CN110699265B - Method for preparing wolfberry leaf tea by fermentation of eurotium cristatum and special strain - Google Patents

Abstract

The invention discloses a method for preparing wolfberry leaf tea by fermenting eurotium cristatum. The applicant firstly obtains a eurotium cristatum NCPS2018015 with high growth speed and strong fermentation capacity from fermented tea after screening and optimizing series conditions, the strain is preserved in China center for type culture collection (CCTCC NO: M2018882) 12 months and 12 days in 2018. The wolfberry leaves fermented by the strain can be prepared into tea for daily drinking by combining with specific process conditions, the tea is emerald green and golden yellow, is very attractive, the tea liquor color is yellow brown, the tea flavor is strong, no green taste exists, the tea is slightly bitter and has no astringent taste and sweet aftertaste, and the problems of dark appearance and color, green taste, poor tea liquor flavor, astringent taste and easy stimulation to the stomach of the traditional wolfberry leaf tea are solved.

Description

Method for preparing wolfberry leaf tea by fermentation of eurotium cristatum and special strain

Technical Field

The invention belongs to the technical field of tea making by fermentation, and particularly relates to a method for making wolfberry leaf tea by fermentation of eurotium cristatum and a special strain.

Background

Eurotium cristatum (Eurotium cristatum) is commonly called as golden flower fungus, belongs to a fungus of Eurotium of Tricholomataceae of Eurotiales, commonly grows on black brick tea, and belongs to probiotics. Scientific research shows that eurotium cristatum can secrete amylase and oxidase, can catalyze the starch in tea to be converted into monosaccharide, oxidize polyphenol compounds, change tea liquor color into brownish red, and eliminate coarse green taste. The tea is more mellow and refreshing in taste, sweet, smooth and sweet. It also has effects of promoting digestion, reducing blood lipid, dissolving fat, and regulating carbohydrate metabolism.

The Chinese wolfberry bud is also called Chinese wolfberry head, Chinese wolfberry bud and beet head, i.e. young tip and young leaf of Chinese wolfberry, and the Chinese wolfberry leaf is mature stem and leaf of Chinese wolfberry. Medlar buds and medlar leaves have slight bitter taste, slight sweet aftertaste and good taste, can clear fire and improve eyesight, and are frequently used for treating yin deficiency internal heat, dry throat and sore throat, liver fire rising, dizziness, blurred vision, low fever and the like in folk. Recorded in the dietetic herbal records that the medlar buds and medlar leaves have the functions of strengthening tendons, resisting aging, removing wind, tonifying bones and muscles, removing consumptive disease and the like. The folium Lycii can be used for soaking fructus Lycii tea for drinking, and has effects of promoting blood circulation, preventing arteriosclerosis, and preventing accumulation of fat in liver; lowering blood pressure, enhancing immunity, lowering blood sugar, loosening bowel to relieve constipation, promoting fluid production and nourishing liver, and various vitamins, essential amino acids and linoleic acid contained in the product can promote metabolism in vivo and prevent aging. Because the medlar buds and medlar leaves have good health care function, the medlar buds and medlar leaves are eaten from old to present. Modern people generally use medlar buds and medlar leaves as vegetables, and can also make the medlar buds and medlar leaves into tea to meet the requirements of people who love drinking tea.

