CN113584166B

CN113584166B - Application of miR-31-5p in acute myelogenous leukemia

Info

Publication number: CN113584166B
Application number: CN202110756247.6A
Authority: CN
Inventors: 闫道广; 钟文彬
Original assignee: Jinan University
Current assignee: Jinan University
Priority date: 2021-07-05
Filing date: 2021-07-05
Publication date: 2024-03-26
Anticipated expiration: 2041-07-05
Also published as: CN113584166A; WO2023280001A1

Abstract

The present disclosure relates to the use of miR-31-5p in acute myeloid leukemia, including the use of a product for detecting miR-31-5p in the preparation of a reagent, chip or kit for aiding in the diagnosis of a subject suffering from Acute Myeloid Leukemia (AML) and/or for prognosis of the survival of the subject, and the use of miR-31 initial/precursor miRNA (pri/pre-miR-31) and/or miR-31 mature miRNA (miR-31-5 p) in the preparation of a medicament for treating AML. Introducing miR-31-5p into cells by a gene transduction method can induce bone marrow AML cells and leukemia stem cells (AML-LSC) to die, and enhance cytotoxicity of chemotherapeutic drug cytarabine; expression of miR-31-5p can inhibit growth of AML cells and AML-LSC cells, and animal life is prolonged. The present disclosure provides novel methods for diagnosis and prognosis evaluation of AML, while also providing gene therapy drugs for the preparation of AML.

Description

Application of miR-31-5p in acute myelogenous leukemia

Technical Field

The present disclosure relates to diagnosis and treatment of tumors, and in particular to application of miR-31-5p in diagnosis and treatment of Acute Myeloid Leukemia (AML).

Background

Leukemia is a type of clonal malignant disease that originates from hematopoietic stem cells, and is statistically responsible for approximately 35 tens of thousands of deaths annually worldwide. Thus, leukemia has become a major malignancy that currently threatens human health. Leukemia stem cells (1eukemia stem cells,LSC) are a very small number of cell populations present in leukemia patients, accounting for about 0.1% -1% of all leukemia cells. LSC was first found in Acute Myelogenous Leukemia (AML) and has been widely accepted. LSC can cause and maintain leukemia, both in long-term cell culture and in animal models; meanwhile, unlike leukemia cells, more than 95% of LSCs are in the "dormant" state of the G0 phase, which are insensitive to traditional cell cycle chemotherapeutics, and the retained LSCs increase the recurrence rate of leukemia patients by self replication (Renewal). Thus, finding a unique self-protection mechanism for LSC, targeting LSC to be killed is an important way to cure leukemia thoroughly.

MicroRNAs (miRNAs) is a non-coding class of small RNA molecules, approximately 19-25bp long, comprising a seed sequence of 6-8nt and a complement of 12-17 nt. The miRNA gene is transcribed to produce an initial miRNA (pri-miRNA), which forms a hairpin structure under the processing of Drosha enzyme, and is divided into 5 'and 3' arms, also called 5p and 3p, according to the transcription order. The 5 'arm and 3' arm portions complement each other to form double stranded RNA, which becomes a mature miRNA precursor (pre-miRNA) and is transported to the cytoplasm, thereby acting to control gene expression after transcription. The pre-miRNA, once entering the cytoplasm from the nucleus, is immediately further processed by Dicer enzyme into mature miRNA. These mirnas play an important role in regulating gene expression and are involved in various aspects such as differentiation, proliferation and maintenance of cell homeostasis.

In most solid tumors, miR-31-5p expression is significantly upregulated. Chinese patent CN106636308B discloses a probe combination and kit for detecting skin cancer related markers, wherein hsa-miR-31-5p is used as a marker for detecting skin cancer related markers.

However, there is currently no report on the expression of miR-31-5p in AML cells and AML stem cells. Thus, there is an urgent need for better understanding of biomarkers in acute myeloid leukemia to develop prognostic prediction tools and to discover new drugs.

Disclosure of Invention

In order to solve the defects of the prior art, the aim of the present disclosure is to screen out acute myeloid leukemia as a molecular diagnosis biomarker, and develop a corresponding diagnosis kit to diagnose, treat or provide prognosis of acute myeloid leukemia.

Specifically, the present disclosure proposes the following technical solutions:

in one aspect, the present disclosure provides the use of a product for detecting miR-31-5p, pri-miR-31 and/or pre-miR-31 in the preparation of a reagent, chip or kit for aiding in the diagnosis of a subject having Acute Myeloid Leukemia (AML) and/or for prognosis of the subject's survival.

In one aspect, the present disclosure provides the use of miR-31-5p, pri-miR-31 and/or pre-miR-31 in the preparation of a medicament for preventing and/or treating Acute Myeloid Leukemia (AML).

In one aspect, the present disclosure provides a medicament for treating Acute Myeloid Leukemia (AML) comprising a miR-31 prime miRNA, a miR-31 precursor miRNA, and/or mature miR-31-5p.

In one aspect, the present disclosure provides a method of treating Acute Myeloid Leukemia (AML) comprising administering to the subject a therapeutically effective amount of miR-31-5p, pri-miR-31 and/or pre-miR-31 or a pharmaceutical composition comprising the same.

In vitro cell culture experiments show that the miR-31-5p is introduced into cells by a gene transduction method to induce the death of AML and AML-LSC cells, and mouse animal experiments show that the expression of miR-31-5p can inhibit the growth of AML and AML-LSC cells and prolong the service life of mice. The present disclosure provides novel methods for diagnosis and prognosis evaluation of AML, while also being useful for preparing gene therapy drugs for AML.

Description of the drawings:

figure 1 shows the principle of reverse transcription of mirnas by tailed method.

FIG. 2 shows the detection of miR-31-5p expression in bone marrow Leukemia Stem Cells (LSC) and normal human bone marrow Hematopoietic Stem Cells (HSCs) of AML patients by QPCR.

FIG. 3 shows the detection of miR-31-5p expression in bone marrow cells (AML) of AML patients and in normal human bone marrow cells (BM) by QPCR.

FIG. 4 is a graph showing the relationship between the expression level of miR-31-5p and the prognosis lifetime of AML patients.

FIG. 5 is the effect of miR-31-5p on AML-LSC clonality.

FIG. 6 is a graph of the results of miR-31-5p induction of AML-LSC and myeloid AML cell death.

FIG. 7 is a graph of the results of the induction of AML-LSC and bone marrow AML cell death by the miR-31-5 p-enhanced chemotherapeutic drug cytarabine (Ara-C).

