CN114317760B - Application of miRNA (micro ribonucleic acid) as biomarker in bladder cancer diagnosis - Google Patents

Abstract

The invention relates to application of miRNA in bladder cancer diagnosis as a biomarker, and relates to the technical field of biological medicines. The invention provides an application of miRNA in a biological sample as a biomarker in bladder cancer diagnosis, wherein the miRNA is at least 1 of hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642a. The application can judge whether a subject who provides a biological sample has bladder cancer or not, or judge whether the subject has the risk of having bladder cancer or not, and is helpful for a clinician to rapidly master the state of illness of the patient, so that an individualized treatment scheme can be formulated in time.

Description

Application of miRNA (micro ribonucleic acid) as biomarker for diagnosing bladder cancer

Technical Field

The invention relates to the technical field of biomedicine, in particular to application of miRNA (micro ribonucleic acid) as a biomarker in bladder cancer diagnosis.

Background

Bladder cancer is a malignant tumor originating in the urothelium of the bladder and is one of the most common malignant tumors of the urinary system. Bladder cancer onset worldwide: the incidence rate is at the 11 th position of all malignant tumors, wherein the incidence rate of men is 9.0/10 ten thousand, and the incidence rate is at the 7 th position of the malignant tumors of men; the female is 2.2/10 ten thousand, and the position is listed after ten female positions; the mortality rate is in the thirteenth position of all tumors, the mortality rates of men and women are 3.2/10 ten thousand and 0.9/10 ten thousand respectively, and the mortality rate is listed in the 9 th position of male malignant tumors. In 2016, the predicted data of China shows 8.05 new cases of bladder cancer, wherein 6.21 cases of male (6 th malignant tumor in male) and 1.84 cases of female; 3.29 ten thousand deaths, of which 2.51 ten thousand in men (11 th malignant tumor in men) and 0.78 ten thousand in women. The onset of bladder cancer varies regionally, racially and sexually, and is seen in the age range of 50 to 70 years, with the incidence increasing with age.

The long-term chronic inflammation stimulation and long-term foreign body stimulation (indwelling catheter and calculus) in the bladder are closely related to the occurrence of bladder cancer, the main pathological types are squamous cell carcinoma and adenocarcinoma, the diagnosis is mostly late, and the prognosis is poor. The risk of the bladder cancer can be increased by cyclophosphamide chemotherapy, pelvic radiotherapy, phenacetin abuse and the like.

Research shows that the survival rate and the prognosis effect of the bladder cancer patient can be improved by 4-5 times by early diagnosis and treatment. Therefore, the method aims at early diagnosis and early screening of the bladder cancer, advances the treatment window of the bladder cancer patient, improves the prognosis of the patient, and timely evaluates the effect of radiotherapy and chemotherapy, and is particularly important for personalized medicine and medication of the bladder cancer patient.

At present, the screening or diagnosis of bladder cancer is mainly based on the history, symptoms and signs of patients, and clinical diagnosis is made by combining laboratory examination, imaging examination, urine cytology, urine tumor marker examination and cystoscopy. Cystoscopy is the most important examination, and pathological examination by cystoscopy is the gold standard for diagnosing bladder cancer. The imaging examination of the upper urinary tract can be used to determine whether or not renal pelvis and/or ureter tumors are combined. The imaging method can only detect tumors growing to a certain extent due to the technical characteristics of the imaging method, and the cystoscope biopsy pathological method can obtain tumor tissues from the bodies of patients, so that the operation technology is difficult, the cost is high, the efficiency is low, the patients are very painful in the whole process, the compliance is poor, the large-batch screening cannot be carried out, and the imaging method cannot be used for early screening and clinical diagnosis due to the influence of a plurality of factors such as the technical level of doctors, the body conditions of the patients and the like.

miRNA is non-coding small molecule RNA with the function of regulating gene expression at the level of posttranscriptional level, has the length of about 18-24nt, participates in a plurality of important biological processes such as cell division proliferation, differentiation and development, metabolism and the like, and has high conservation, time sequence and tissue specificity among biological species. It is located in the gene intron, and the mature miRNA enters the RNA-induced gene silencing complex (RISC) to form an asymmetric complex. The mature miRNA chain in the RISC can be specifically combined with the 3' untranslated region of the target mRNA, thereby degrading the target mRNA, blocking protein synthesis and regulating gene expression.

