characteristic band, and the result is positive; if there is no band, the result is negative.
2. and (3) carrying out visual detection on the reaction product by using a nucleic acid detection test strip after the reaction is finished, dripping the product into 5 mu L of the test strip, standing for 1-5 min, and observing the result, wherein if two red lines appear: one is located in the detection area (T), the other is located in the quality control area (C), the detection is judged to be positive, namely, a reaction occurs; if only one red line located in the quality control area appears, judging that the test result is negative; if no red line appears, the detection result is invalid.
The results show that the positive control (the ricefield eel rhabdovirus CrERV) shows a trapezoidal characteristic band, the negative (water) control has no obvious band, and the ricefield eel tissue samples infected with the ricefield eel rhabdovirus CrERV from No.1 to No. 5 show obvious trapezoidal characteristic bands, which indicates that the samples from 1 to 5 are ricefield eel rhabdovirus positive and are consistent with the actual situation.
Sequence listing
<110> Changjiang aquatic products institute of aquatic science and research in China
<120> ricefield eel rhabdovirus CrERV RT-CPA detection primer and application
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 11545
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
acgagaaaaa agaaaccaat atacagaata tcaagattat tggatttctt tttctcgaca 60
ttaaaaatgt caacagacat catatctgaa cctccaagaa tggaaaacca aatcatcaag 120
agagtgtcta ctggagctga agtcaaggca gttctgcctg caactgaagc tcaggccact 180
tatccagcag atgggatggc agatggggcg atgccactca tcattattga attcaaagat 240
ctaaccgcat cggaaatcaa gcagatgatc ctcgccggaa ttcaagagag gagactggat 300
gcggacattg tggtccgcta tctctatgag gttgtccaac actggaatga agttaacaac 360
aatgagatct ggacatcctt tggaatcggg ttggctaaaa ttgggcaaga ggtcaacccc 420
ctcaacctgc tgaaagttcg ctatggaaga agggcagttc cagactttgc agtggctcaa 480
ggacagactg atgttcaaga caaggccctc gtgatcctgt tgttggggat ctaccgagtg 540
gcatctatca caaacgacgc gtataaaaca cgtgtcatgg atgcaatcca gcagcaagcc 600
ttagaggcag atcctaaagt ccagcttaac atcagagtac tagctggcaa caaacatttg 660
ctgtccaatc caaattatct cagaatggtg gcagcaattg acatgttctt ttacagattc 720
aaggagtctg agagagcgaa tgtcagagtt tcaactctga catccagatt taaagactgt 780
gcagctctat caacatttgc tcatgtcgca tcattcactg gattaaccct cagtggagtg 840
ctggattggg tgttcacgga gactgtcgca gctgaagtgg agaggatgat gaaaccaggc 900
caagagattg accaagaggc atcttacatg ccttatttaa aagacatggg actatctaaa 960
gtgtcccctt actctgccac aaagaatcca ggattccatg catggggaca atcggcttgc 1020
gccctcatgg gatccatcag atcacagaac gccctgcgag catcagagga caattggctg 1080
aacctcaagc tcaatgctga aatcatggcg ttcgccctgg gaacatctgc agagctggta 1140
aaggcttttg acatcggagg caacactgat gaccaagatg acggaggagc ttttgagggt 1200
gagctgaatc taacagaaga tgctggaatg cccaaaaaga gagatgccat ggagtggttc 1260
atgtacatgg aaggcagaga cttcaagctg acagaggaga tgaaggaagg actgaggaga 1320
atggccggaa atatcaagaa cccaaggcct ggaaccatcg gtgatctgct gaagcaccaa 1380