FIG. 8 is a graph depicting the therapeutic effect of miR-31-5p on AML disease in B-NDG mice.

Detailed Description

In this disclosure, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by one of ordinary skill in the art. Also, protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology-related terms and laboratory procedures as used herein are terms and conventional procedures that are widely used in the corresponding arts. Meanwhile, in order to better understand the present disclosure, definitions and explanations of related terms are provided below.

As used herein, the term "primary miR-31" or "pri-miR-31" refers to mirnas derived from miR-31 genes after transcription by RNA polymerase.

As used herein, the term "precursor miR-31" or "pre-miR-31" refers to the initial miR-31 (pri-miR-31) that forms a hairpin sequence under processing by the Drosha enzyme, having 71 nucleotides (71 nt), the sequence of which is as follows: 5'-ggagaggaggcaagaugcuggcauagcuguugaacugggaaccugcuaugccaacauauugccaucuuucc-3' (SEQ ID NO 3).

As used herein, the term "mature miR-31-5p" or "miR-31-5p" refers to the sequence of precursor miR-31 (pre-miR-31) formed under the processing of Dicer enzyme, having 21 nucleotides (21 nt), the sequence of which is as follows: 5'-aggcaagaugcuggcauagcu-3' (SEQ ID NO 1).

As used herein, the term "vector" refers to a construct capable of delivering and optionally expressing one or more polynucleotides of interest into a host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, cosmids or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells. The vector may be stable and may replicate itself. There is no limitation as to the type of carrier that can be used. The vector may be a cloning vector, a polynucleotide suitable for propagation and acquisition in combination with a variety of exogenous organisms, a genetic construct or an expression vector. Suitable vectors include prokaryotic expression vectors (e.g., pUC18, pUC19, bluescript and derivatives thereof), mpl8, mpl9, pBR322, pMB9, coIE1, pCR1, RP4, phage and shuttle vectors (e.g., pSA3 and pAT 28), and eukaryotic expression vectors based on viral vectors (e.g., adenovirus, adeno-associated virus and retrovirus and lentivirus), as well as non-viral vectors such as pSilencer 4.1-CMV (Life technologies Corp., carslbad, CA, U.S.), pcDNA3, pcDNA3.1/hyg pHCMV/Zeo, pCR3.1, pEFlHis, pND/GS, pRc/HCMV2, pSV40/Zeo2, pTRACER-HCMV, pUB6/V5-His, pVAXl, pZeoSV2, I, pSVL and SV-10, pBL-2 and pTL 2.

As used herein, the term "plasmid" refers to a small, circular, double-stranded, self-replicating DNA molecule obtained by genetic engineering techniques capable of transferring genetic material of interest to a cell, which results in the production of a product encoded by the genetic material (e.g., a protein polypeptide, peptide, or functional RNA) in a target cell. Furthermore, the term "recombinant plasmid" or "plasmid" also refers to a small, circular, double-stranded, self-replicating DNA molecule obtained by genetic engineering techniques used during the preparation of viral vectors as vectors for recombinant vector genomes.

As used herein, the term "viral vector" refers to an agent obtained from a naturally occurring virus by genetic engineering techniques capable of transferring genetic material of interest (e.g., DNA or RNA) to a cell, which results in the production of a product encoded by the genetic material (e.g., protein polypeptide, peptide, or functional RNA) in a target cell.

As used herein, the term "pharmaceutical composition" refers to a formulation of a variety of preparations. Formulations containing a therapeutically effective amount of miR-31-5p, pri-miR-31 and/or pre-miR-31 are in sterile liquid solution, liquid suspension or lyophilized form, optionally containing a stabilizer or excipient.

As used herein, the term "pharmaceutically acceptable carrier" refers to a component of a pharmaceutical formulation that is not an active ingredient, which is non-toxic to a subject. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, or preservatives.

As used herein, "treating" an individual with a disease or condition means that the symptoms of the individual are partially or fully alleviated, or remain unchanged after treatment. Thus, treatment includes prophylaxis, treatment and/or cure. Prevention refers to preventing an underlying disease and/or preventing worsening of symptoms or disease progression.

As used herein, "therapeutic effect" refers to the effect resulting from treatment of an individual that alters, generally improves or ameliorates symptoms of, or cures a disease or condition.

As used herein, a "therapeutically effective amount" or "therapeutically effective dose" refers to an amount of a substance, compound, material, or composition comprising a compound that is at least sufficient to produce a therapeutic effect after administration to a subject. Thus, it is the amount necessary to prevent, cure, ameliorate, block or partially block the symptoms of a disease or disorder.

As used herein, a "prophylactically effective amount" or "prophylactically effective dose" refers to an amount of a substance, compound, material, or composition comprising a compound that, when administered to a subject, will have the desired prophylactic effect, e.g., prevent or delay the onset or recurrence of a disease or symptom, reducing the likelihood of the onset or recurrence of a disease or symptom. The fully prophylactically effective dose need not occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a prophylactically effective amount may be administered in one or more administrations.

In one aspect, the present disclosure provides the use of a product for detecting miR-31-5p, pri-miR-31 and/or pre-miR-31 in the preparation of a reagent, chip or kit for aiding in the diagnosis of a subject suffering from Acute Myeloid Leukemia (AML) and/or for prognosis of the survival of a subject, wherein the sequence of miR-31-5p is: 5'-aggcaagaugcuggcauagcu-3' (SEQ ID NO 1), the sequence of said pre-miR-31 is: 5'-ggagaggaggcaagaugcuggcauagcuguugaacugggaaccugcuau gccaacauauugccaucuuucc-3' (SEQ ID NO 3).

In some embodiments of the present disclosure, the reagent is capable of detecting the level of miR-31-5p, pri-miR-31 and/or pre-miR-31 in a biological sample.

In some embodiments of the present disclosure, a lower level of miR-31-5p, pri-miR-31 and/or pre-miR-31 in the biological sample than the corresponding level of miR-31-5p, pri-miR-31 and/or pre-miR-31 in a normal control sample is indicative of the subject suffering from Acute Myeloid Leukemia (AML).

In some embodiments of the present disclosure, the biological sample is selected from one or more of peripheral blood, bone marrow, and tissue suspected of having leukemia cells.

In some embodiments of the disclosure, the subject may be a human or other mammal.

In some embodiments of the present disclosure, the level of miR-31-5p, pri-miR-31 and/or pre-miR-31 is detected using a high-throughput sequencing method, a miRNA expression profile chip, a quantitative PCR method and/or a probe hybridization method.