miRNA is taken as a small non-coding RNA which is abnormally expressed in some tumors, participates in the regulation of related genes of the occurrence and development of a plurality of tumors, plays a very critical role in the process, is stable even in the presence of a large amount of ribozymes, is abundantly expressed in various body fluids, and can be used as a biomarker for tumor diagnosis and prognosis judgment. In future clinical treatment, miRNA not only can become a novel marker related to early disease diagnosis and disease process, but also is expected to treat diseases by changing the expression of miRNA or the expression of target genes thereof. The search and identification of mirnas and their target genes associated with disease development provide the basis for clinical treatment of mirnas.

Based on the above reasons, finding a biomarker miRNA with high sensitivity and specificity for diagnosing bladder cancer, and establishing a noninvasive early-stage screening method and a detection method for evaluating the treatment effect of radiotherapy and chemotherapy are hot spots of current research and urgent. The Liquid Biopsy technology (Liquid Biopsy) can just solve the pain point at present, and can well solve the problems. At present, no ideal product for screening bladder cancer exists clinically, and some diagnostic products of pan-cancer species mainly detect gene mutation by high-throughput sequencing on DNA fragments in blood, circulating tumor cells in blood and micro-RNA.

However, despite the vast information on the general condition of a blood sample, there are some inherent drawbacks to performing a liquid biopsy by extracting miRNA from blood: first, blood collection is invasive, causing discomfort to the patient; secondly, such direct detection of naked DNA or miRNA in blood also results in varying degrees of loss and degradation; thirdly, the components in the blood are complex, the sources are various, the information is mottled, and nonspecific interference and interference caused by hydrodynamic action can be caused in the detection and analysis process; fourthly, blood has the characteristic of easy coagulation, and needs to be subjected to anticoagulation treatment for the next detection, and the anticoagulation treatment per se may have certain influence on the detection result; fifth, a large number of cells in the blood have half-lives of seconds to weeks or more than a month, and may also have an effect on the assay results.

Therefore, it is necessary to find a biomarker miRNA for diagnosing bladder cancer with high sensitivity and specificity and establish other liquid biopsy techniques besides blood as a sample.

Disclosure of Invention

In view of the above problems, the present invention provides an application of miRNA as a biomarker in diagnosing bladder cancer, which can determine whether a subject providing a biological sample has bladder cancer or whether the subject is at risk of having bladder cancer, and thus helps a clinician to rapidly grasp the condition of a patient, thereby making an individualized treatment plan in time.

In order to achieve the purpose, the invention provides application of miRNA in a biological sample as a biomarker in bladder cancer diagnosis, wherein the miRNA is at least 1 of hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642a.

In the research process, the miRNA in urine exosomes of bladder cancer patients and normal people are extracted by strictly organizing and evaluating patients, the expression difference of the miRNA in the urine exosomes is screened at high flux through a gene chip, and 4 miRNAs (hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642 a) are screened from the miRNA. Meanwhile, Q-PCR is applied to carry out verification of a large sample, and four pieces of miRNA (hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642 a) are proved to be remarkably up-regulated in urine exosomes of bladder cancer patients and have higher consistency with bladder cancer tissues, so that one or more of the four pieces of miRNA can be used as bladder cancer markers and applied to preparation of bladder cancer diagnosis products.

The invention also provides application of miRNA in a biological sample as a biomarker in development and/or preparation of products for diagnosis of bladder cancer, and is characterized in that the miRNA is at least 1 of hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642a.

In one embodiment, the miRNAs include hsa-miR-221, hsa-miR-215, and hsa-miR-642a.

In one embodiment, the miRNAs are hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642a.

In one embodiment, the bladder cancer comprises urothelial cancer, squamous cell carcinoma, inter-cellular carcinoma, small cell carcinoma, mixed carcinoma, carcinosarcoma, or metastatic cancer.

The invention also provides a product for diagnostic use in bladder cancer, the product comprising: a reagent for detecting the expression level of the miRNA in a biological sample.

In one embodiment, the reagent for detecting the expression level of the miRNA in the biological sample comprises: the kit comprises a reagent for extracting urine exosomes, a reagent for extracting RNA of the urine exosomes, an RNA reverse transcription reagent and an RNA quantitative detection reagent.

