CN115305283A

CN115305283A - Exosome small non-coding RNA molecular marker and application thereof

Info

Publication number: CN115305283A
Application number: CN202111441546.7A
Authority: CN
Inventors: 张灏
Original assignee: Jinan University
Current assignee: Jinan University
Priority date: 2021-11-30
Filing date: 2021-11-30
Publication date: 2022-11-08

Abstract

The invention discloses an exosome small non-coding RNA molecular marker and application thereof, belonging to the field of tumor liquid biopsy and molecular diagnosis. The exosome small non-coding RNA molecular marker is at least one of tRNA-GlyGCC-5 and sRESE; the nucleotide sequence of the tRNA-GlyGCC-5 is shown as SEQ ID NO. 1; the nucleotide sequence of sRESE is shown in SEQ ID NO. 2. The sRESE in the invention is a brand-new small non-coding RNA sequence, and is the first discovery of the inventor that the sRESE has important significance for the research of esophageal cancer markers and disease progression mechanisms. The tumor diagnosis kit comprising the exosome small non-coding RNA molecular marker provided by the invention is a liquid diagnosis monitoring kit which has non-invasiveness, high sensitivity and high specificity and is suitable for census screening.

Description

Exosome small non-coding RNA molecular marker and application thereof

Technical Field

The invention belongs to the field of tumor liquid biopsy and molecular diagnosis, and particularly relates to an exosome small non-coding RNA molecular marker and application thereof.

Background

Cancer continues to threaten human health, about 700 thousands of people die of cancer every year, the cancer is hidden and rapidly developed, the cancer often develops to a late stage when clinical symptoms appear or a hospital visit occurs, and most patients die within years after diagnosis. The 5-year survival rate of malignant tumor patients in developed countries in Europe and America is 60% -70%, while the survival rate in China is only 30.9%, and the survival rate in rural areas is half of that in cities. One of the key factors contributing to such high tumor mortality is the lack of early diagnostic tools that deprive patients of the opportunity for early treatment. Taking esophageal cancer as an example, china is a country with high incidence of esophageal cancer, the number of the incidence of the esophageal cancer accounts for 50% of the world, and the esophageal cancer in China is mostly squamous carcinoma, which is different from the western countries. Esophageal cancer has no obvious symptoms in the early stage, swallowing obstruction appears in the middle and late stages, most patients are in the late stage when in clinic, and the optimal treatment time is missed. There is evidence to investigate that early treatment can increase the 5-year survival rate of patients from 20-30% to 60-80% relative to late treatment.

The current diagnosis of esophageal cancer relies on imaging and histopathology, the former of which only detects sufficiently large tumors, while the latter requires endoscopic or surgical esophageal harvesting of the tumor tissue from the patient. The two measures have many defects, such as poor sensitivity, poor patient compliance caused by invasive examination, high cost, low examination efficiency, incapability of carrying out screening and general examination in large batch, and difficulty in early screening due to the influence of many factors such as the technical level of doctors and the physical conditions of patients. Therefore, early diagnosis of esophageal cancer requires the use of a sensitive, noninvasive or minimally invasive diagnostic technique based on tumor-specific markers.

The existing tumor markers include various types such as DNA, RNA, protein, non-coding RNA, and the like, and expression forms of the markers can be classified into gene mutation, amplification, high expression, and the like. In recent years, some small non-coding RNAs are gradually found to be tumor markers, such as miRNA, piRNA, snorRNA, small non-coding RNA, tsRNA and some unnamed non-coding RNAs. These different types of small non-coding RNA participate in various biological regulation processes in cells and can participate in the communication and regulation among cells. Research shows that when tumor occurs, the expression amount of various types of small RNA of cells can be changed to different degrees, and the small RNA is involved in the process of tumor progression or is used as a product of tumorigenesis and development. tsRNA is a small class of RNA derived from transfer RNA (tRNA), and more studies have shown that tsRNA expression is temporally and spatially regulated and plays an important role in many biological processes. tsRNA is easily produced by cleavage with RNase such as angiogenin, RNY1, dicer and the like under stress such as amino acid deficiency, oxidative stress, hypoxia and the like. tsRNA is a potential tumor-specific target, as factors such as nutrient deficiency, hypoxia in the tumor microenvironment and the like easily drive the production of tsRNA. At present, no research on tsRNA as a marker exists in esophageal cancer.