The common preparation method of the medlar bud tea and the medlar leaf tea comprises the steps of withering, rolling, drying and the like the picked fresh medlar buds and medlar leaves, controlling the parameters of temperature, time and the like of each stage, and determining when the tea is processed according to the water loss degree, color, smell and the like of the medlar buds and medlar leaves. However, the Chinese wolfberry bud tea and the leaf tea on the market at present are tea which is not fermented, so that natural substances in the tea are more reserved, and the Chinese wolfberry bud tea and the leaf tea have the effects of diminishing inflammation, sterilizing, resisting aging and the like; however, the tea polyphenol content is much higher than that of fermented tea, and the astringency is stronger than that of the fermented tea. Compared with fermented tea, the product has certain irritation, and is easy to irritate stomach. The patent application No. 201910194942.0 discloses a method for preparing folium Lycii tea, which comprises picking, cleaning, withering, parching to deactivate enzymes, rolling, parching to dry, shaping, drying, extracting fragrance, and packaging to obtain final product. The patent application of application No. 201810617019.9 discloses a wolfberry bud tea and leaf tea processing technology, which comprises a withering process, a rolling process, a fermentation process and a drying process which are sequentially carried out on wolfberry buds and wolfberry leaves, wherein the fermentation process is increased and is naturally fermented for 6-8 h, so that the tea polyphenol content of the wolfberry bud tea and the leaf tea is reduced, the irritation is reduced, and the wolfberry bud tea and leaf tea processing technology has good effects of nourishing and protecting the stomach. The fermentation process is simple (natural fermentation for several hours), and aims to reduce the content of tea polyphenols in the Chinese wolfberry bud tea and leaf tea and reduce the irritation to stomach. However, the above patent documents still adopt the traditional processes to prepare the lycium barbarum leaf tea, which has dark color and luster, more or less green taste, bad tea soup flavor, astringent taste, and much chlorophyll and other functional substances loss.

Disclosure of Invention

Aiming at the problems of dark appearance and color, green flavor, poor tea soup flavor, astringent taste, easy stimulation to the stomach and the like of the traditional Chinese wolfberry leaf tea, the invention provides a method for preparing the Chinese wolfberry leaf tea by fermenting eurotium cristatum and a special strain thereof. The applicant firstly obtains a eurotium cristatum strain NCPS2018015 with high growth speed and strong fermentation capacity from fermented tea after screening and optimizing a series of conditions. The medlar leaves fermented by the strain can be prepared into tea for daily drinking by combining with specific process conditions, chlorophyll and other functional substances in the medlar leaves can be kept to the maximum extent, the prepared tea has bright appearance and color, emerald green and golden yellow are crossed, the grass flavor and astringent flavor which are easily existing in the medlar leaf tea can be removed, and the content of tea polyphenol is properly reduced. And after fermentation, the functional components are more easily dissolved out after being soaked in boiled water, so that the effects of easier absorption of various components in the boxthorn leaves and better health care effect are realized.

The invention firstly obtains a eurotium cristatum strain NCPS2018015 with high growth speed and strong fermentation capacity from fermented tea after screening and optimizing a series of conditions. The strain is preserved in China center for type culture Collection (CCTCC for short, the address: China, Wuhan university) in 12 months and 12 days in 2018, and the preservation number is CCTCC NO: M2018882.

The invention also provides a method for preparing the wolfberry leaf tea by fermenting eurotium cristatum, which is characterized by sequentially processing and preparing the wolfberry leaf tea by the following process steps: picking, cleaning, blanching, rolling, fermenting and drying;

the method comprises the following specific steps:

1) picking: selecting fresh tender stems and leaves of fructus Lycii with green color, rich fat and no disease and pest damage and deterioration;

2) cleaning: cleaning with clear water, draining, and spreading and drying until the leaves are withered and soft;

3) blanching: boiling in hot water at 90-100 ℃, immediately putting into cold water for soaking and cooling after blanching; drying at low temperature directly after blanching;

4) rolling: putting the dried raw materials on a rolling plate, rolling for 3-5 min, after pectin decomposers form a tight strip shape, putting the strip into a pot at 70 +/-5 ℃ for quickly stir-frying, baking until the hand-rolled leaves are finely crushed into powder and the water content is lower than 6%, and taking out of the pot for spreading and cooling;

5) fermentation: putting the rolled and baked boxthorn leaves in the step 4) into a high temperature resistant culture bag, adding 20-25ml of 5 +/-1% glucose solution and 20-25ml of malt wort into every 100 g of rolled and baked boxthorn leaves, and sterilizing to obtain a culture material; then inoculating 8-12ml of eurotium cristatum NCPS2018015 seed liquid into the culture material according to the proportion of inoculating every 100 g of the rolled and baked boxthorn leaves into the culture material; culturing the inoculated culture bag at 28-30 deg.C for 12-14 days;

6) and (3) drying: and after the culture is finished, drying until the moisture content is 8-12%, and bagging the wolfberry leaf tea or pressing the wolfberry leaf tea into brick type, cake type or lump type according to the needs to obtain the finished wolfberry leaf tea.