In one embodiment, the biological sample is urine.

Urine is an important component of liquid diagnosis, and has gained more and more attention in recent years, and many molecular substances in blood are also found in urine, and have a remarkable role in early diagnosis of diseases. The urine is called as ultrafiltrate of blood, many active components in the blood are removed, the components are purer relative to the blood, compared with other liquids, the urine is easy to control and difficult to coagulate, and the influence of anticoagulation treatment and the like on the test result can be well eliminated. Meanwhile, urine collection is noninvasive, a subject basically has no pain and discomfort, repeatability is realized, safety and cheapness are realized, detection is convenient, a plurality of markers can be detected by one-time sampling, and quantification can be realized. Therefore, the urine used as the biological sample has obvious advantages compared with other body fluids.

The present invention also provides a system for diagnosing bladder cancer, the system comprising:

an analysis device: the miRNA expression level detection module is used for detecting the miRNA expression level in a biological sample of a subject to be diagnosed and inputting the miRNA expression level into an evaluation model for diagnosis and analysis;

an output device: for outputting the above diagnosis result.

The present invention also provides a method for detecting bladder cancer, which is a non-disease diagnostic method, comprising the steps of: collecting urine, extracting urine exosomes, extracting miRNA in the urine exosomes, and detecting the expression level of the miRNA.

Compared with the direct detection of miRNA in blood or urine of a subject, the method has obvious advantages by detecting miRNA of exosomes in urine of the subject, exosomes in urine are more stable than urine, and the secretory vesicles of exosomes can effectively protect miRNA from being decomposed by nuclease.

Compared with the prior art, the invention has the following beneficial effects:

the invention provides application of miRNA in bladder cancer diagnosis as a biomarker, which can judge whether a subject providing a biological sample suffers from bladder cancer or whether the subject has a risk of suffering from bladder cancer, and is helpful for a clinician to rapidly master the state of illness of a patient, so that an individualized treatment scheme can be formulated in time.

Drawings

FIG. 1 is a schematic diagram showing the results of real-time fluorescent quantitative PCR detection in example 2;

FIG. 2 is a schematic diagram showing the results of the correlation analysis of miRNA in urine exosomes with miRNA in bladder cancer tissue of example 3;

FIG. 3 is a diagram showing the results of the sensitivity and specificity analysis of miRNA in urine exosomes of example 4;

FIG. 4 is a diagram showing the results of the sensitivity and specificity analysis of the panel assay combining hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642a in urine exosomes of example 5;

FIG. 5 is a diagram showing the results of the sensitivity and specificity analysis of the panel assay combining hsa-miR-221, hsa-miR-215 and hsa-miR-642a in urine exosomes of example 5.

Detailed Description

To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.

Defining:

exosomes (exosomes) of the present invention: the vesicle corpuscle is a vesicle corpuscle surrounded by a double-layer lipid membrane with the diameter of only 30-100nm nanometers, can be secreted and released by various cells in organisms such as B cells, T cells, dendritic cells, mast cells, endothelial cells, fibroblasts, mesenchymal stem cells, tumor cells and the like, naturally exists in body fluid, has high abundance in blood, urine, ascites, breast milk and the like, contains protein, RNA and fat components, participates in substance exchange and information exchange among cells, influences the physiological state of the cells, and is closely related to the occurrence and progress of various diseases. The tumor cells will secrete exosomes continuously in the growth process, so that the exosomes enter a lymphatic system and capillaries in tumor tissues, and the tumor cells play a role in inhibiting or promoting malignant tumors and the like. The information carried by the exosome is diversified, and the protein and the nucleic acid in the exosome can be used for early diagnosis of cancer, relapse monitoring, drug resistance monitoring and other related analysis. The exosome is easier to enrich, and the secretory vesicle of the exosome can effectively protect nucleic acid substances from being decomposed by nuclease, so that the exosome is very useful in clinical application; and the exosome is more stable, and even a sample stored at the temperature of 70 ℃ below zero for 30 years can be extracted from the exosome. The exosome contains rich miRNA, so that the detection of the exosome-derived miRNA is beneficial to early diagnosis, curative effect evaluation and prognosis analysis of tumors.

Reagents, materials, equipment sources:

miRNA SYBR GREEN forward primer and universal reverse primer (huada gene).