The current sources of liquid biopsy markers mainly include CTCs, ctDNA, and exosomes. CTC and ctDNA are mainly from blood and are studied earlier, but the CTC is circulating tumor cells released into peripheral blood from solid tumors, and the ctDNA is DNA released into peripheral blood from tumor cells. ctDNA is partial to the front end and is mainly used for early cancer screening, personalized medication guidance and drug resistance analysis by detecting mutation and DNA methylation, but the content of ctDNA in plasma is limited (10-20 ng/mL), and how to effectively enrich ctDNA is still the most critical step and difficulty of related analysis. CTC is mainly used for real-time monitoring and prognosis determination of cancer, but has many problems. For example, the current detection method can only find a small amount of tumor cells, and can not achieve the purpose of guiding individualized medication; and circulating tumor cells have a plurality of types, and the existing detection method can only detect a few types, has high omission factor and high detection cost.

Exosomes are playing an increasingly important role in disease diagnosis as an emerging vehicle for liquid biopsy markers compared to CTC and ctDNA. Exosomes can be secreted and released by almost various cells in bodies such as B cells, T cells, dendritic cells, mast cells, endothelial cells, fibroblasts, mesenchymal stem cells and tumor cells, exist in various body fluids such as blood, saliva, urine, ascites, cerebrospinal fluid and breast milk, contain various contents such as proteins, nucleic acids and metabolites, and are closely related to the occurrence and progress of various diseases.

Saliva is an important component of liquid diagnosis, has gained more and more attention in recent years, and has a remarkable role in early diagnosis of diseases. Salivary glands are abundant in blood, saliva is considered as an end product of blood circulation, and many molecular substances in blood are also found in saliva. Saliva, known as the ultrafiltrate of blood, is purer than blood and removes many of the usual components of blood. Compared with other liquids, saliva is easy to control and not easy to coagulate, and the influence of anticoagulation treatment on test results is eliminated. Meanwhile, saliva collection is noninvasive, subjects have no pain and discomfort, and the method has repeatability, safety and low price. In addition, the components in blood are complex, the sources are various, the information is mottled, nonspecific and interference by hydrodynamic action can be caused in the detection and analysis process, a large number of cells in blood have half-lives of several seconds to several weeks or more than one month, the analysis result can be influenced, and saliva does not have the problems. In summary, saliva has a significant advantage as a source of fluid biopsy markers over other bodily fluids.

While liquid biopsy is being developed, it is still in need of improvement. The type of the liquid and the detection index are adopted. The selection of an appropriate body fluid for detection is crucial to the clinical efficacy of liquid biopsy, and most of the current liquid biopsies mainly use blood as a detection object, but the cellular components in the blood are complex, and some free DNA, exosomes and the like in the blood come from blood cells (such as platelets), which may have a great influence on the detection result. In addition, the proper detection index is also an important factor for improving the sensitivity and specificity of liquid biopsy, the liquid biopsy index is firstly easy to store, strong in stability and not easy to degrade under the influence of enzyme or external factors, and secondly has disease specificity, and the progress state of in-vivo diseases can be accurately reflected.

In summary, the prior art often has the following disadvantages: 1) The current detection means mainly comprising ctDNA and CTC in clinic is difficult to realize early diagnosis of malignant tumor due to the limitation; 2) The existing liquid biopsy method taking blood as a collected sample has certain traumatism besides the problem of blood coagulation, brings discomfort to patients, has the problems of poor patient compliance and the like, and is not beneficial to realizing continuous monitoring; 3) Current detection means lack sufficient sensitivity and specificity; 4) The materials are inconvenient to obtain and are not easy to store; 5) The operation is carried out with high requirements on doctors. No technology for solving the above problems is available.

At present, no report related to the application of the exosome small non-coding RNA molecular marker in the diagnosis of esophageal cancer is found.

Disclosure of Invention

Aiming at the defects and shortcomings in the prior art, the invention aims to provide an exosome small non-coding RNA molecular marker.

The invention also aims to provide application of the above exosome small non-coding RNA molecular marker.

The purpose of the invention is realized by the following technical scheme:

an exosome small non-coding RNA molecule marker, which is at least one of tRNA-GlyGCC-5 and sRESE;

the nucleotide sequence of tRNA-GlyGCC-5 is as follows:

GCATGGGTGGTTCAGTGGTAGAATTT(SEQ ID NO:1)；

the nucleotide sequence of sRESE is as follows:

GCATGATCTGAGTTCCTGTTTCTTCTG(SEQ ID NO:2)。

the exosome is preferably a saliva exosome.