Further, the seed liquid is prepared by the following steps: shaking and culturing the Eurotium cristatum NCPS2018015 strain for 60-84h by adopting a wort liquid culture medium at 28-30 ℃ in a shaking table to obtain a seed liquid.

Further, the blanching in the step 3) is as follows: boiling in hot water at 90-100 ℃ for 60-100 s. Immediately soaking in cold water for cooling after blanching, and ensuring that each bud and leaf is cooled to below 30 ℃.

Further, the step 3) of low-temperature baking is carried out, wherein the baking temperature is 60-70 ℃, and the baking is carried out until the moisture content is 60 +/-5%.

The invention has the advantages that:

1) development of dominant strains

The applicant firstly obtains an eurotium cristatum strain NCPS2018015 from fermented tea after screening and series condition optimization. Compared with other strains, the strain has the advantages of high growth speed and strong fermentation capacity, and the lycium barbarum leaf tea fermented by the strain has the advantages of short fermentation time and high thallus content.

2) The invention adopts eurotium cristatum to ferment and prepare the Chinese wolfberry leaf tea for the first time

At present, reports of manufacturing the wolfberry leaf tea by fermenting eurotium cristatum are not found, the wolfberry leaf tea manufactured by fermenting eurotium cristatum for the first time is manufactured by fermenting the eurotium cristatum, the specific conditions of the process are combined, the fermentation time is short and is only 10-14 days, and the spore yield is high (the spore content can reach 10)⁷-10⁸) The golden flower fungus can produce amylase, protease, lipase and the like, the enzymes can be beneficial to reducing the accumulation of fat in human bodies, the tea soup can maintain the blood fat balance of organisms and can be beneficial to treating obesity and hyperlipidemia, and the fermented boxthorn leaves can also retain the original functional substances of the boxthorn leaves to the maximum extent.

3) The product is good

The wolfberry leaf tea prepared by fermenting eurotium cristatum NCPS2018015 is very attractive due to emerald green and golden yellow intersection of tea leaves, is yellow brown in tea liquor color, strong in tea fragrance, free of green taste, slightly bitter and astringent in taste and sweet after taste, and well overcomes the defect that the wolfberry leaves are drunk as tea substitutes. Meanwhile, the prepared wolfberry leaf tea contains a large amount of eurotium cristatum thalli, so that the treatment of obesity and hyperlipidemia is facilitated.

Drawings

FIG. 1 is a colony morphology map of the strain NCPS2018015 of the present invention; wherein, the A picture is a colony morphology picture cultured for 4-5 days, and the B picture is a colony morphology picture cultured for 10-11 days;

FIG. 2 is a microscopic image of a colony of the invention strain NCPS2018015 stained with cotton blue; panel A and B are the pictures of colonies cultured for 4-5 days; panel C and D are photographs of ascocarp cultured for 6 days and 7 days, respectively;

FIG. 3 is a picture of a wolfberry leaf tea prepared by fermenting the strain NCPS2018015 of the present invention before (left) and after (right) drying;

FIG. 4 is a picture of a strain 072 fermented wolfberry leaf tea before (left) and after (right) drying;

FIG. 5 is a picture of the Chinese wolfberry leaf tea prepared by fermenting the strain 055 before (left) and after (right) drying;

fig. 6 is a picture of wolfberry leaf tea prepared by fermenting strain 100 before (left) and after (right) drying.