In some embodiments of the present disclosure, the reagents comprise forward primers for amplifying miR-31-5 p; preferably, the forward primer has the sequence shown below: 5'-aggcaagatgctggcatagct-3' (SEQ ID NO 2).

In some embodiments of the present disclosure, the subject has a shorter survival time if the transcript level of the miR-31-5p, pri-miR-31 and/or pre-miR-31 in the biological sample is low relative to the transcript level of the corresponding miR-31-5p, pri-miR-31 and/or pre-miR-31 gene in a normal control sample.

In some embodiments of the present disclosure, the chip comprises a solid support and an oligonucleotide probe immobilized on the solid support.

Experiments of the present disclosure prove that the increase of miR-31-5p in intracellular level can directly induce AML and AML-LSC cell death, and enhance cytotoxicity of chemotherapeutic drug cytarabine. As previously described, the miR-31-5p gene is transcribed by RNA polymerase to obtain initial miR-31 (pri-miR-31), the initial miR-31 (pri-miR-31) forms a precursor miR-31 (pre-miR-31) with a hairpin structure under the processing of Drosha enzyme, and the precursor miR-31 (pre-miR-31) forms miR-31-5p under the processing of Dicer enzyme. Thus, the intracellular level of the pri-miR-31 and/or pre-miR-31 is increased, and the pri-miR-31 and/or pre-miR-31 can be processed in the cell to form miR-31-5p, so that the same effect of increasing miR-31-5p can be achieved.

In some embodiments of the present disclosure, miR-31-5p, pri-miR-31 and/or pre-miR-31 is naturally-occurring, synthetically-synthesized or is obtained by transfecting cells with an expression vector capable of expressing a DNA fragment of miR-31-5p, pri-miR-31 and/or pre-miR-31, in which the gene sequence of miR-31-5p is: 5'-aggcaagatgctggcatagct-3' (SEQ ID NO 2); the gene sequence of the pre-miR-31-5p is as follows: 5'-ggagaggaggcaagatgctggcatagctgttgaactgggaacctgctat gccaacatattgccatctttcc-3' (SEQ ID NO 4).

In some embodiments of the disclosure, the expression vector is selected from the group consisting of a plasmid, phage, phagemid, cosmid, viral vector, virion, prokaryotic expression vector, and eukaryotic expression vector.

In some embodiments of the disclosure, the viral vector is selected from the group consisting of a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpesviral vector, an alphaviral vector, a baculovirus, and a vaccinia virus.

In some embodiments of the disclosure, the prokaryotic expression vector is selected from the group consisting of an E.coli expression vector, a B.subtilis expression vector.

In some embodiments of the present disclosure, the eukaryotic expression vector is selected from a yeast expression vector, an insect expression vector, or a mammalian expression vector.

In some embodiments of the present disclosure, the agent may be administered alone or in combination with other agents capable of inhibiting AML.

In some embodiments of the present disclosure, the other drug capable of inhibiting AML is selected from one or more of daunorubicin, cytarabine, thioguanine, etoposide, cephalotaxine, vincristine, prednisone, mitoxantrone, doxorubicin, cyclophosphamide, carboplatin, decitabine, methotrexate, etoposide, doxorubicin (doxorubicin), cisplatin, dexamethasone, sabaticin, methylnitrourea, fluorouracil, 5-fluorouracil, vinblastine, camptothecin, actinomycin-D, mitomycin C, hydrogen peroxide, oxaliplatin, irinotecan, topotecan, folinic acid, carmustine, streptozotocin, paclitaxel, tamoxifen, dacarbazine, imatinib, azacytidine, and gemtuzumab.

In some embodiments of the present disclosure, the medicament further comprises a pharmaceutically acceptable carrier.

In some embodiments of the present disclosure, the pharmaceutically acceptable carrier is selected from one or more of lactose, dextrose, sucrose, polyvinylpyrrolidone, alginates, gels, cellulose, syrup, sorbitol, mannitol, starch, gum arabic, talc, magnesium stearate, calcium phosphate, calcium silicate, microcrystalline cellulose, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, mineral oil, microcapsules and microspheres, nanoparticles, liposomes.

In some embodiments of the present disclosure, the pharmaceutical dosage form is a solution, injection, oral liquid, suspension, emulsion, extract, powder, granule, suppository, aerosol, granule, tablet, or capsule.

In some embodiments of the present disclosure, the injection comprises sterile or sterilized solutions, injections, oil injections, powder injections, and the like; oral liquid dosage forms include solutions, syrups, emulsions, suspensions, and the like; the tablet comprises common compressed tablet, sugar-coated tablet, effervescent tablet, chewable tablet, multi-layer tablet, implant tablet, sustained release tablet, controlled release tablet, etc.

In some embodiments of the present disclosure, the medicament further comprises a dispersing agent or a stabilizing agent.

In one aspect, the present disclosure provides a reagent, chip or kit for aiding in the diagnosis of a subject suffering from Acute Myeloid Leukemia (AML) and/or for prognosis of the subject's survival; the reagents, chips or kits comprise products for detecting miR-31-5p and/or a precursor thereof in the biological sample.

In one aspect, the present disclosure provides a medicament for treating Acute Myeloid Leukemia (AML), comprising miR-31-5p, pri-miR-31 and/or pre-miR-31.

In one aspect, the present disclosure provides a pharmaceutical composition for treating Acute Myeloid Leukemia (AML), the medicament comprising miR-31-5p, pri-miR-31 and/or pre-miR-31, and a pharmaceutically-acceptable carrier.

The medicament or pharmaceutical composition of the embodiments is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal, and rectal administration. Solutions or suspensions for parenteral, intradermal, or subcutaneous administration may include the following components: sterile diluents for injection such as water, saline, fixed oils, polyethylene glycols, glycerol, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methylparaben; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediamine tetraacetic acid (EDTA); buffers, such as acetates, citrates or phosphates, and agents for regulating the osmotic pressure, such as sodium chloride or dextrose. The pH can be adjusted with an acid or base, such as hydrochloric acid or sodium hydroxide. Parenteral formulations may be packaged in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (herein water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable pharmaceutically acceptable carriers include physiological saline, bacteriostatic water, cremophor ELTM (BASF, parsippany, N.J.), or Phosphate Buffered Saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy injection is possible. It must be stable under the conditions of manufacture and storage and must be able to prevent the contaminating action of microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycols, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols (such as mannitol, sorbitol), sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition agents delaying absorption, for example, aluminum monostearate and gelatin.