The application of the exosome small non-coding RNA molecular marker in preparing tumor diagnosis products.

The tumor is malignant tumor; preferably esophageal cancer; the esophageal cancer preferably comprises esophageal squamous carcinoma.

The tumor diagnosis product preferably comprises a tumor diagnosis kit.

A tumor diagnosis kit comprises the exosome small non-coding RNA molecular marker.

The tumor diagnosis kit also comprises an exosome RNA extraction component, an exosome small non-coding RNA reverse transcription component and an exosome real-time quantitative component.

The exosome RNA extraction component preferably comprises an exosome RNA extracting solution, an exosome RNA impurity removing solution, an exosome RNA precipitation solution, an exosome RNA cleaning solution and an exosome RNA enrichment solution.

The exosome small non-coding RNA reverse transcription component preferably comprises 5 xmiRNA reverse transcription buffer solution, miRNA RTase mixed liquor, miRNA polyA polymerase, DEPC water and total RNA.

The kit also comprises a primer for amplifying the small non-coding RNA molecular marker of the exosome;

the primers used for tRNA-GlyGCC-5 are:

a forward primer: gtggttcagtgggtagaattta;

reverse primer: a universal reverse primer;

primers used for sRESE were:

a forward primer: CTGAGTTCCTGTTTTCTTCTGA;

reverse primer: a universal reverse primer.

Compared with the prior art, the invention has the following beneficial effects:

(1) The inventors surprisingly found that tRNA-GlyGCC-5 and sRESE are significantly up-regulated in esophageal cancer, have high consistency with tissues, and apply Q-PCR for large sample verification. Therefore, the tRNA-GlyGCC-5 and sRESE provided by the invention have strict scientific basis and good scientific significance, the scientificity and universality of the application of the tRNA-GlyGCC-5 and sRESE as esophageal cancer markers and in a diagnostic kit are ensured, and the combination of the tRNA-GlyGCC-5 and sRESE as the markers improves the sensitivity and specificity of detection. In addition, the sRESE in the invention is a brand-new small non-coding RNA sequence, is discovered by the inventor for the first time, and has important significance for the research of esophageal cancer markers and disease progression mechanisms.

(2) The tumor diagnosis kit comprising the exosome small non-coding RNA molecular marker provided by the invention is a liquid diagnosis monitoring kit which has non-invasiveness, high sensitivity and high specificity and is suitable for census screening.

(3) By detecting the expression of the small non-coding RNA from the tumor-derived exosome, the kit and the system which can use biological samples such as body fluid and the like to diagnose the esophageal tumor and have high stability and accurate quantification are provided, and due to the characteristics of minimal invasion, easy detection and convenient repeated sampling, the kit and the system are favorable for reflecting the disease state of a patient with the esophageal cancer dynamically in real time and helping clinicians to rapidly master the illness state of the patient, thereby timely formulating more individualized treatment measures.

(4) The invention develops a tumor diagnosis kit, which can be used for diagnosing and predicting esophageal cancer by detecting the expression quantity of tRNA-GlyGCC-5 and sRESE in exosomes and individually or jointly using the molecular markers, has the characteristics of good stability, high repetition rate, simplicity in acquisition and better sensitivity and specificity than the prior art, and solves the problem that esophageal cancer lacks a definite diagnosis and prognosis marker.

(5) The prediction efficiency (sensitivity, specificity and AUC) of the molecular marker of the invention on esophageal cancer is higher than that of the existing molecular markers (HOTAIR marker, YKL-40+ SCCA marker, IL-8 marker and miR-155 marker).

(6) The invention takes saliva as a specimen, utilizes the characteristic that the saliva diagnosis effect is superior to that of blood and other body fluids, provides a liquid biopsy method based on exosomes, makes up the defects of the traditional biopsy, and compared with CTC and ctDNA used at present, the exosomes in the invention for detecting small non-coding RNA can better reflect the tumor condition. The small non-coding RNA is more stable than ctDNA, can reflect the internal biological information of tumor cells, is convenient to detect, can detect a plurality of markers by one-time sampling, can be quantitative, and is convenient to unify standards. In addition, the invention can effectively avoid the loss and degradation caused by directly detecting naked DNA and RNA by using the small non-coding RNA of the exosome.