Detailed Description

Example 1: isolation and identification of target strains

1. Isolation of the Strain

Respectively taking Shaanxi Jingyang Fuzhuan tea and Hunan Anhua dark tea, adding into sterile water, shaking for 2hr, diluting in series, and taking dilution degree of 10⁴、10⁵Coating a wort solid plate (containing 0.01 percent of chloramphenicol) with the suspension, culturing the plate at 28-30 ℃ for 4-5 days, selecting a single colony with better growth vigor to a wort slant culture medium according to the appearance of the colony, culturing for 6-7 days, then performing serial dilution and purification again, and culturing the single colony slant for later use.

Detecting the growth activity of a single colony: the malt wort liquid culture medium is filled into 500mL triangular flasks, each flask is filled with 250mL, and the flasks are sterilized at 121 ℃ for later use. The slant digging block is connected to the liquid culture medium, the liquid culture medium is cultured for 72 hours at 28 ℃ and 180rpm by shaking of a shaking table, the growth vigor is observed in the culture process, thalli are collected centrifugally after the culture is finished, the dry weight of the thalli is measured after drying, 10 strains with the highest thalli are selected to inoculate the dark green tea, the dark green tea is fermented according to the traditional dark green tea fermentation process, the content of eurotium cristatum (eurotium cristatum) in the final fermented product is measured, and the result is as follows.

TABLE 1 Thelephora chrysantha content produced by different strains fermenting dark tea

As can be seen from the results of table 1: the number of golden flower bacteria (eurotium cristatum) generated by fermenting the black tea by the strain 015 is the highest, and multiple repeated experiments show that the strain has good stability, so that the strain 015 is selected as a final strain to carry out strain identification and is named as NCPS 2018015.

2. Identification of strains

1) And (3) observing colony morphology: the isolated strain was inoculated into 20% CZG plate medium, cultured in an incubator at 28 ℃, and the color, morphology, size and texture changes of the strain growth were observed and recorded. The results are shown in FIG. 1. As can be seen from fig. 1: culturing at 28 deg.C for 4-5 days to obtain bacterial colony with diameter of 25-30 mm; the colony is in a regular round shape, has a compact texture, has a regular halo in the interior, has light yellow edge, is close to olive light yellow, is gradually deepened from the edge to the middle, is close to olive brown to clove brown, is attached with large decorative hypha, and becomes brown after aging; culturing for 10-11 days until the diameter of colony can reach 60mm, and the whole colony color is changed into olive color to clove brown color. At the early stage, yellow halos were clearly visible on the back of colonies, and after the age, they appeared dark brown and diffused over a large area throughout the medium.

2) And (3) microscopic observation: at the edges of the colonies that have been grown, sterile coverslips are inserted obliquely at a 45 ° angle into the medium. Culturing for 4-5 days, taking out the cover glass carefully with tweezers when the hypha extends to the cover glass, covering on the glass slide with cotton blue staining agent to avoid bubble generation, standing for 10 min, and observing, the result is shown in FIG. 2.

As can be seen from Panel A of FIG. 2, the colonies consisted of spherical or nearly spherical ascocarp having a diameter of about 150-200 μm, yellow (pale blue due to cotton blue staining) and hyphae, and contained therein a number of spherical or nearly spherical ascomycetes having a diameter of about 5 μm. As can be seen from the A and B pictures, the color of the sample under a microscope is largely yellow, and the sample has hyphae decoration, transverse partition walls, asymmetric branches, diaphragms and sclerotium. As seen in panels C and D, after 6-7 days of culture, the ascocarp began to burst, gradually releasing the ascomycetes.

Through observing colony morphological characteristics and microscopic structural characteristics such as hypha, spores and the like, the NCPS2018015 fungus can be preliminarily identified as the sporangium fungus according to a fungus identification manual and a Chinese fungoid book, but the species is difficult to identify only through morphological characteristics, and further identification needs to be carried out by combining a molecular biology means.