In the case of sterile powders for the preparation of sterile injectable solutions, the methods of preparation are vacuum-drying and freeze-drying of a powder containing the active ingredient plus any additional desired ingredient from a sterile filtered solution thereof as described previously.

It is particularly advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. As used herein, a dosage unit form refers to a physically separable unit suitable as unitary dosages for subjects to be treated; each unit contains a predetermined amount of miR-31-5p, pri-miR-31 and/or pre-miR-31 calculated to produce a desired therapeutic effect in combination with a desired drug carrier.

The pharmaceutical composition may be placed in a container, package, or dispenser together with instructions for administration.

In one embodiment, one or more of the miR-31-5p, pri-miR-31 and/or pre-miR-31 can be administered in combination therapy, i.e., in combination with other agents capable of inhibiting AML. The term "in combination" herein means that the agents are administered substantially simultaneously, simultaneously or sequentially. If administered sequentially, the first of the two compounds is still preferably detected at the treatment site at an effective concentration at the time of initiation of administration of the second compound. In one instance, a "combination" can also be a kit comprising both miR-31-5p, pri-miR-31 and/or pre-miR-31 and other therapeutic agents.

For example, the combination therapy can comprise co-formulation and/or co-administration of miR-31-5p, pri-miR-31 and/or pre-miR-31 described herein with one or more additional therapeutic agents (e.g., one or more cytokine and growth factor inhibitors, immunosuppressants, anti-inflammatory agents, metabolic inhibitors, enzyme inhibitors, and/or cytotoxins or cytostatics, as described in greater detail below). Such combination therapy may advantageously utilize lower doses of the therapeutic agent administered, thus avoiding the potential toxicity or complications associated with various monotherapy regimens.

It should be noted that the skilled artisan will recognize that the primer sequences of the present disclosure may be suitably adapted and modified based on the sequence of the relevant marker, and that these modified primer sequences may still be used to detect the marker. The present disclosure also includes such equivalent technical solutions.

Example 1 collection of clinical samples and cell sorting

1. Collection of AML clinical samples

Primary bone marrow cases were randomly withdrawn from hematological hospitalized Acute Myelogenous Leukemia (AML) patients (n=44), and patient bone marrow samples were collected and numbered (AML-1, AML-2, … …, AML-44), the patients did not receive any drug treatment; normal human bone marrow samples were collected in 5 cases (n=5). All of the samples were obtained with the consent of the tissue ethics committee.

The treatment method for collecting bone marrow samples of AML patients and normal human bone marrow samples is as follows:

bone marrow was extracted 2mL under aseptic conditions, and heparin was added for anticoagulation. Acquisition requirements of bone marrow specimens: heparin anticoagulation, no blood clot, bone marrow volume greater than 2mL, and cell sorting within 24 hours after specimen collection.

2. Isolation of mononuclear cells

Single nucleated cells were sorted from AML patient bone marrow samples and normal human bone marrow samples collected in step 1 using human lymphocyte separation medium (accession number 711101X) from da you, comprising the steps of:

A. bone marrow samples were diluted with an equal volume of Phosphate Buffered Saline (PBS) at pH7.4, 0.01M. For example, 1mL of bone marrow sample is added to 1mL of PBS and mixed well by gentle inversion.

B. And (3) adding a certain volume of separating liquid into a 15mL centrifuge tube, spreading the diluted bone marrow sample obtained in the step (A) above the liquid level of the separating liquid, and keeping the interface between the two liquid levels clear to obtain a mixture of bone marrow and the separating liquid. The volume ratio of lymphocyte separation liquid to bone marrow sample diluted by PBS is 1:2.

C. And C, under the condition of room temperature, regulating the centrifugal force of a horizontal rotor of the centrifugal machine to 700-800 g (or the rotating speed of 2000-2500 rpm/min), and centrifuging the mixture of the bone marrow and the separation liquid obtained in the step B for 20-30 min.

D. After centrifugation, a thin and compact white film layer on the separating liquid is collected, namely: mononuclear cell (including lymphocytes and monocytes) layers.

E. Diluting the mononuclear cells collected in the step D with 5mL of PBS, and mixing the mononuclear cells upside down to obtain diluted mononuclear cells.

F. The diluted mononuclear cells obtained in step E were centrifuged for 10min at room temperature with the horizontal rotor of the centrifuge adjusted to a centrifugal force of 250g (or a rotational speed of 1000 rpm/min).

G. The mononuclear cell pellet obtained in step F is resuspended in PBS or a suitable medium for use.

3、CD34 ⁺ CD38 ^- Stem cell sorting

Screening Leukemia Stem Cells (LSC) in mononuclear cells of AML patients separated in the step 2 or Hematopoietic Stem Cells (HSC) in normal human mononuclear cells by using a magnetic bead screening kit of Meitian and gentle company to screen CD34 ⁺ CD38 ^- Stem cells. The method specifically comprises the following steps:

A. 2X 10 was resuspended in 600. Mu.L PBS ⁸ And obtaining the resuspended mononuclear cells.

B. Adding 200 mu L of FcR blocking solution and 200 mu L of magnetic bead coupled anti-CD 34 antibody into the re-suspended mononuclear cells obtained in the step A, and incubating at 4 ℃ for 30min to obtain blocked and coupled mononuclear cells.

C. And B, adding 50 mu L of FITC-labeled anti-CD 38 antibody into the blocked and coupled mononuclear cells obtained in the step B, and incubating at 4 ℃ for 10min to obtain FITC-labeled mononuclear cells.

D. The FITC-labeled mononuclear cells obtained in step D were applied to a magnetic bead sorter, and cells not bound to the CD34 antibody were passed through a magnetic field to retain cells bound to the CD34 antibody.

E. Step D retained the sorter that bound CD34 antibody cells 3 times with 500 μl PBS.

F. The magnetic field of the bead classifier was removed, 1mL of PBS was added, and the PBS was rapidly pushed out of the classifier with a piston. The cells washed from the sorter were collected as CD34 positive cells.

G. And F, adding 20 mu L of enzymolysis solution into the CD34 positive cells collected in the step F, and incubating at 4 ℃ for 10min.250g (or 1000 rpm/min) was centrifuged for 10min, the supernatant was discarded, and the cell pellet was collected.

H. The cell pellet collected in step G was suspended in 20. Mu.L of PBS, 60. Mu.L of the enzymatic hydrolysis stopper was added, 100. Mu.L of the anti-FITC antibody was added, and the mixture was incubated at 4℃for 30 minutes.

I. Adding the cells incubated in the step H to a magnetic bead separator, and collecting cells which are not bound with FITC antibody, namely CD34 ⁺ CD38 ^- Stem cells.