Drawings

FIG. 1 shows the structure prediction of tRNA from tRNA-GlyGCC-5.

FIG. 2 is a graph showing the results of PCR verification of small non-coding RNAs in example 1; wherein, the sample number: 200 saliva samples from patients with esophageal cancer, 120 control samples from normal human saliva, a statistical difference p <0.001.

FIG. 3 is a graph showing the results of the expression levels of tRNA-GlyGCC-5 and sRESE in esophageal squamous cell carcinoma cell lines relative to normal human esophageal squamous epithelial cells in example 1.

FIG. 4 is a graph showing the results of correlation analysis of tRNA-GlyGCC-5 and sRESE with their corresponding salivary exosomes in tissues.

FIG. 5 is a graph of the results of analysis of the sensitivity and specificity of tRNA-GlyGCC-5 and sRESE in example 1 using a ROC curve as markers in combination with two small non-coding RNAs.

FIG. 6 is a graph showing the results of survival analysis of the combination of the small non-coding RNAs tRNA-GlyGCC-5 and sRESE in example 1.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the embodiments of the present invention are not limited thereto.

The reagents in the examples are commercially available unless otherwise specified.

Example 1: diagnosis of esophageal cancer patients by detecting the content of specific small non-coding RNA in saliva exosomes

1. Collection, storage and transport of saliva

(1) Collecting: at 8-10 a.m., subjects who satisfied the following conditions were collected whole saliva using non-irritant instillation in a quiet and comfortable environment: 1) Empty stomach, no strenuous exercise; 2) The subject is instructed to use about 20-60mL of gargle to remove food and other residues in the oral cavity, spit out residual liquid, slightly droop the head, sit still until saliva naturally flows out, collect non-irritant whole saliva in a collection dish, preferably to spread the saliva over a culture dish, about 250-900 mu L, and then quickly subpackage to a sterile storage tube.

(2) And (3) storage: the collected saliva can be stored for a long time at-80 ℃ after centrifugation in a storage tube.

(3) And (3) transportation: if the saliva is transported, the saliva can be placed in a transport box for transportation so as to ensure that subsequent experiments are protected from various microorganisms or enzymes in the saliva.

The inventor collects a large number of saliva samples for exosome detection of tumor patients and normal people in a plurality of domestic hospitals for years (all the saliva samples are collected, stored and transported according to the above standards), and carries out follow-up on all patients, wherein the follow-up is carried out once every three months, the survival state and the recurrence condition of the patients are recorded in detail, and complete case follow-up data is established.

2. Extraction, storage and transportation of saliva exosomes

(1) Extraction of saliva exosomes: taking 500 mu L of saliva (saliva without centrifugation) obtained in the step 1 in the same volume, centrifuging for 10min at 300g, transferring supernatant into a new centrifuge tube, centrifuging for 10min at 2000g, transferring supernatant into the new centrifuge tube, centrifuging for 20min at 5000g, transferring supernatant obtained by centrifugation into a new EP tube with 1.5mL by using a pipette, and obtaining about 450-470 mu L of clarified supernatant; adding the exosome precipitation reagent into the clarified supernatant according to the volume ratio of the exosome precipitation reagent =250 to 63, uniformly mixing, standing at 4 ℃, incubating overnight, centrifuging at 1500g and 4 ℃ for 30min, centrifuging at 3000g for 5min, then discarding the supernatant, collecting the precipitate, and resuspending the precipitate with an appropriate amount of 1 × exosome suspension to obtain an exosome suspension.

The corresponding amount of exosomes was analyzed according to Nanosight and the results are shown in the following table:

table 1:

sample size (μ L)	Sample source	The resulting exosome quantity (granules/mL)
			500	Saliva	1～10×10 ⁶

(2) Storage and transport of saliva exosomes

The obtained exosome can be stored for a long time in a storage tube at the temperature of minus 80 ℃ in a refrigerator, and RNA, DNA, protein and the like contained in the exosome can be stored stably.