Reagents, materials and equipment used in the embodiment are all commercially available sources unless otherwise specified; unless otherwise specified, all the experimental methods are routine in the field.

Example 1

The gene chip screens the expression difference of miRNA in urine exosomes of bladder cancer patients and normal persons in a high-throughput manner.

In the embodiment, the miRNAs in the urine exosomes of 20 bladder cancer patients and the miRNAs in the urine exosomes of 20 normal volunteers are extracted, and then the miRNA expression difference between the bladder cancer patients and the normal volunteers is screened at high throughput through a gene chip. The method specifically comprises the following steps:

1. collection, storage and transportation of urine.

In this example, urine samples from 20 patients with bladder cancer in a hospital and 20 normal volunteers in the hospital were collected, and the age, male and female differences, smoking and other factors were strictly controlled between the two groups. The collection, storage and transportation are carried out according to the following standards and steps:

(1) Collecting: 20ml of the subject's urine was collected at 8-10 am and taken care to avoid bacterial contamination, and urine specimens were sent immediately in clean, dry disposable urine cups prepared in the laboratory.

Attention to diet control before collection; centrifuging at 3000 Xg for 15min to remove cells or cell debris; women avoid taking urine during menstruation, and men avoid prostate fluid or semen from mixing into the specimen. Filling in a sample registration list, and recording the conditions of sample name, organization type, number, sampling date, sample processing process and the like.

(2) And (3) storage: the collected urine is stored in a refrigerator at the temperature of minus 80 ℃ after being centrifuged in an aseptic storage tube, and the urine can be stored for a long time in a frozen state.

(3) And (3) transportation: if the transportation is needed, the food can be placed in a dry ice transportation box for freezing and transportation.

2. And (4) extracting urine exosomes.

10ml of urine from each bladder cancer patient and 10ml of urine from each normal person (the amount of urine not centrifuged is at least 5 ml) were collected, centrifuged at 300 Xg for 10 minutes, and the supernatant was collected. The mixture was centrifuged at 2000 Xg for 10 minutes to obtain a supernatant. The mixture was centrifuged at 10,000 Xg for 30 minutes to obtain a supernatant. 100,000 Xg, at 4 ℃ for 90 minutes, removing the supernatant, the remaining precipitation of PBS heavy suspension, again with 100,000 Xg centrifugal 90 minutes. And centrifuging, then removing the supernatant, collecting the white precipitate of the exosome, and re-suspending the white precipitate of the exosome with a proper amount of 1X exosome suspension (phosphate buffered saline solution) to obtain the exosome suspension. The corresponding amounts of exosomes were analyzed according to Nanosight as shown in the table below.

TABLE 1 exosome counts

3. And extracting miRNA in the urine exosomes.

And (3) adding 250ul-500ul of RNA extracting solution (phenol and RNase inhibitor) into the white precipitates of the urine exosomes of the bladder cancer patient and the normal person obtained in the step (2), repeatedly blowing and beating, splitting at room temperature for 5min-15min, uniformly mixing, and adding the corresponding miRNA external reference cel-miR-39 for subsequent analysis and standardization. Adding 50ul of RNA impurity removing solution (chloroform), swirling, mixing well, standing at room temperature for 5-15min, centrifuging at 10000-13000 g for 5-15 min, transferring the upper layer water phase to another new tube, adding equal volume of RNA precipitation solution (isopropanol), reversing from top to bottom, mixing well, standing at room temperature for 5-15 min, or precipitating at-20 deg.C. Centrifuging at 10000g-13000g for 5min-15min, discarding supernatant, adding 250ul-500ul-20 deg.C precooled RNA washing solution (75% DEPC ethanol) to wash and precipitate, shaking and mixing, centrifuging at 12000g for 5min, discarding ethanol solution, and standing on super clean bench to air dry and precipitate completely. Dissolving the precipitate with RNA enrichment solution (DEPC aqueous solution), detecting purity and concentration with NanoDorp2000 ultraviolet spectrophotometer, sealing with miRNA sealing membrane, and storing at-80 deg.C. The results of the detection and analysis by using a NanoDorp2000 ultraviolet spectrophotometer are shown in the following table.