actttgtgag caatcctcga gtcaagagaa atgaaattat atgttattgt gccacatgaa 1440
tatggtctca agtgaccgct ttattgtgag aatgtggagg agcattagtt acttaagggt 1500
caataaggtg atgggatatg aaaaaaactt taacagagat catggcaaaa ccagttttcc 1560
agatatctta tgatcttgag aagttggcta ccaacttcga ggaactcaat ttggctgaat 1620
tgaagcgaaa tggagaggac ccagatgatc ccttggaatg gaaatcatcc cctgacttct 1680
tgccttacgc agcatctcag gaagcagagg agtatgaaca gggagagcaa gaaatggagt 1740
gtattgatga atatactcct gctgactctt cctggacagc agaagtctca ggaccaccaa 1800
tcctcccagg atatacgacc caatctagat ggtttggacc tggagtgaca gcagagacca 1860
agccaatcat attggaagag ttggctagtg tcttgcagca gatcggaatc aagctgattt 1920
cagctgctcc ttctgcggat gccaattatt acttgttata ccccaatgta cacatgaatc 1980
tgatggcccc aggagtcctt gagagtggaa gaccactacc cccctgtcta gctccagccg 2040
aagcacccaa accacccgcc gcgccagccc caggcctgct caaagagtta cctcctgctc 2100
caaggcagcc catccctgcc ctgttggggc aaagtttgac cgggccgatc ccaaatgatg 2160
atgatgtcag agctgtgctc tgggcttctg gaataagggt agttgaaaag aagaccaaca 2220
aaacagctat cctcaagcca tgtgccttag gctggatgat agacgactgg ctgcaagtag 2280
acatcggggc ggaaacagac attgctgaaa tctttaaaaa gatgttggcg aaaactccca 2340
gccgaaaatt gatgatgtac aagtacatcc ctctcgaggt aattcagcaa atggtgctgt 2400
tctaataatc caaattaaat aagtatgtca tgacgattca aattgtgatc ttaattctaa 2460
tttcttttat actttagtgg tgtcggggag atatgaaaaa aactttaaca gatatcatag 2520
aatatccacg aaagatgcct ctgttcaaga agagcaacaa gaagttggct attaagccgt 2580
atcaagcacc tccgccgtac tcggcgactg cactcactcc gagtgctcct atggccctgc 2640
ctgacagtga ctatggaatc aaaacaatga tggtggagtt ggacttcaaa atcatatcca 2700
gcatcgagct gaaaacgatt ggcaagattt accaaattgc gcaatacatg ctggatgatt 2760
atactggtcc aattcggagt aagcctctgt atatgggcct gttcctcgca tcatgccaca 2820
atgccattaa tccatcaatg gtccatggaa agtggcatta tgagatacag tttaggggcc 2880
caataggatt caatctggca aacaacacac ccctggactg ggtctgtaac catgttgcca 2940
gatcttatga gtgttactct cgagatcaat cactggtcag ctacacctgc aatatgcgcg 3000
ccacatagat gagaggatca tctcgtgagt agatgttcca cgctgtgttg gtgcagcgct 3060
cagctgagtc tgtgttcgga attatccaga tggcagaagc agaggtccga ggagacgaca 3120
tgctgtatgt cctgagtgat cgtggtcgta gctggcatta ataagatcgg aacgaattga 3180
ctctgaatct acaaatgacc gacaccacga ggctcactct ctgaagaagg ctcatgacgt 3240
gaatcacctg cagaccatga gccaatcaga tccgactaca ttaatgcaac attcactttc 3300
tcttatatat ggggcacgtc ttacgttttt aaatgtataa ggtcacaatt atgtcatccg 3360
ccaatgcggc gtattagctg atacgcatat cgataattat atatgtatcc ttaactatta 3420
atcagtctga ttggtggtcg ttatgaaaaa aacttaacag atttcatcat gaaattaatc 3480
attgcactca cgttgatctc ccaggcgatt ggctatccac tgtttgttcc gatcagactt 3540
caaggatggc atgatgttaa actagatact ttgatgtgtc ccagttatgc atctgagctg 3600
aataaggagg ccgcttggcc acagattgga ttgagacatc tcgctgcgac agattattat 3660
ggagcaaaag ggacaatctg ccataagacc atctgggtga aaacttgtga tttcagatgg 3720
tatggaccta ggtatattac gaccaagatt tcgtacgcac ctataaccgg actagaatgt 3780
caacaggcag tagtcaaggc atccaaagat gagctagaga caccatacat gccagaagct 3840
aactgcaatt gggctacagt cagtgataat gaaaagacat ttatcacagt ccaaaagagc 3900
aacatcttca tggaccctta taacatggtc tatgtaagcg caatcttaaa aggaggaaaa 3960