Example 2 detection of miR-31-5p Gene expression

1. Total RNA extraction:

A. mononuclear cells or CD34 selected in example 1 ⁺ CD38 ^- Stem cells were washed twice with PBS.

B. Adding 1mL of Trizol lysate, and blowing with a pipettor for several times for lysis and mixing uniformly; the nucleoprotein was allowed to stand at room temperature for 5min to allow for adequate separation.

C. 200. Mu.L of chloroform was added thereto, the tube was capped, vigorously shaken for 15s, and left at room temperature for 5min.

D. Centrifuge at 4℃at 12,000g for 15min and aspirate about 400. Mu.L of the upper aqueous phase into another new 1.5mL EP tube. Care is taken not to draw in the intermediate interface layer.

E. 500. Mu.L of isopropanol was added, and the mixture was thoroughly mixed and left at room temperature for 10min.

F. Centrifugation was performed at 4℃for 10min at 12,000g, the supernatant was discarded and RNA was precipitated at the bottom of the centrifuge tube.

G. The RNA pellet was washed by adding 1mL of 70% ethanol.

H. Centrifuge at 4 ℃,7,500g for 5min, discard supernatant.

I. After the precipitate is air-dried for 3-5 min, 40 mu L of DEPC treatment water is added to dissolve RNA precipitate, and the concentration and the integrity of RNA are measured and stored at-70 ℃. RNA concentration and ratio of 260nm/280nm were determined: the purity requirement of total RNA is that the OD260/OD280 value should be between 1.8 and 2.2; detection of RNA integrity: RNA integrity was checked by 1% agarose gel electrophoresis.

2. Reverse transcription synthesis of cDNA template (One Step PrimeScript miRNA cDNA synthesis Kit using Takara Bio):

unlike mRNA, the mature miRNA is only about 20nt in length, very short, and normally the forward primer is enough to cover the whole length of the miRNA, and the reverse primer is not placed. In order to achieve qPCR amplification of mirnas, the solution is to try to increase the length of the reverse transcription product at the time of reverse transcription. The most straightforward way to increase the length of the reverse transcription product of miRNA is to increase the length of miRNA, i.e. add a stretch of sequence after the 3-terminus of miRNA, and then perform reverse transcription. After the miRNA is processed by a tail addition method, the length of the obtained cDNA is increased to more than 80nt from the original 20nt, so that qPCR amplification of the miRNA can be realized.

The tailing is accomplished by the co-action of two enzymes, polyA polymerase and reverse transcriptase, respectively. PolyA polymerase is responsible for adding PolyA tails to miRNAs, increasing their length. The reverse transcription primer is then bound to the PolyA sequence and synthesis of the extended version cDNA is accomplished by reverse transcriptase. The process is shown in fig. 1.

The reaction system was formulated as follows:

TABLE 1 reaction system

Reaction system	Volume of
		RNA(0.5-8μg)	3.75μL
mRQ buffer (2×)	5μL
		mRQ enzyme	1.25μL
Total volume after DEPC water addition	10μL

The mixture was thoroughly mixed and the following procedure was set in the PCR instrument:

TABLE 2PCR procedure

Step (a)	Temperature (temperature)	Time
			1	37℃	60min
2	85℃	5s
			3	4℃	Termination of

After the reaction, the reaction product was stored in a-20 ℃ refrigerator for subsequent experiments.

3. Fluorescent quantitative PCR

The amplified target gene was detected in a CFX96 detection system by using the U6 housekeeping gene as a control, 3 parallel controls were made for each RNA sample, and the relative quantification of RNA was analyzed by the ΔΔCt method.

Fluorescent quantitative PCR was performed using Takara Bio kit (SYBR Premix EX Taq Kit).

TABLE 3 fluorescent quantitative PCR reaction System

The forward primer is a forward primer for miR-31-5p or internal reference U6, wherein:

the nucleotide sequence of the miR-31-5p forward primer is as follows: 5'-aggcaagatgctggcatagct-3' (SEQ ID NO 2).

The nucleotide sequence of the U6 forward primer is as follows: 5'-ggaacgatacagagaagattagc-3' (SEQ ID NO 5).

The reverse primer was a mRQ3' primer provided for the kit, wherein:

the nucleotide sequence of the mRQ' primer is: 5'-ctcaactggtgtcgtgga-3' (SEQ ID NO 6).

Fluorescent quantitative PCR reaction conditions

Step (a)	Temperature (temperature)	Time	Cycle number
				1	95℃	10s
2	95℃	5s
				3	60℃	30s	Returning to the step 2, repeating 40 loops

4. Data processing and result analysis

The quantitative PCR data are processed by the software configured for fluorescent quantitative PCR, a threshold and a base line of each gene are established, and a dissolution amplification curve is automatically generated by the software. CT values corresponding to each sample reaction were obtained. The relative expression levels in the samples were plotted using a 2- ΔΔct algorithm, and log (2- Δct) was calculated for each sample.

As a result, as shown in FIG. 2, the expression of miR-31-5p was significantly reduced in the bone marrow Leukemia Stem Cells (LSC) of 44 AML patients, compared to the bone marrow Hematopoietic Stem Cells (HSC) of 5 normal persons. Similarly, as shown in FIG. 3, miR-31-5p expression was also significantly down-regulated in bone marrow cells (AML) of 44 AML patients compared to bone marrow cells (BM) of 5 normal persons. The results show that miR-31-5p is a very good AML diagnosis marker and has a very good clinical application prospect.

EXAMPLE 3 analysis of the prognostic relationship of miR-31-5p Gene expression from the TCGA database in AML patients

The raw miRNA expression data and clinical information of TCGA-LAML in GDC (https:// portal. GDC. Cancer. Gov /) was downloaded by GDCRNATool (http:// bioconductor. Org/packages/level/bioc/html/GDCRNATools. Html) R language package. Duplicate samples in the miRNA raw data were filtered and the raw count data of mirnas were combined into a single expression matrix. TMM normalization and Voom conversion are carried out, and by running the gdcVoom normalization function, the original count data is normalized by the TMM method implemented in the edge and further converted by the Voom method provided in limma. Kaplan Meier (KM) analysis was performed using the gdcSurvval analysis kit in the R language package GDCRNATools, miR-31-5p expression data and clinical information was imported into the TCGA database, and the miR-31-5p expression was grouped so as to maximize the sensitivity of the analysis and find any potential correlation with survival irrespective of a preset cutoff (e.g., median), each possible cutoff between the lower and upper quartiles of expression was calculated. Each of these thresholds was then used for individual Kaplan Meier (KM) analysis. The False Discovery Rate (FDR) was calculated to correct multiple hypothesis testing, with the results being considered significant only with FDR < 0.05. The best cut-off with the lowest p-value (0.0284 in this example) was used in the final results, divided into a high expression set n=91, a low expression set n=73 (where cases above the cut-off are considered miR-31-5p high and cases below the cut-off are considered miR-31-5p low), and the gdkmplot kit draws a survival curve. And analyzing the survival relation between the miR-31-5p gene expression level and AML patients by using a GDCRNAT tool. The results in FIG. 4 show that the lower the miR-31-5p expression level, the shorter the survival of the patient. The above results indicate that the expression level of miR-31-5p is directly related to prognosis of AML patients.