3. RNA extraction in saliva exosomes

Adding 250-500 mu L of exosome RNA extracting solution into the exosome suspension obtained in the step 2, repeatedly blowing and beating, cracking at room temperature for 7-14 min, uniformly mixing, and adding corresponding miRNA exogenous cel-miR-39 for subsequent analysis and standardization. Adding 60 mu L of exosome RNA impurity removal liquid, fully mixing by vortex, standing for 4-14min at room temperature, centrifuging for 4-14 min at 10000-13000 g, transferring an upper water phase to another new tube, adding an isovolumetric exosome RNA precipitation liquid, standing for 4-14 min at room temperature after up-down reversing and mixing uniformly, or precipitating at-20 ℃, centrifuging for 4-14 min at 10000-13000 g, discarding supernatant, adding 250-500 mu L of exosome RNA cleaning solution precooled at-20 ℃, washing and precipitating, shaking and mixing uniformly, 12000g/5min, discarding ethanol liquid, standing in an ultra-clean bench, fully airing and precipitating. Dissolving the precipitate with exosome RNA enrichment solution, detecting purity and concentration with a NanoDorp2000 ultraviolet spectrophotometer, sealing the obtained RNA sealing film, and storing at-80 ℃.

The above reagent components are shown in table 2 below:

table 2:

name of reagent	Principal Components
		Exosome precipitating reagent	Polyethylene glycol 6000
Exosome suspensions	Phosphate buffered saline solution
		Exosome RNA extract	Phenol and rnase inhibitors
Exosome RNA impurity removal liquid	Chloroform
		Exosome RNA precipitation liquid	Isopropanol (I-propanol)
Exosome RNA washing solution	75% DEPC ethanol
		Exosome RNA enrichment solution	1 XPBS solution

The concentration of RNA in saliva exosomes was determined and analyzed using a NanoDorp2000 UV spectrophotometer as shown in the following table:

table 3:

the inventor extracts the total RNA in the collected saliva exosomes according to the steps, and sends a proper volume of RNA to perform high-throughput sequencing of the whole transcriptome according to the concentration of the total RNA, and the experiment relates to saliva of 10 esophageal cancer tumor patients and 10 normal volunteers in Guangdong province. The age, sex, and presence or absence of smoking factors between the two groups were strictly controlled. Whole transcriptome sequencing was performed by Beijing Nuo He Sourceology technologies, inc.

The results of the saliva exosome small non-coding RNA whole transcriptome sequencing screening are shown in Table 4 below, and tRNA-GlyGCC-5 and sRESE are more normally expressed in cancer.

Table 4:

small non-coding RNA names	p value	Log of fold change
			tRNA-GlyGCC-5	0.0015955	2.2931
sRESE	0.00032399	2.588

Structure prediction of tRNA-GlyGCC-5

tRNA-GlyGCC-5 was found to be a small RNA derived from tRNA-GlyGCC by BLAST functional alignment of NCBI website (https:// www.ncbi.nlm.nih.gov.). We predicted the secondary structure of tRNA-GlyGCC by tRNAdb database (http:// trna.bioin.uni-leipzing.de/DataOutput/Search) and input the secondary structure information into Vienna RNA Web Services website (http:// rna.tbi.uni. Ac.at/forna /), which was visualized as shown in FIG. 1), tRNA-GlyGCC-5 was derived from the 5' end of tRNA-GlyGCC.

5. Reverse transcription of small non-coding RNA in salivary exosomes

Small non-coding RNAs were reverse transcribed into cDNA using tailing method using a commercially mature kit: all-in-One of Guangzhou pluripotent Gene Co., ltd ^TM The miRNA qRT-PCR Detection (QP 015, QP 016) is carried out according to the instructions, and the specific steps are as follows:

table 5:

composition (A)	Dosage form
		5 x miRNA reverse transcription buffer solution	5μL
miRNA RTase mixed liquor	1μL
		miRNA polyA polymerase	1μL
Total RNA	1ng-5μg
		DEPC water	Make up to 25. Mu.L

The components in Table 5 were mixed well, centrifuged in a PCR instrument at 37 ℃ for 1h and 85 ℃ for 5min, and the resulting cDNA was stored in a-80 ℃ freezer for further use.