tgtgcaagca aagtctgccc actcgagatg catggaggaa tttggatacc cagcgaagca 4020
cccaaagaga gttgcaaact gagcagcagc accactagcc acatcaatcc caacagtgcc 4080
tccaggttag taacagatgc aagttatttg gttacggagt atcatcgaca actgccgttc 4140
ttaggagctt gtaagatgtc aatgtgcgga gaggtaggaa tgaggtttaa gtctggagaa 4200
tggtacaaga ttgagtcaag cgacggacgg gtgctgtcct ttctcgatag tgttccaatg 4260
tgtgatggag agctgactgt ctccatccat gacagctcag ctacgtatca caaattgagc 4320
caggaaatcc ttgatctgtc cgcacaaatt gcttgcatat ccgaattgcg aagagccaga 4380
gagaagggag cagttagcaa ctacctcttg agtttcctaa caccaaacca tggagggttt 4440
gggacggcat accgggtgtt caacggacag ttgcaagctt ccaaggccac ttatgcaaga 4500
gtgagactcg gtgctctctc cactgcaaca aattggggac aattagataa tggcagtgca 4560
tactcttcag aagatgtcac aggcgagata atcgatggac ccctattcaa tgggaatcgg 4620
atggacaatg ggactcttag gatcgttcag aatgcaatat tgggccagac actagaagat 4680
gaagatttat atgaacattc agcaaaagag attctccatc cgcatctgac aatcctaagc 4740
aataatgaat cggacgtgct gtctgcattt cgtcctgtag gtgcccaagg cgatatcata 4800
catgcagtgg gtgagtgggt aggaactgga gtgagtggat ttatccatac tattgtctat 4860
ctggtggtct tctgtggcat cattcttctc ctttacagat gtttgccata tttcctgaaa 4920
aaacgaaaat cacagtcggc gggtcgggtg actcctcaaa tgatcccttt gcagcaatat 4980
caatttgttc cctaaatgac ttgtattgat tgaaccattg ttatactctt tattacaagc 5040
tcttgaatgg gtgattcttc ttcttcatga tatattatct agatgatggg ttaataaagt 5100
gggtatgaaa aaaactttaa cagtgatcat ggattattct caggaatatg tcgatgatta 5160
cgatgatcca tttgcggaat acgaggcttt ctcaaatttt caagattttt ttgaaaaagg 5220
gagaccactg aatcagaaag attacaacct gaattctccg ttgatcggag atgagattga 5280
tgcattcctc acatacctca aaacacacag tatctctgca agatttgtga gagacaaaaa 5340
aagatgggag ctttacaaag agcatgtact gtatcctcac ttgatgatcc aagaccacac 5400
tgtcatacat aaatggttag ggaatcattt gctgaatatg caacaaacac aagaatataa 5460
aactttggtg agtcgtgtaa atgaaatgac aagatcggca gatgagatac ttcaaccttt 5520
tctaaaggga tggaaaggtg agtccacatc accaactaga aaagacccaa atttgttaca 5580
acatacaggt ctggaatatg gatcaggatt tctcggctgg cacaaagtta cactattgat 5640
gaatagtcag acaagattag aaagagaaaa tctgataaca tctgagttcc aaggcctgga 5700
gtctgttcta gaatcagatg acttatggat agggagaatc aaagatccat gtattggtac 5760
ttggatcatc actgataatc tagtctggag caacaaaagt ggaattctac tagacaaaaa 5820
tacagttatg atgatcaaag acaccttgat aggccgcatt cagacgctat tgagcttaat 5880
aaatcgagaa gacaaaaaat ttgatgacca aacacccaag aaactctaca atctatacag 5940
attgggagac aaaatgctca agaacaaggg ggatgacgcc tatgaggcta ttaagatgct 6000
ggaaccaatg tgtaatcttc agctatctaa actggcacat gaatatcgtc ctctcatccc 6060
tgatttccct cactttgaaa accatgtgag gaaaacatgc ggcgacctat cacaagagca 6120
cccagaagtc ttagaaatac tagagctagt gttgtcatta agaaacgtcg aagaggcact 6180
tctcttcttc ggatctttca gacactgggg gcatccattc attgattact ttgagggcct 6240
taaaaaactg aacaaacaag tcacattgca aaaggagata gatgacaaat atgcgaatgc 6300
attagcaagt gatctggcct atatagtcct taagaaggaa tttgacaaga agaagcactg 6360
ggcagtcaac aaagaagcga tgagtgagaa acatccattc taccagcatg tctctgaaca 6420
cacctggcca acaccaaaac aagtagacga ctttggagac aattggcata aactgccact 6480
tataaaagtg ttcgaaatcc cggacgtcat tgatccgtcc atcatatact cagacaagag 6540