3) The strain ITS sequence identification result is as follows:

the ITS sequence determination of NCPS2018015 resulted in the following (SEQ-1):

CCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCTGGGTCCAACCTCCCATCCGTGTCTATCTGTACCCTGTTGCTTCGGCGTGGCCACGGCCCGCCGGAGACTAACATTTGAACGCTGTCTGAAGTTTGCAGTCTGAGTTTTTAGTTAAACAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTTCCGTCCCTGGCAACGGGGACGGGCCCAAAAGGCAGTGGCGGCACCATGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCCCGTAGGTCCAGCTGGCAGCTAGCCTCGCAACCAATCTTTTTAACCAGGTGACCTCGGATCAGTACGATCCACTCT。

and (3) searching a sequence similar to the DNA sequence of the test strain by using a local similar query system of the DNA sequence of GenBank, and comparing and analyzing. BLAST alignment showed that there was 99% homology of the DNA sequence of the ITS segment of Eurotium Cristatum (MF) numbered MF993117.1 with the test strain in the database (499/500). The score value compared to the two was 917bits and the E value was 0.0.

Therefore, according to colony morphology characteristics, observation of microscopic structure characteristics such as hyphae and spores and the determination result of an ITS sequence in molecular biology, the strain NCPS2018015 can be judged to be Eurotium cristatum. The strain is preserved in China center for type culture Collection (CCTCC for short, the address: China, Wuhan university) in 12 months and 12 days in 2018, and the preservation number is CCTCC NO: M2018882.

3. Compared with other eurotium cristatum

The product performance comparison of the black tea fermented by the Fuzhuan tea separating strain, the black tea fermented by the strain NCPS2018015 of the invention and the finished Fuzhuan brick (produced in Shanxi Jingyang) is shown in Table 2.

TABLE 2 Properties of different teas

As can be seen from table 2: compared with the black tea fermented by the Fuzhuan tea isolated strain and a finished product Fuzhuan brick (produced by Shaanxi Jingyang), the black tea fermented by the Eurotium cristatum strain NCPS2018015 has better product effect.

Example 2: fermentation preparation of Chinese wolfberry leaf tea

1) Picking: selecting fresh tender stem and leaf of fructus Lycii with green color, rich fat and no disease and pest damage and deterioration.

2) Cleaning: cleaning selected Lycii folium with clear water, mainly removing dust and other dirt on folium surface, draining, spreading and drying in the air at dry place or blowing with fan, and turning over for 1-2 times during spreading and drying till folium withering and softening, and water loss rate is 5-10%.

3) Blanching: the wolfberry leaves are boiled in hot water at the temperature of 90-100 ℃ for 60-100 s, the wolfberry leaves are still tender green, the active ingredients are hardly lost, and the attractive tea color can be kept. Immediately soaking in cold water for cooling after blanching, and ensuring that each bud and leaf is cooled to below 30 ℃.

The tea soup prepared by the step has poor fragrance, green taste can be remained, the tea soup has astringent taste, and the defect can be completely improved by a subsequent fermentation process. Baking until the leaves are soft, and the leaves are held into a ball, the hands are loose and not scattered, and the water content is 60 +/-5%.

4) Rolling: putting the baked raw materials on a rolling plate, uniformly rolling with force for 3 times in each pot, generally rolling for 3-5 min, after the pectin decomposer forms a tight strip rope shape, putting the strip rope into a pot at 70 +/-5 ℃ for quickly stir-frying, baking until the hand-twisted leaves are finely crushed into powder, and the water content is lower than 6%, taking out of the pot and spreading and cooling.

5) Fermentation of

Slant culture: the slant culture medium is malt wort agar culture medium, and is cultured at 28-30 deg.C for 7 days; wort agar medium: 150mL of wort, 3g of agar, pH6.4 + -0.2, high-temperature sterilization and plate pouring.