Q-PCR validation of tRNA-GlyGCC-5 and sRESE for diagnosis of esophageal cancer

Detecting cDNA obtained by reverse transcription of small non-coding RNA by using SYBR GREEN method or probe method, and adopting a kit mature on the market: all-in-One of Guangzhou pluripotent Gene Co., ltd ^TM miRNA qRT-PCR Detection (QP 015, QP 016), according to the instruction operation, make 20 uL Real Time PCR reaction system according to the following proportion:

table 6:

component (A)	Dosage form
		2 × SYBR GREEN buffer	10μL
miRNA SYBR GREEN universal reverse primer	2μL
		miRNA SYBR GREEN forward primer	2μL
cDNA template	2μL
		ROX reagent	0.1μL
ddH ₂ O	3.9μL

Real-time fluorescent quantitative PCR detection was performed using a Bio-rad Brillo CFX Connect fluorescent quantitative PCR instrument, and relative quantification was performed by the 2-Delta CT method.

The reaction conditions of the real-time fluorescent quantitative PCR detection are as follows: a pre-denaturation stage: 10min at 95 ℃; and (3) an amplification cycle stage: 10s at 95 ℃,20 s at 60 ℃,10 s at 72 ℃ and 40 cycles.

The primers used were:

tRNA-GlyGCC-5

a forward primer: GTGGTTCAGTGGTAGAATTTA

Reverse primer: a universal reverse primer;

sRESE

a forward primer: CTGAGTTCCTGTTTTTTCTTCTGA

Reverse primer: a universal reverse primer.

7. Test of

The inventor selects 200 cases of saliva of esophageal cancer patients and 120 cases of normal human saliva (all volunteers sign an informed consent) in Guangdong province, and performs PCR verification and relative quantification by a 2-delta CT method on the screened small non-coding RNA according to the method.

As shown in FIG. 2, the expression of tRNA-GlyGCC-5 and sRESE in salivary exosomes of esophageal cancer patients was significantly higher than that of normal persons.

the results of expression levels of tRNA-GlyGCC-5 and sRESE in human Esophageal squamous Carcinoma cells HKESC-1, KYSE140, KYSE510, TE1 (all available from ATCC) versus normal human Esophageal squamous epithelial cells NE2 (disclosed in Lin Y et al, evaluation of Salivary external chiral GOLM1-NAA35 RNA as a positional Biomarker in Esophageal Carcinoma, clinical Cancer Research,2019,25 (10): 3035-3045), NE3 (disclosed in Wang L et al, for example human Esophageal Cancer cell transfection by targeting the miR-497/PELP1 a. Cancer Letters,2019, 450) are shown in FIG. 3.

As can be seen in FIG. 3, the expression of tRNA-GlyGCC-5 and sRESE in esophageal squamous cell carcinoma cell lines is greatly different from that of normal human esophageal squamous cell cells, and the expression of tRNA-GlyGCC-5 and sRESE in esophageal cancer cell lines is high, which indicates that the tRNA-GlyGCC-5 and sRESE may play a role in the occurrence and development of esophageal cancer cell lines.

The results of the correlation analysis between tRNA-GlyGCC-5 and sRESE and their corresponding salivary exosomes in the tumor tissues of patients with esophageal squamous cell carcinoma are shown in FIG. 4.

As can be seen from FIG. 4, the tRNA-GlyGCC-5 and sRESE of the saliva exosomes have better consistency with tumor tissues and can reflect the expression level of the tissues.

ROC curve analysis shows that when two small non-coding RNAs are used as markers to distinguish esophageal cancer patients from normal people individually and jointly, the expression levels of tRNA-GlyGCC-5 and sRESE in saliva of 200 esophageal cancer patients and 120 normal people in Guangdong province have the following effects:

tRNA-GlyGCC-5: AUC of 0.878, diagnostic sensitivity of 75.50%, specificity of 92.50%;

sRESE: AUC was 0.871, diagnostic sensitivity was 74.50%, specificity was 90.83%;

the two are combined: AUC was 0.933, diagnostic sensitivity was 90.50%, specificity was 94.20% (as shown in figure 5). (Note: in the case of the combination, it is necessary to detect the expression level of each small non-coding RNA, and then to perform regression according to the logistic regression formula

Combined expression =111.01 × (tRNA-GlyGCC-5 expression) +27.198 × (sRESO expression) -4.029

Calculating a joint expression value, and performing ROC curve analysis by using the joint expression value

Therefore, the small non-coding RNA in the screened exosome can better diagnose the esophageal cancer.

In addition, SPSS 19.0 software is used, expression values of two small non-coding RNAs, namely tRNA-GlyGCC-5 and sRESE, are combined through binary logistic regression to obtain a risk score, median of the risk score is used as a dividing point to divide patients into a high risk group and a low risk group, and the Kaplan-Meier method is used for carrying out survival analysis on the patients in the high risk group and the low risk group, wherein the result is shown in figure 6.