TABLE 2 concentration of RNA in urine exosomes

4. And carrying out chip screening on miRNA in the urine exosomes.

And (3) the miRNA in the urine exosomes of the bladder cancer patients and the miRNA in the urine exosomes of normal volunteers are subjected to miRNA detection with a proper volume according to the total RNA concentration for carrying out microRNA chip screening, wherein the miRNA chip (Agilent Human miRNA (8 × 60K) array) screening is completed by analysis of Shanghai gold region medical inspection Limited.

The chip screening results of the urine exosome miRNA are shown in the following table, and the biomarker combination is obtained by combining the chip screening results and clinical practice experience: hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642a.

TABLE 3 chip screening results of urine exosome miRNA

Name of system	p value
		hsa-miR-211	0.003126498
hsa-miR-101	0.002492194
		hsa-miR-215	0.004102011
hsa-miR-642a	0.002479016

The specific sequences of hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642a are respectively shown in SEQ ID NO: 1-4.

hsa-miR-221(MIMAT0004568)：ACCUGGCAUACAAUGUAGAUUU(SEQ ID NO:1)；

hsa-miR-101-5p(MIMAT0004513)：CAGUUAUCACAGUGCUGAUGCU(SEQ ID NO:2)；

hsa-miR-215-5p(MIMAT0000272)：AUGACCUAUGAAUUGACAGAC(SEQ ID NO:3)；

hsa-miR-642a-5p(MIMAT0003312)：GUCCCUCUCCAAAUGUGUCUUG(SEQ ID NO:4)。

Example 2

And (3) verifying the diagnosis of the bladder cancer by hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642a through Q-PCR.

Extracting miRNA in urine exosomes of 100 patients with bladder cancer and miRNA in urine exosomes of 40 normal persons in a certain hospital, performing Q-PCR verification on hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642a screened in example 1, and performing relative quantification by a delta-delta CT method. The method specifically comprises the following steps:

1. miRNA in urine exosomes are reversely transcribed into cDNA.

The miRNA in the urine exosomes of 100 patients with bladder cancer is respectively and reversely transcribed into cDNA by a tailing method and a stem-loop method, and the miRNA in the urine exosomes of 40 normal persons is respectively and reversely transcribed into cDNA, and a 25uL reverse transcription reaction system is prepared by adopting a mature kit on the market, such as All-in-one TMmiRNA qRT-PCR Detection (QP 015 and QP 016) of a multifunctional company according to the operation of a specification and the proportion shown in the following table.

TABLE 4 reverse transcription System

Composition (A)	Dosage form
		5 miRNA reverse transcription buffer solution	5uL
miRNA RTase mixed liquor	1uL
		miRNA polyA polymerase	1uL
Total RNA	1ng-5ng
		DEPC water	Make up to 25uL

The components are mixed evenly, the mixture is placed in a PCR instrument for 5min at 37 ℃ and 1h and 85 ℃ after simple centrifugation, and the obtained product cDNA is placed in a refrigerator at-80 ℃ for standby.

2. And detecting the cDNA by Q-PCR.

A mature kit on the market, such as All-in-one TMmiRNA qRT-PCR Detection (QP 015, QP 016) of a compound energy company, is adopted, cDNA obtained by miRNA reverse transcription is detected according to the operation of an instruction, and a 20uL Real Time PCR reaction system is prepared according to the proportion shown in the following table.

TABLE 5 Real Time PCR reaction System

Real-Time fluorescent quantitative PCR detection was performed using an Applied Biosystems 7500 Real Time PCR System, and relative quantification was performed by the Δ CT method. The Real Time PCR reaction conditions were 95 ℃ for 10min, (95 ℃ for 10s,60 ℃ for 20s,72 ℃ for 10 s) for 40 cycles. The results are shown in FIG. 1.

As can be seen from FIG. 1, Q-PCR verification is performed on the four miRNAs screened by the chip, which shows that the expression levels of hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642a in bladder cancer are higher than those in normal tissues (the number of samples of bladder cancer patients is n =100, the number of samples of normal volunteers is =40, and the statistical difference p is less than 0.001), and the result is consistent with the high-throughput screening result of the gene chip, which shows that one or more of hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642a can better diagnose bladder cancer.

Example 3

And (3) analyzing the correlation between miRNA in urine exosomes and miRNA in bladder cancer tissues.