Example 4 detection of in vitro clonality of AML-LSC

1. Sample selection and numbering

Leukemia stem cells (AML-LSCs) of acute myeloid leukemia were isolated according to the method of example 1, from the 44 AML cases tested in example 2, 3 different AML patients were selected for the cloning experiments, and the 3 AML patients were assigned Leukemia Stem Cell (LSC) cloning experiments corresponding to the patient sample number as AML-5, AML-8 and AML-9, respectively.

2. AML-LSC culture

AML-LSC cell culture uses a Serum-Free Medium (STEMCELL Technologies company) Medium, and 3 stem cell factors are added to the Medium: rIL3 (final concentration 10ng/mL, peproTech Co.), rFlt3 (final concentration 10ng/mL, peproTech Co.) and rSCF (final concentration 25ng/mL, peproTech Co.), cell culture at 37℃and 5% CO ₂ In the incubator, medium exchange or cell passaging is performed every 3 days. Note that the cell culture density should be controlled at 10 ³ ～10 ⁴ and/mL to prevent stem cell differentiation.

3. Lentiviral infection

Carrying a DNA sequence capable of expressing a control RNA (in the example shown, the control RNA is abbreviated as a 5'-ttctccgaacgtgtcacgt-3' DNA sequence) or a DNA sequence capable of expressing miR-31-5p (in the example shown, the control RNA is abbreviated as miR-31-5p, which is abbreviated as a 5'-ttctccgaacgtgtcacgt-3' DNA sequence) A DNA sequence of 5'-aggcaagatgctggcatagct-3') lentiviral particles were purchased from Shanghai Ji Ma company (control RNA products lot G07AZ; miR-31-5p product lot number 170305 DZ), control RNA lentiviruses and miR-31-5 p-expressing lentiviruses have titers of greater than 10 ⁹ TU (i.e., the number of bioactive viral particles per milliliter) is included to ensure infection efficiency.

Lentiviral infection process of AML-LSC:

A. taking 1×10 ⁴ Cells were cultured in 0.5mL of medium.

B. The polybrene was added at 5. Mu.g/mL and the lentivirus was added at a multiplicity of infection MOI (i.e., number of virus particles per cell in one system) of 100. For example 10 ⁴ The amount of virus required to be added to each cell is 10 ⁶ TU。

C、37℃，5％CO ₂ Culturing in an incubator for 4 hours.

D. Then 0.5mL of culture medium is added, the temperature is 37 ℃ and 5 percent of CO is added ₂ Culturing in an incubator for 24 hours.

E. After 24 hours, 1mL of culture medium was added, and the culture was continued for 24 hours for subsequent experiments.

4. Cloning culture Process

A. 2000 AML-LSC cells infected with lentivirus for 48 hours were mixed well with 2mL of semi-solid medium Methylcellulose Medium (STEMCELL Technologies).

B. The cell/semi-solid medium mixture prepared in step a above was seeded in 6-well plates and 3 replicate wells were seeded per AML case cell.

C、37℃，5％CO ₂ Culturing in an incubator for 14 days.

5. Data processing and result analysis

Each well was photographed under a 10 x microscope and the number of cell clones that each well was able to form was recorded and counted.

FIG. 5 shows the effect on clonogenic capacity after infection of AML-LSC with miR-31-5 p-expressing lentiviruses. As shown in FIG. 5a, 3 cases of AML-LSC cells infected with lentivirus expressing control RNA were well cloned after 14 days of culture. In contrast, 3 cases of AML-LSC cells infected with miR-31-5p lentivirus showed a significant decrease in the number of clones formed after 14 days of culture, and the clone sizes were also significantly inhibited.

Statistical analysis was performed using GraphPad Prism 8 software. The results show mean ± standard deviation. Statistical methods mean-to-mean comparisons were determined to be statistically significant using t-test with P <0.05, P <0.01, P < 0.001. As shown in FIG. 5b, the statistical results indicate that the clonogenic capacity of 3 AML-LSC cells is significantly inhibited by miR-31-5p expression. In the control group, approximately 100 clones were formed per 2000 AML-LSC cells, while in the miR-31-5 p-expressing group, the number of clones formed per 2000 AML-LSC cells was less than 20.

Example 5 influence of miR-31-5p on AML-LSC cells and bone marrow AML cells

1. Sample selection and numbering

Leukemia stem cells (AML-LSCs) of acute myeloid leukemia were isolated according to the method of example 1, from among the 44 AML cases tested in example 2, 3 different AML patients were selected for the cell death detection assay, and corresponding to the patient sample number, the 3 AML patients were numbered AML-5, AML-8 and AML-9, respectively.

2. Culture of AML-LSC and myeloid AML cells

AML-LSC culture was performed as in example 4.

Bone marrow AML cells were cultured in 1640 medium containing 20% fetal bovine blood at 37deg.C and 5% CO ₂ 。

3. Lentiviral infection

AML-LSC lentivirus infection method was as in example 4.

The method for infecting bone marrow AML cells with lentiviruses was the same as that for infecting AML-LSC in Experimental example 4.

4. Cell death detection

After 96 hours of culture of lentiviral infected AML-LSC and bone marrow AML cells, cell death rate assays were performed (using the LIVE/DEAD cell Activity assay kit from THERMO FISHER Co.):

A. 1000g centrifugation for 5min to collect 1X 10 ⁵ A cell;

B. the supernatant was discarded, the cell pellet was washed 1 time with 1mL of PBS and centrifuged again at 1000g for 5min to collect the cells;

C. cells were resuspended with 1mL PBS;

D. Adding 1 mu L of fluorescent dye provided by the kit, and uniformly mixing;

E. incubation for 30 minutes at room temperature in the dark;

F、BD Accuri ^TM c6 (BD) flow cytometer detection.