ccattccatg caaaaatcag aggtgctaga tagtatcatg aaccatccca atactcccat 6600
cccaactagg aaagtattgt cctctctctt agagaaacca gcaacagatt ggccgaaatt 6660
tctagagtca gtagatctaa atgggttaga tgaagaagat ctggttatcg gattgaaagg 6720
gaaagaaaga gaattaaaga aagcaggacg tttcttctcc ctaatgtcat ggaaattacg 6780
agagtatttc gtcatgacag aatatctgat caaacacaac tttgtcccac tatttcatgg 6840
attgactatg gcagatgaca tgactcaagt tatgaagaaa atgttagaca gaagccaagg 6900
gcaaggagag aatgactacc agagagtcag tattgcaaac catattgact atgaaaagtg 6960
gaacaatcac caaaggaaag aatcaaatgg accaacattt cgagtgatgg gacaattctt 7020
gggctatcca tctttgatcg aaaggacgca tgagttcttc gagaaaagcc tgatatacta 7080
caatggtagg ccggatttga tgcaagtgac cggaaaccag gtgattaact ccactgataa 7140
acttgtttgc tggcaaggac aaaagggagg gctagaggga ctaagacaga aaggatggag 7200
cattttaaat ctgttaatca tcaggagaga atctaaaatt cggaacactc gggtccagac 7260
cctggcgcaa ggagacaatc aagtcatttg cacccaatac atgctcagcc ccagcagaga 7320
tgagaaagag ctgaaagaga agctgaaaca catagcagaa aacaatgggg ttattatgga 7380
cgccatcgag aggggcacaa ataaactggg tttgattatc aacaacgatg agactatcca 7440
gtcagcagat ttcctgacat atgggaaaat accaatcttc cgcggaaaca ttcgttgtct 7500
agaagggaaa agatggtcca gggtgacatg tgtgaccaat gatcaacttc caaatttatc 7560
taatgttttg tcatcagtct caacaaatgc tctaaccgtc tctcactttg acatttcacc 7620
attgaatgct atgcgacagt attgtttctt cggatgcttt gctcttaaac tggtctccat 7680
gcacaatccc gctctgcgag gatcccacga gtcacgctta ggatttgata tatcaaccga 7740
ttctacaatc gcagctactt tgtttcttga tccatcattg ggaggagcca gtgggatgtc 7800
cctgacacga ttcttaatga gaatgtttcc agatccagtc accgaggggc tagcgttttg 7860
gaaggtggtc tacaacaaca cagatttagg ttgggtgaag aaattgtgta caaaggctgg 7920
tcatcccaaa ttagctaaag gagagatgaa caacatcggg aagctgatag agaatccatc 7980
tgctctcaat ttaaagaaag agacatcagc aatcagtatc ataaaaaacg aagtgaaaag 8040
attcttatac gacaaatgca ttgatttcgg gaatagagtt atatcagccg caatcgaaga 8100
aaccagagag gaagagccat acctggacaa cttcctcgca tccatctatc ctctatttcc 8160
aagattcttg gccgaattca aagctgcatc gttccttgga atcacagatt ccctggtcag 8220
cctgttccag aactccaaga ctatcagagg tgtgttcaaa aacaagtatg caaaagaaat 8280
agagttaaag gtcctgactt gcgagatcaa cttactgaaa ttaatacatg actttgaaaa 8340
ggcagaaatt ttcccgatgt gggattgctc ctccttacat gctaagattt tgagacaaga 8400
atcctgggga atgccagtgc atggagctac cattccgcac cctttagaga tgttatctct 8460
gaaagatttt catcatagat gtgagataat ggattatatc acagtctctg taattgagcc 8520
attaaacaaa tgcttagaat ccaagggcag attgccagct tacttgggat caaagacatc 8580
ggagaccaca agcatcatcc aaccatggga cagagaaaca aacatcccaa tgatcaaaag 8640
agcagccaag ctaaggaatg ccatatcatg gtttgtgaac cctgactcca atctagcaaa 8700
aagcataatg aacaatttag aaggactcac tggcgaaaaa tgggatggtg cattggaggg 8760
attcaaacga accgggtccg ctctgcaccg tttctctagc gctcgagtca gctcaggtgg 8820
cttttccgca cagagtcctg caaaattgac aaggatgatg tccacaactg atacctttag 8880
ggatataggg accgacaatt acgacttcat gtttcagtcc ttgctaatcc attcacagat 8940
cacagcaggc gaagtcctcg gagattctga tgcaacagga acattgcatt ttcatttgga 9000
ttgcaaaagt tgcctgtcta gaatagaaga ggtagtcctg gaatcaagag tcacctacag 9060
tccagaagac agatctggat tacttaacag gtggaagcca gagggatcaa catggtcaac 9120