The seed liquid is prepared by the following steps: respectively filling the malt wort liquid culture medium into 500mL triangular flasks, filling 250mL of malt wort liquid culture medium into each flask, sterilizing at 121 ℃ for 30min, and cooling and taking out for later use; the slant is picked and inoculated in seed liquid culture medium (wort liquid culture medium), shaking cultured at 28 deg.C and 180rpm for 72hr to obtain seed liquid. Wort liquid medium (per liter): 0.1g of chloramphenicol, 130g of malt extract powder and pH of 5.6 +/-0.2.

Fermentation: putting the rolled and baked raw materials into a high-temperature resistant culture bag, adding 20-25ml of 5% glucose solution and 20-25ml of wort into every 100 g of rolled and baked boxthorn leaves, sterilizing at 121 ℃ for 30 minutes, cooling to normal temperature, and inoculating 10ml of seed solution into every 100 g of rolled and baked boxthorn leaves into the culture bag. Culturing the inoculated culture bag in a constant temperature chamber at 28-30 deg.C for 12-14 days without controlling humidity, and the content of spore of eurotium cristatum (Eurotium cristatum) in the final cultured folium Lycii tea can reach 10⁷-10⁸。

6) And (3) drying: after the culture is finished, drying until the moisture content is 8-12%, bagging the wolfberry leaf tea or pressing the wolfberry leaf tea into brick type, cake type or lump type according to the needs to obtain the finished wolfberry leaf tea, as shown in fig. 6, brewing and tasting the wolfberry leaf tea, and making sensory evaluation as shown in table 3.

Comparative example: the wolfberry leaf tea is prepared by fermenting the wolfberry leaves by adopting the strains 072, 055 and 100 with higher yield of eurotium cristatum (eurotium cristatum) in the table 1 (except for different strains, the rest is the same as the example 2), the fermentation effect graphs of the wolfberry leaf tea are sequentially shown in the figures 4-6, the wolfberry leaf tea prepared by fermenting the wolfberry leaves by the strains 072, 055 and 100 is brewed and tasted, and the sensory evaluation is made as shown in the table 3.

TABLE 3 sensory evaluation of brewing taste of different eurotium cristatum fermented lycium barbarum leaves tea

And (4) analyzing results: as shown in fig. 3-6, it can be seen from the appearance that the lycium barbarum leaf tea prepared by fermenting the strain of the invention is bright in color, and the color and quantity of the emitted golden flower are golden yellow and large (fig. 3); the wolfberry leaf tea fermented by common golden flower fungus (strains 072, 055 and 100) is dark in color and obviously less in fungus quantity (fig. 4-6). As can be seen from the appearance and sensory evaluation of Table 3, the Chinese wolfberry leaf tea fermented by the strain NCPS2018015 has the advantages of very large golden flower fungus amount, bright color, strong tea fragrance, slightly bitter taste, sweet aftertaste and good mouthfeel, while the Chinese wolfberry leaf tea fermented by the common golden flower fungus (strains 072, 055 and 100) has dark color, heavy bitter taste and poor mouthfeel.

SEQUENCE LISTING

<110> institute of agricultural products of academy of agricultural sciences of Shandong province

<120> method for preparing wolfberry leaf tea by fermenting eurotium cristatum and special strain

<130> 0

<160> 1

<170> PatentIn version 3.3

<210> 1

<211> 511

<212> DNA

<213> ITS sequence of Eurotium cristatum strain NCPS2018015

<400> 1

cctgcggaag gatcattacc gagtgcgggc cctctgggtc caacctccca tccgtgtcta 60

tctgtaccct gttgcttcgg cgtggccacg gcccgccgga gactaacatt tgaacgctgt 120

ctgaagtttg cagtctgagt ttttagttaa acaatcgtta aaactttcaa caacggatct 180

cttggttccg gcatcgatga agaacgcagc gaaatgcgat aattaatgtg aattgcagaa 240

ttcagtgaat catcgagtct ttgaacgcac attgcgcccc ctggtattcc ggggggcatg 300

cctgtccgag cgtcattgct gccctcaagc acggcttgtg tgttgggctt ccgtccctgg 360

caacggggac gggcccaaaa ggcagtggcg gcaccatgtc tggtcctcga gcgtatgggg 420

ctttgtcacc cgctcccgta ggtccagctg gcagctagcc tcgcaaccaa tctttttaac 480

caggtgacct cggatcagta cgatccactc t 511

Claims (8)