As can be seen in FIG. 6, the combination of tRNA-GlyGCC-5 and sRESE, two small non-coding RNAs, was effective in predicting the prognosis of patients with esophageal cancer.

Furthermore, we compared the diagnostic efficiency of the markers of the invention (tRNA-GlyGCC-5 and sRESE in combination as markers) for esophageal cancer with known markers, as shown in Table 7.

Table 7:

HOTAIR markers have been disclosed in Wang W et al, serum HOTAIR as a novel diagnostic biomarker for esophageal gastric cell cancer. Mol cancer.2017.DOI:10.1186/s 12943-017-0643-6;

the marker YKL-40+ SCCA has been disclosed in Zheng X et al.instability of using serum YKL-40 and SCCA in combination for the diagnosis of the patients with esophageal cell cancer. BMC cancer.2014. DOI;

IL-8 markers have been described in Huang Z et al, serum interleukin-8 as a potential diagnostic biomarker in esophageal plasmid cell carcinosma, cancer biomark.2020.DOI: 10.3233/CBM-201687;

miR-155 markers have been described in Zheng Y et al MicroRNA-155 acts as a diagnostic and diagnostic biomarker for oenophagal squamous cell Carcinoma, arthritis Cells Nanomed Biotechnol.2020.DOI: 10.1080/21691401.2020.1773479;

as can be seen from table 7: the small non-coding RNA molecular marker of the exosome (tRNA-GlyGCC-5 and sRESE are combined to be used as the marker) has better diagnosis efficiency on esophageal cancer than other known markers.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such modifications are intended to be included in the scope of the present invention.

Sequence listing

<110> river-south university

<120> small non-coding RNA molecular marker of exosome and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> tRNA-GlyGCC-5 nucleotide sequence

<400> 1

gcatgggtgg ttcagtggta gaattt 26

<210> 2

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> nucleotide sequence of sRESE

<400> 2

gcatgatctg agttcctgtt tcttctg 27

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> tRNA-GlyGCC-5 forward primer

<400> 3

gtggttcagt ggtagaattt a 21

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> SRESE Forward primer

<400> 4

ctgagttcct gtttcttctg a 21

Claims

1. An exosome small non-coding RNA molecular marker, wherein the marker is at least one of tRNA-GlyGCC-5 and sRESE;

the nucleotide sequence of the tRNA-GlyGCC-5 is shown as SEQ ID NO. 1;

the nucleotide sequence of sRESE is shown in SEQ ID NO. 2.

2. The exosome small non-coding RNA molecular marker according to claim 1, characterized in that said exosome is a saliva exosome.

3. Use of the exosome small non-coding RNA molecule marker of any one of claims 1-2 in the preparation of a tumor diagnostic product.

4. Use according to claim 3,

the tumor is malignant tumor.

5. The use according to claim 4,

the malignant tumor is esophageal cancer.

6. The use according to claim 5,

the esophageal cancer comprises esophageal squamous carcinoma.

7. Use according to claim 3,

the tumor diagnosis product comprises a tumor diagnosis kit.

8. A tumor diagnostic kit comprising the exosome small non-coding RNA molecular marker of any one of claims 1 to 2.

9. The tumor diagnosis kit according to claim 8, wherein the tumor diagnosis kit further comprises an exosome RNA extraction component, an exosome small non-coding RNA reverse transcription component and an exosome real-time quantification component;

the exosome RNA extraction component comprises an exosome RNA extraction solution, an exosome RNA impurity removal solution, an exosome RNA precipitation solution, an exosome RNA cleaning solution and an exosome RNA enrichment solution;

the small non-coding RNA reverse transcription component of the exosome comprises 5 xmiRNA reverse transcription buffer solution, miRNA RTase mixed liquor, miRNA polyA polymerase, DEPC water and total RNA.

10. The tumor diagnostic kit according to claim 8, further comprising primers for amplifying the exosome small non-coding RNA molecular marker of any one of claims 1 to 2;

the primers used for tRNA-GlyGCC-5 are:

a forward primer: gtggttcagtgggtagaattta;

reverse primer: a universal reverse primer;

the primers used for sRESE were:

a forward primer: CTGAGTTCCTGTTTTTTCTTCTGA;

reverse primer: a universal reverse primer.