agaaagaacc agaccggaga tccagagtac cgccatagag aggttaaata aatcatccat 9180
tcattataac atgggaaggg ctcaaggatt tatttacgga gatcagaaga tgaccggaag 9240
aggaggagac gagtcatcat tgttccctct ctccatccag tacaaagtaa aggctgatct 9300
gtttttgaaa ggactgatgg acggtttggt ttatgcatca tctctcgcaa caatccacag 9360
gaggaatttt gaccatccga ccaaattcca agcaacacag tatgggacat tggagtactt 9420
ggtagaagag ctgacaagtc atccgccatt tctcaatctt ttgagatcag gtcctttatc 9480
agaaatattg agaagtgtcc ctcacagagt ccctccatct tacccattga cgaacaggga 9540
tttgggggca ttggcacgaa attacttgag atacatgcta caaactttga aacagagcca 9600
ccaaagaaag gactacgatg caaatttgat aatttttgct gacatgatgt ccccagacgt 9660
catataccct tacgccctag cgcaaaagtg tgcaagatta gcatttaagc ctaagtggac 9720
accaaaggac acagaaactt tgagacaact gagagaaact gcatccagca tgagagcgaa 9780
tcctgacttc aagatgtatc tgtcaaacaa gatagtcgca gtagaccatg agattcgcca 9840
tgcatccaaa accatacaag agaaaacctc cttcaaagaa gaaaagctcg actgggggaa 9900
ggaattgtct gggaaagtga caatctcaga tgttgtagtc agtaatgaga agcaggcagt 9960
cccttcagaa acagtcaagc agcggaaaga tccattaata tctggattgc gacatttcca 10020
gatggccaca ggagcacatt ataaattgag atcaatcttg gatgctaaaa agatcactta 10080
ccgtgatttc atctgtggtg gagatggatc aggggggttg acatcatgtc tcttaagaca 10140
atctccagct agtcgaggac tcttcaacag tttgttggag ataaaggaaa cagatctgag 10200
gggcagttct ccgagtccac catctgctgt gttccatttg ggaccagaga gtcagagatg 10260
ctgcaatcta ctgtctgcat gggaaaatcc cagtgatcta agtcaggcac ttacttggga 10320
ctactttcgc tcagaaatga caaagaataa ccttaaagtg gatctcatga catttgacat 10380
ggaagtgcgg gatgtagaaa tgtctgtaaa aatagaaacc atgattgaag agaacttaga 10440
cctgttgtct gagaaaggaa cattgatcta caagacttac ttgagccgat ttgcatccgt 10500
ggatgtttgt gcaccagaga ggttcagcaa gtacttttca aaagctgagt tgatttcaac 10560
tcaattcact agcagtcata gctcagaagt ttatcttgtg tgcactggga aacgaagaaa 10620
tccaaaaaat ttgaaatttg tcaattggaa aacgacttgg gcactcgcaa aagttcacaa 10680
gtgttggaat gacacggaaa ccgagttgaa acgggctttc gagctgcagc agatggacat 10740
gtatcaggga gtgccgaaga agttgatatc tgattgggaa aacgatcttc tggctttgac 10800
tctggggctc cgagtagaga gtgggatagc ctcagtattg tgctcatttc tgagtaccca 10860
tcgacgaatc ttgtccggga cgacactcct tgccatctgg gctcatgtgg cactctacca 10920
aagaagaccc ggaaccagtc ctccttctat cagacactgc caggaaattg gtatcatttc 10980
tattggattt ctctactgct tagctcttgc tagagctgat gtctcattgt atagcaagat 11040
gaaaatgatg acggacaatg cctttccctt tcattaccaa aaatccagat ggaacacagc 11100
cactggattg aatcaaaccg tcaggctgga caataaaatg gcaagtcttg gaagtgtgat 11160
cagattgttt tccagacttg gtttacaggg ggatgcagac tggaggaaag tggatgaatc 11220
atgccgactg attgtaccgc agtgcacaat gaaatggata ttggcacaca ctgggctggc 11280
aggattgaca aaaggtgagt ggtcattggg ggaagtgatt gctcaggaag agtgggagga 11340
gagagaggct gcgtggacgg aataagcctt aaatgtattg tatttttgtg atggtttgct 11400
tttgggatat tttgaaaact taggcttact ttcatgtgtt taatcattag agtaataagg 11460
gatgtttttt tgatatgaaa aaaactcaca attactgaga aaccgaaccg gtttgctaat 11520
cagagactgt gtttgttttt ctcgt 11545
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
caggatatac gacccaatc 19
<210> 3
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
taactctttg agcaggcctc aggatatacg acccaatc 38