1. A strain for fermenting the Chinese wolfberry leaf tea is an eurotium cristatum strain NCPS2018015, and the preservation number is CCTCC NO: M2018882.

2. Use of the strain of claim 1 for fermenting black tea and wolfberry leaf tea.

3. A method for preparing wolfberry leaf tea by fermenting Eurotium cristatum is characterized in that Lycium barbarum leaves are used as raw materials, and the wolfberry leaf tea is obtained by adopting the Eurotium cristatum strain NCPS2018015 of claim 1 for fermentation after picking, cleaning, blanching and rolling.

4. The method for preparing the lycium barbarum leaf tea through eurotium cristatum fermentation as claimed in claim 3, is characterized by comprising the following steps of:

1) picking: picking fresh tender stems and leaves of the Chinese wolfberry;

2) cleaning: cleaning with clear water, draining, and spreading and drying until the leaves are withered and soft;

3) blanching: boiling in hot water at 90-100 ℃, immediately putting into cold water for soaking and cooling after blanching; drying at low temperature directly after blanching;

4) rolling: putting the dried raw materials on a kneading plate, kneading for 3-5 min, then putting the raw materials into a pot at 70 +/-5 ℃, quickly stir-frying, baking until the hand-twisted leaves are finely crushed into powder and the water content is lower than 6%, and then spreading out the powder out of the pot and cooling;

5) fermentation: putting the rolled and baked boxthorn leaves in the step 4) into a high temperature resistant culture bag, adding 20-25ml of 5 +/-1% glucose solution and 20-25ml of malt wort into every 100 g of rolled and baked boxthorn leaves, and sterilizing to obtain culture materials; then inoculating 8-12ml of eurotium cristatum NCPS2018015 seed liquid into the culture material according to the proportion of inoculating every 100 g of rolled and baked boxthorn leaves into the seed liquid; culturing the inoculated culture material at 28-30 deg.C for 12-14 days;

6) and (3) drying: and after the culture is finished, drying until the moisture content is 8-12%, and bagging the wolfberry leaf tea or pressing the wolfberry leaf tea into a brick type, a cake type or a lump type according to the needs to obtain the finished wolfberry leaf tea.

5. The method for preparing the lycium barbarum leaf tea through eurotium cristatum fermentation as claimed in claim 4, wherein the preparation method of the eurotium cristatum NCPS2018015 seed liquid comprises the following steps: shaking and culturing the Eurotium cristatum NCPS2018015 strain for 60-84h by adopting a wort liquid culture medium at 28-30 ℃ in a shaking table to obtain a seed liquid.

6. The method for preparing the lycium barbarum leaf tea through eurotium cristatum fermentation as claimed in claim 4, wherein the picking in the step 1) is as follows: selecting fresh tender stem and leaf of fructus Lycii with green color, rich fat and no disease and pest damage and deterioration.

7. The method for preparing the lycium barbarum leaf tea through eurotium cristatum fermentation according to claim 4, wherein the blanching in step 3) is as follows: blanching in hot water at 90-100 ℃ for 60-100 s, immediately soaking in cold water for cooling after blanching, and ensuring that each wolfberry leaf is cooled to below 30 ℃.

8. A process for preparing tea from Lycium barbarum leaf by fermentation of Eurotium cristatum as claimed in any one of claims 4 to 7, wherein the baking in step 3) is carried out at a temperature of 60 to 70 ℃ until the water content is 60 + -5%.

Images