5. Data processing and result analysis

The results of the flow cytometer detection were subjected to data analysis by flowjo_v10 software and statistical analysis by GraphPad Prism 8 software. The results show mean ± standard deviation. Statistical methods mean-to-mean comparisons were determined to be statistically significant using t-test with P <0.05, P <0.01, P < 0.001. 3 replicates were run in parallel for each case.

Taking fluorescence Intensity (Intensity) as an abscissa and cell number as an ordinate, normal living cells only show one peak with weaker fluorescence Intensity; the fluorescent dye infects more as the cells die, and thus a peak of stronger fluorescence intensity appears. FIG. 6 shows a graph of the results of induction of cell death following infection of AML-LSC and myeloid AML cells by a miR-31-5 p-expressing lentivirus. As shown in FIG. 6a, the expression of miR-31-5p causes the cell to have a strong fluorescence peak, indicating that the cell is dead. The statistics of FIG. 6b show that the mortality of the cells of the 3 different case control groups was less than 5% regardless of whether they were AML-LSC cells or bone marrow AML cells, but that the mortality of the cells of the miR-31-5p expression group was significantly increased, and that the average mortality of the AML-LSC and bone marrow AML cells of the 3 cases AML-5, AML-8 and AML-9, respectively, were: AML-LSC (41±3, 30.4±3.5 and 39.8±4.8), bone marrow AML cells (43.5±5.1, 51.4±4.9 and 43.4±6.6). Thus, miR-31-5p expression is effective in inducing AML-LSC and myeloid AML cell death.

Example 6 influence of miR-31-5p Combined chemotherapeutic drug on AML-LSC cells and bone marrow AML cells

1. Sample selection and numbering

2. Culture of AML-LSC and myeloid AML cells

AML-LSC culture was performed as in example 4.

3. Lentiviral infection

AML-LSC lentivirus infection method was as in example 4.

4. Cell death detection

After culturing lentiviral-infected AML-LSC and bone marrow AML cells for 72 hours, the culture was continued for 24 hours in medium with or without 5. Mu.M chemotherapeutic agent cytarabine (Ara-C), respectively, and then cell death rate detection was performed. The specific detection method is the same as in example 5.

5. Data processing and result analysis

FIG. 7 shows a graph of the results of cell death following infection of AML-LSC and bone marrow AML cells with miR-31-5 p-expressing lentiviruses. As shown in FIGS. 7a and 7b, the miR-31-5p expression-group cell death rate was increased, regardless of whether AML-LSC cells or bone marrow AML cells. However, mortality of AML-LSC cells and bone marrow AML cells was further increased following the combination of the chemotherapeutic drug cytarabine. The average mortality changes for AML-LSC and myeloid AML cells in 3 cases of AML-5, AML-8 and AML-9 were: AML-LSC (36.+ -. 2.9 up to 72.+ -. 6.6, 33.6.+ -. 4.5 up to 64.6.+ -. 6.9, and 29.3.+ -. 3.6 up to 47.3.+ -. 4.6), bone marrow AML cells (41.6.+ -. 3.3 up to 65.3.+ -. 6.6, 39.3.+ -. 6.5 up to 73.6.+ -. 4.1, and 46.3.+ -. 7.1 up to 69.6.+ -. 5.7). Thus, miR-31-5p expression can be effective in enhancing chemotherapy-induced AML-LSC and bone marrow AML cell death.

EXAMPLE 7 in vivo experiments in animals verify the effect of miR-31-5p expression on AML and AML-LSC

1. Cell culture and viral infection

AML-LSC cultures and lentiviral infection methods were as in example 4.

2. Raising laboratory animals

4-6 weeks old B-NDG immunodeficient mice were purchased from Beijing Bai Chart Biotechnology Co. Mice were purchased and kept in SPF-class animal houses for 1 week after acclimatization and then subjected to the experiment.

3. Treatment of experimental animals prior to cell transplantation

24 hours before cell transplantation experiments, B-NDG immunodeficient mice are irradiated by a Rad Source RS2000 series X-ray biological irradiation instrument, and the irradiation dose is 2Gy, so that the residual immune system is destroyed.

4. Establishment of B-NDG mouse leukemia model

AML-LSC cells infected with the expression control RNA (Control RNA) and miR-31-5p (miR-31-5 p) lentivirus are respectively injected into mice through tail vein within 24 hours, and the number of the injected cells is 1 multiplied by 10 ⁶ And establishing a B-NDG mouse leukemia model by using cells/mice. AML-LSC cells of each case were injected into 12 mice individually.

5. Positive cell detection

After 2 weeks of transplantation, 6 mice from each group were dissected at random, bone marrow cells were isolated, stained with anti-human CD45, CD34 antibodies, and the positive cell proportion was detected by flow cytometry (CD 45 molecules were expressed on all leukocytes, anti-human CD45 antibodies specifically recognized human leukocytes transplanted in mice, so the proportion of CD45+ cells reflects the proportion of human AML cells transplanted in mice, CD45 ⁺ CD34 ⁺ The cells reflect the transplanted human AML-LSC). The specific method comprises the following steps:

A. the bone marrow of the mice is taken, and after removing red blood cells by using a red blood cell lysate, bone marrow cells are obtained.

B. Cells were washed 1 time with PBS and centrifuged at 1000rpm for 5min to collect cells.

C. Cell staining buffer (Biolegend) resuspended cells and adjusted to a cell density of 10 ⁶ Individual cells/mL.

D. 200. Mu.L of the cell suspension was taken and 20. Mu.L of FcR blocking reagent was added.

E. mu.L of FITC-labeled anti-human CD45 antibody and 5. Mu.L of APC-labeled anti-human CD34 antibody were added.

F. Incubation was carried out at room temperature for 30min in the absence of light, during which the mixing was reversed every 10 min.

G、BD Accuri ^TM C6 (BD) flow cytometer detection.

6. Drawing of survival curves of mice

The remaining 6 mice were kept on feeding, the death time was recorded, and a survival curve was drawn.

7. Data processing and result analysis

The results of the flow cytometer detection were subjected to data analysis by flowjo_v10 software and statistical analysis by GraphPad Prism 8 software. The results show mean ± standard deviation. Statistical methods mean-to-mean comparisons were determined to be statistically significant using t-test with P <0.05, P <0.01, P < 0.001. Survival curves were plotted using the survivinal function of GraphPad Prism 8 software.