Taking hsa-miR-221 as an example, the correlation analysis is carried out on hsa-miR-221 in cancer tissues of bladder cancer patients and hsa-miR-221 in urine exosomes of bladder cancer patients, and the result is shown in figure 2.

The results in FIG. 2 show that: the correlation p =0.0188 shows that the hsa-miR-221 in the urine exosome of the bladder cancer patient has better consistency with the hsa-miR-221 in the bladder cancer tissue, and miRNA in the urine exosome can reflect the miRNA expression level of the cancer tissue.

Therefore, the screened miRNA (hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642 a) has larger expression difference between bladder cancer tissues and normal tissues, and can better diagnose the bladder cancer.

Example 4

And (3) analyzing the sensitivity and specificity of miRNA in the urine exosome.

Taking hsa-miR-221 as an example, the sensitivity and specificity of miRNA in urine exosomes are analyzed by applying ROC curve, and the result is shown in figure 3.

The results in FIG. 3 show that: when the hsa-miR-221 is used for distinguishing the bladder cancer tissue from the normal tissue, the AUC value is 0.74, the cutoff point sensitivity is 80%, and the specificity is 80%. Thus the kit has clinical application significance for diagnosing and screening the bladder cancer.

Therefore, hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642a also have the characteristics of high sensitivity and strong specificity, can be used for better diagnosing and screening bladder cancer, and have clinical application significance.

Example 5

And (3) analyzing the sensitivity and specificity of miRNA combination panel detection in urine exosomes.

Comparing and analyzing the hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642a combined panel with the hsa-miR-221, hsa-miR-215 and hsa-miR-642a combined panel, and analyzing the sensitivity and specificity of miRNA in urine exosomes by using an ROC curve, wherein the result is shown in figure 4 and figure 5.

The results of fig. 4 and 5 show that: the detection result of the hsa-miR-221, hsa-miR-101, hsa-miR-215 and hsa-miR-642a combined panel is superior to that of the hsa-miR-221, hsa-miR-215 and hsa-miR-642a combined panel and is superior to that of a single marker. The combination panel of 4 markers has more clinical application significance for the diagnosis and screening of the bladder cancer. Therefore, the combination panel of 4 markers has higher sensitivity and specificity, can better diagnose and screen the bladder cancer, and has more clinical application significance.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Shanghai gold region medical laboratory Co., ltd

Application of <120> miRNA in bladder cancer diagnosis as biomarker

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

accuggcaua caauguagau uu 22

<210> 2

<211> 22

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

caguuaucac agugcugaug cu 22

<210> 3

<211> 21

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

augaccuaug aauugacaga c 21

<210> 4

<211> 22

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gucccucucc aaaugugucu ug 22

Claims (7)

1. The application of the reagent for detecting the miRNA expression level in the biological sample in the preparation of products for the diagnosis application of bladder cancer is characterized in that the miRNA comprises hsa-miR-221, hsa-miR-215 and hsa-miR-642a.

2. The use of claim 1, wherein the mirnas are hsa-miR-221, hsa-miR-101, hsa-miR-215, and hsa-miR-642a.

3. The use of any one of claims 1-2, wherein the bladder cancer comprises urothelial cancer, squamous cell carcinoma, inter-cellular cancer, small cell cancer, mixed type cancer, carcinosarcoma or metastatic cancer.

4. Use according to claim 1, characterized in that it comprises the following steps: collecting urine, extracting urine exosomes, extracting miRNA in the urine exosomes, and detecting the expression level of the miRNA in any one of claims 1-2.

5. A product for diagnostic use in bladder cancer, the product comprising: a reagent for detecting the expression level of the miRNA of any one of claims 1-2 in a biological sample, the reagent for detecting the expression level of the miRNA in a biological sample comprising: the kit comprises a reagent for extracting urine exosomes, a reagent for extracting RNA of the urine exosomes, an RNA reverse transcription reagent and an RNA quantitative detection reagent.

6. The product of claim 5, wherein the biological sample is urine.

7. A system for diagnosing bladder cancer, the system comprising:

an analysis device: for detecting the expression level of the miRNA of any one of claims 1-2 in a biological sample of a subject to be diagnosed, inputting the expression level into an evaluation model for diagnostic analysis;

an output device: for outputting the diagnosis result.

Images