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
taactctttg agcaggcct 19
<210> 5
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
catcagattc atgtgtaca 19
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
cagaagtctc aggaccacca 20
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
agggatgggc tgccttggag c 21
Claims (2)
1. An RT-CPA detection primer of ricefield eel rhabdovirus CrERV, wherein the primer is 1s: CAGGATATACGACCCAATC;2a1s: TAACTCTTTGAGCAGGCCTCAGGATATACGACCCAATC; 2a: TAACTCTTTGAGCAGGCCT; CATCAGATTCATGTGTACA a; CAGAAGTCTCAGGACCACCA for 4 s; AGGGATGGGCTGCCTTGGAGC, wherein the preservation number of the ricefield eel rhabdovirus CrERV is as follows: CCTCC NO: v201819.
2. the use of the primer of claim 1 for preparing a finless eel rhabdovirus detection kit, wherein the finless eel rhabdovirus C rERV has the deposit number: CCTCC NO: v201819.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811047925.6A CN109234450B (en) | 2018-09-07 | 2018-09-07 | Monopterus albus rhabdovirus CrERV RT-CPA detection primer and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201811047925.6A CN109234450B (en) | 2018-09-07 | 2018-09-07 | Monopterus albus rhabdovirus CrERV RT-CPA detection primer and application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN109234450A CN109234450A (en) | 2019-01-18 |
CN109234450B true CN109234450B (en) | 2019-12-06 |
Family
ID=65067606
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201811047925.6A Active CN109234450B (en) | 2018-09-07 | 2018-09-07 | Monopterus albus rhabdovirus CrERV RT-CPA detection primer and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN109234450B (en) |
Families Citing this family (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109182277B (en) * | 2018-09-07 | 2021-05-07 | 中国水产科学研究院长江水产研究所 | Monopterus albus rhabdovirus CrERV and RT-PCR detection primer and application |
CN109762939A (en) * | 2019-02-02 | 2019-05-17 | 中国水产科学研究院珠江水产研究所 | For detecting the primer and probe and kit of mandarin fish rhabdovirus |
CN111733283B (en) * | 2020-04-28 | 2021-07-06 | 广东海大畜牧兽医研究院有限公司 | Triple fluorescence PCR detection kit for infectious spleen and kidney necrosis virus, largemouth black bass virus and mandarin fish rhabdovirus |
CN112725530A (en) * | 2021-01-19 | 2021-04-30 | 中国计量大学 | Cross primer amplification primer group for detecting bean pod mottle virus, kit and application |
CN112760389B (en) * | 2021-03-18 | 2023-09-15 | 吉林省养蜂科学研究所(吉林省蜂产品质量管理监督站、吉林省蜜蜂遗传资源基因保护中心) | Method for detecting STRs gene frequency of Apis mellifera |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1410535A (en) * | 2002-11-14 | 2003-04-16 | 中国科学院水生生物研究所 | Mandarin fish rhabdo virus toxic strain, its preparation method and application |
CN101638685B (en) * | 2008-07-29 | 2013-01-09 | 杭州优思达生物技术有限公司 | Method for amplifying target nucleic acid sequence by using cross primer and kit for amplifying target nucleic acid sequence and application thereof |
CN106148565B (en) * | 2015-04-16 | 2019-11-08 | 中国水产科学研究院长江水产研究所 | A kind of Koi herpesvirus CPA detection primer and application |