FIG. 8 shows the therapeutic effect of miR-31-5p expression on AML disease in B-NDG mice. Wherein:

the results in fig. 8a show that, 2 weeks after transplantation, the control group treated mice, AML cells (hCD 45 ⁺ Cells) were successfully implanted in the bone marrow cavity of mice, and the AML cell implantation rates in 3 cases, AML-5, AML-8 and AML-9, were: 40.5.+ -. 6.9, 32.5.+ -. 6.2 and 32.3.+ -. 7.3; in contrast, the implantation rate of cells expressing miR-31-5p group is obviously reduced, and the implantation rates are respectively as follows: 4.+ -. 3, 6.3.+ -. 4.5 and 7.7.+ -. 4.4.

FIG. 8b shows results showing AML-LSC cells in control treated mice after 2 weeks of transplantation(hCD45 ⁺ CD34 ⁺ Cells) were successfully implanted in the bone marrow cavity of mice, and the implantation rates of AML-LSC cells in 3 cases of AML-5, AML-8 and AML-9 were: 9.6.+ -. 3.9, 11.2.+ -. 4.6 and 8.1.+ -. 3.8; in contrast, the implantation rate of cells expressing miR-31-5p group is obviously reduced, and the implantation rates are respectively as follows: 1.5.+ -. 1.1, 1.1.+ -. 0.7 and 2.4.+ -. 1.5.

FIG. 8c shows that the control treated mice died from day 15 post-implantation, all mice died within 30 days, and median survival in the 3 cases of AML-5, AML-8 and AML-9 in the cell-implanted control mice was 19 days, 20 days and 19 days, respectively; in contrast, mice in the miR-31-5p expression group showed only a few deaths, with most mice having a survival period of greater than 40 days.

These results indicate that miR-31-5p expression in the B-NDG mouse model can inhibit AML and AML-LSC cell growth in the bone marrow of the mice, and the service life of the mice is remarkably prolonged.

The embodiments described above are preferred embodiments of the present disclosure, but the embodiments of the present disclosure are not limited by the embodiments described above, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principles of the present disclosure should be made by equivalent substitution methods, and are included in the scope of the present disclosure.

Sequence listing

<110> and university of south China

Application of <120> miR-31-5p in acute myelogenous leukemia

<130> MTI21012

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> RNA

<213> Homo sapiens

<400> 1

aggcaagaug cuggcauagc u 21

<210> 2

<211> 21

<212> DNA

<213> Homo sapiens

<400> 2

aggcaagatg ctggcatagc t 21

<210> 3

<211> 71

<212> RNA

<213> Homo sapiens

<400> 3

ggagaggagg caagaugcug gcauagcugu ugaacuggga accugcuaug ccaacauauu 60

gccaucuuuc c 71

<210> 4

<211> 71

<212> DNA

<213> Homo sapiens

<400> 4

ggagaggagg caagatgctg gcatagctgt tgaactggga acctgctatg ccaacatatt 60

gccatctttc c 71

<210> 5

<211> 23

<212> DNA

<213> Homo sapiens

<400> 5

ggaacgatac agagaagatt agc 23

<210> 6

<211> 18

<212> DNA

<213> Homo sapiens

<400> 6

ctcaactggt gtcgtgga 18

Claims

1. Use of a product for detecting miR-31-5p in the preparation of a reagent, chip or kit for assessing survival of a prognosis subject of acute myeloid leukemia;

wherein the product is capable of detecting the level of miR-31-5p in a biological sample;

wherein the subject has a shorter survival time if the level of miR-31-5p in the biological sample is lower than the corresponding level of miR-31-5p in a normal control sample;

the sequence of miR-31-5p is shown as SEQ ID NO. 1;

the product comprises a forward primer with a sequence shown as SEQ ID NO.2 and a reverse primer with a sequence shown as SEQ ID NO. 6.

2. The use according to claim 1, wherein the biological sample is selected from one or more of peripheral blood, bone marrow and tissue suspected of having leukemia cells.

3. The use of claim 1, wherein the subject is a human or other mammal.

4. The use of claim 1, wherein the level of miR-31-5p is detected using a high throughput sequencing method, a miRNA expression profiling chip, a quantitative PCR method, and/or a probe hybridization method.

5. The use according to claim 1, wherein the chip comprises a solid support and an oligonucleotide probe immobilized on the solid support.

The application of miR-31-5p and cytarabine in preparing a medicament for treating acute myelogenous leukemia is disclosed, wherein the sequence of miR-31-5p is shown as SEQ ID NO. 1.

7. The use of claim 6, wherein the miR-31-5p is natural, synthetic, or an expression vector that expresses a DNA fragment of the miR-31-5p, and wherein the sequence of the DNA fragment of miR-31-5p is set forth in SEQ ID No. 2.

8. The use according to claim 7, wherein the expression vector is a viral vector.

9. The use according to claim 8, wherein the viral vector is a retroviral vector.

10. The use according to claim 8, wherein the viral vector is selected from the group consisting of lentiviral vectors, adenoviral vectors, adeno-associated viral vectors, herpesviral vectors, alphaviral vectors, baculovirus vectors and vaccinia viral vectors.

11. The use of claim 6, wherein the miR-31-5p and cytarabine are administered alone or in combination.

12. The use according to any one of claims 6 to 11, wherein the medicament further comprises a pharmaceutically acceptable carrier.

13. The use according to claim 12, wherein the pharmaceutically acceptable carrier is selected from one or more of lactose, dextrose, sucrose, polyvinylpyrrolidone, alginates, cellulose, sorbitol, mannitol, starch, gum arabic, talc, magnesium stearate, calcium phosphate, calcium silicate, methyl hydroxybenzoate, propyl hydroxybenzoate, mineral oil, microcapsules and microspheres, nanoparticles, liposomes.

14. Use according to claim 13, the cellulose being selected from microcrystalline cellulose or methylcellulose.

15. The use according to any one of claims 6 to 11, wherein the medicament is in the form of an injection, an oral liquid, an extract, a powder, a suppository, an aerosol, a granule, a tablet or a capsule.

16. The use according to claim 15, wherein the injection comprises a sterile or sterile solution, a water injection, an oil injection or a powder injection; oral liquid dosage forms include solutions, syrups, emulsions or suspensions; the tablet comprises common compressed tablet, sugar-coated tablet, effervescent tablet, chewable tablet, multi-layer tablet, implant tablet, sustained release tablet or controlled release tablet.

17. The use of claim 6, wherein the medicament further comprises a dispersing agent or a stabilizing agent.

18. The use of claim 15, wherein the medicament further comprises a dispersing agent or a stabilizing agent.