-
2018
- 2018-09-07 CN CN201811047925.6A patent/CN109234450B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN109234450A (en) | 2019-01-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109234450B (en) | Monopterus albus rhabdovirus CrERV RT-CPA detection primer and application | |
Xu et al. | Isolation and preliminary characterization of a new pathogenic iridovirus from redclaw crayfish Cherax quadricarinatus | |
Deng et al. | Characterization of a ranavirus isolated from cultured largemouth bass (Micropterus salmoides) in China | |
Luo et al. | Haematopoietic necrosis of cultured Prussian carp, Carassius gibelio (Bloch), associated with Cyprinid herpesvirus 2. | |
CN109517806B (en) | Tilapia lake virus virulent strain and RPA detection primer and method thereof | |
CN109182277B (en) | Monopterus albus rhabdovirus CrERV and RT-PCR detection primer and application | |
Seo et al. | Outbreak of hirame rhabdovirus infection in cultured spotted sea bass Lateolabrax maculatus on the western coast of Korea | |
CN109266785B (en) | Monopterus albus rhabdovirus CrERV RT-LAMP detection primer and application | |
CN102277361A (en) | Method for screening protective antigens of Singapore grouper iridovirus | |
CN102108414B (en) | Real-time fluorescence transcription-polymerase chain reaction (RT-PCR) detection method and kit for pike fry rhabdovirus (PFRV) | |
CN107190103B (en) | Multiplex PCR primer group, kit and method for simultaneously detecting three fish viruses | |
CN111485034A (en) | Fluorescent quantitative RT-PCR method for detecting fish viral nervous necrosis and corresponding kit | |
CN109234451B (en) | Tilapia parvovirus TiPV CPA detection primer and application thereof | |
CN106755518B (en) | Real-time quantitative PCR detection kit for portunus trituberculatus sarcocysticercus | |
Bigarré et al. | Ranaviruses associated with high mortalities in catfish in France | |
CN112359148B (en) | PCR primer group for rapidly detecting three fish viruses and application thereof | |
CN112094854B (en) | Specific primer, probe and kit for detecting pelodiscus sinensis flavivirus | |
CN110184385B (en) | Freshwater crayfish thrum virus PCV-87R specific sequence and application | |
CN109988870B (en) | Triple fluorescence PCR detection kit for shrimp mortem nodavirus, blood cell iridovirus and nodavirus and application thereof | |
CN111057793B (en) | RT-LAMP detection primer of carp coronavirus HL39 and application | |
Borzym et al. | Outbreak of ranavirus infection in sheatfish, Silurus glanis (L.), in Poland | |
CN103397106B (en) | Hybridized snakehead fish rhabdovirus fluorescent quantificationally PCR detecting kit and detection method thereof | |
Freitas et al. | Genetic characterization of esocid herpesvirus 1 (EsHV1) | |
Pekmez et al. | Molecular characterisation of Lymphocystis Disease Virus detected from Sea Bream in Turkey | |
CN110982941A (en) | RT-RPA detection primer of carp coronavirus HL39 and application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |