CN110669117B - Volvariella volvacea ethylene receptor protein - Google Patents

Abstract

The application belongs to the technical field of straw mushroom genomes, and particularly relates to straw mushroom ethylene receptor protein. The protein is named as VvEBD, and the full length of the base sequence is 2211 bp, which is shown in SEQ ID NO. 1. The ethylene receptor protein binds ethylene, thereby regulating the maturation process of plants. The inventor obtains the protein coding gene by cloning, transforms the gene by using a eukaryotic yeast expression system, and experimentally verifies the binding capacity of the protein and ethylene. The results prove that the yeast cells transformed with the transmembrane domain of the receptor protein can bind ethylene, namely, the protein is really an ethylene receptor in straw mushroom. Based on the discovery and the proof, a certain technical basis can be laid for the cultivation of new species of straw mushrooms and the preservation of straw mushrooms by over-expressing or silencing the coding gene of the protein.

Description

Volvariella volvacea ethylene receptor protein

Technical Field

The application belongs to the technical field of straw mushroom genomes, and particularly relates to straw mushroom ethylene receptor protein.

Background

Straw mushroom (A)Volvariella volvacea) Is an edible fungus which is generally cultivated in China, has a long cultivation history, and has the advantages of fat and tender meat, delicious taste and rich nutritionIt is very popular with people. Research on the growth process of the straw mushrooms shows that the straw mushrooms can synthesize ethylene like high-grade plants, and the ethylene can accelerate the mature and aging of the picked fruit bodies. And the application of the plant ethylene inhibitor 1-methylcyclopropene can inhibit the mature and aging of the fruiting body of the adopted straw mushroom and effectively prolong the refreshing time. Based on the physiological phenomenon, ethylene receptors similar to higher plants probably exist in the straw mushrooms, and through deep research on the related ethylene receptors, a certain technical basis can be laid for the application of new straw mushroom variety cultivation, straw mushroom preservation and the like.

Disclosure of Invention

The application aims to provide the straw mushroom ethylene receptor protein, thereby laying a certain technical foundation for the technical development of new straw mushroom variety cultivation, straw mushroom preservation and the like.

The technical solution adopted in the present application is detailed as follows.

A straw mushroom ethylene receptor protein is named as VvEBD, the full length of a base sequence of the protein is 2211 bp, and the protein is shown as SEQ ID NO.1 and plays a role as an ethylene receptor in straw mushroom.

The preparation method of the straw mushroom ethylene receptor protein VvEBD is obtained by a PCR amplification method, and the specific PCR amplification steps are as follows:

(1) extracting straw mushroom total RNA and carrying out reverse transcription to obtain cDNA for later use;

(2) the primer sequences for PCR amplification were designed as follows:

VvEBD-F，5’-ACAAGCTTATGTCCCCTACAGTTGCTCGCT-3’，

VvEBD-R，5’-CACCAGTGTAACGCAGCGTAGAG-3’；

and (2) carrying out PCR amplification by taking the cDNA subjected to reverse transcription in the step (1) as a template and the VvEBD-F/R as a primer pair to obtain a target gene VvEBD.

The straw mushroom ethylene receptor protein VvEBD is applied to plants, and is combined with ethylene, so that the maturation process of the plants is regulated and controlled.

A method for cultivating a new plant variety utilizes a genetic engineering technical means, transcribes a straw mushroom ethylene receptor protein VvEBD into a plant genome, and regulates the growth or maturation time of the plant by combining with ethylene.

After the research on the existing volvaria volvacea genome, the inventor finds that 1 gene encodes a protein which has a similar structural domain with an ethylene receptor of a higher plant, and further speculates that the protein is possibly the ethylene receptor in volvaria volvacea. To verify the hypothesis, the inventors further cloned the protein, obtained the CDS region of the gene, transformed the gene using eukaryotic yeast expression system, and experimentally verified the binding ability of the protein to ethylene. The results prove that the yeast cells transformed with the transmembrane domain of the receptor protein can bind ethylene, namely, the protein is really an ethylene receptor in straw mushroom. Based on the discovery and the proof, a certain technical basis can be laid for the cultivation of new species of straw mushrooms and the preservation of straw mushrooms by over-expressing or silencing the coding gene of the protein.

Drawings

FIG. 1 shows the results of functional analysis and alignment of gene sequences;

FIG. 2 is an electrophoretogram of total RNA extraction from mycelia of straw mushroom;

FIG. 3 construction of a yeast expression recombinant plasmid; in the figure, M: marker Trans 5; 1: the PCR product EGFP; 2: PCR product VvEBD; 3: fusion PCR product VvEBD/EGFP; 4: pYES2/NT/A plasmid; 5: pYES2/NT/A-vvEBD/EGFP plasmid; 6: pYES2/NT/A-vvEBD/EGFP double enzyme digestion;

FIG. 4 shows the expression of recombinant proteins in Saccharomyces cerevisiae (the recipient strains are Saccharomyces cerevisiae INVSC 1);

figure 5 detection of the ethylene binding activity of vvEBD protein (different superscripts indicate significant differences (p < 0.05)).

Detailed Description

The present application is further explained with reference to the drawings and examples, and before describing the specific examples, some of the biological materials, reagents, and instruments involved in the following examples are briefly described as follows.

Biological material:

straw mushroom: the Malus baccata mushroom is purchased from agricultural academy of Henan province;

the yeast expression strain INVSCI, the eukaryotic expression plasmid pYES2/NT/A and the plasmid pEGFP-C1 with the green fluorescent protein gene are all common publicly available biological materials;

relevant primer synthesis and sequencing work in the examples was provided by Shanghai Bio Inc.;

experimental reagent:

the LB liquid culture medium, the LB solid culture medium, the PDA solid culture medium and the YPD liquid culture medium are all common culture media and can be prepared conventionally according to the prior art;

liquid medium for SC-Ura selection (100 mL): dissolving 0.8g of original culture medium (product of Beijing Kulai Boke technology Co., Ltd.) in 90mL of deionized water, adjusting pH to 5.8, adding 10mL of 20% glucose (20 g of glucose is added to 100mL of water, and filtering and sterilizing for later use);

solid medium for SC-Ura selection (100 mL): 2% of agar powder is added into a liquid culture medium for SC-Ura screening; sterilizing at 121 deg.C for 20 min;

SC-Ura Induction Medium (100 mL): 0.8g of original culture medium (product of Beijing Ku Lai Boke technology Co., Ltd.) was added to a volume of 80mL, and 20% galactose and 10% raffinose were added thereto in an amount of 10mL each;

trizol, RNA Loading Buffer, product of TaKaRa company;

DEPC water, product of Biosharp;

galactose, raffinose, product of kulaibock technologies ltd, beijing;

reverse transcription kit, Abm Biotech products Ltd

Restriction enzymes Hind III, Not I, NEB;

salmon sperm, a product of Beijing Solebao science and technology Limited;

2 × geneStar pfu PCR Mix, product of Leifeng.

PEG3350, 10xLiAc, 20% galactose solution, 20% glucose solution, 10% raffinose solution, etc. used in the yeast transformation process are prepared conventionally according to the prior art.

Example 1

Based on the previous research, the inventors speculate that a certain gene in the genome of volvariella volvacea may be a volvariella volvacea ethylene protein receptor (the alignment result is shown in fig. 1), in order to verify the function of the gene, the inventors firstly further clone the sequence and carry out detailed analysis on the structure, and in order to facilitate the subsequent further transformation verification, further recombine the cloned gene sequence to prepare an expression vector, and the present example is briefly introduced as follows with respect to the related experiments.

Firstly, extracting the total RNA of the straw mushroom and reversely transcribing the total RNA into cDNA for standby

(1) Total RNA extraction

Inoculating purchased straw mushroom hypha to a PDA culture medium, beating a hypha block of 5mm by using an inoculating loop after culturing and activating at 34 ℃, transferring the hypha block to a fresh PDA solid flat plate again, culturing for about 4 days at 34 ℃, scraping the fresh hypha as a sample for extraction when the straw mushroom hypha is about to fully grow on the PDA solid flat plate, putting the sample into a mortar precooled by liquid nitrogen, quickly grinding the sample until the hypha becomes uniform and fine powder, and then extracting the straw mushroom total RNA.

Specific extraction operations can be referred to as follows:

1) putting 1.5mL of a centrifuge tube on ice, putting about 0.1g of sample powder into the centrifuge tube, adding 1mL of reagent Trizol, violently shaking to fully mix the sample powder and the sample powder, standing for 5min, and centrifuging at 12000rpm for 10 min;

2) carefully transferring the supernatant to a new 1.5mL centrifuge tube, adding 200 μ L chloroform, violently shaking and mixing uniformly, standing for 5min, and centrifuging at 12000rpm for 10 min;

3) transferring 400 mu L of supernatant to a new 1.5mL centrifuge tube, adding 1-fold volume (400 mu L) of isopropanol, standing at-20 ℃ for 30min to precipitate RNA, and then centrifuging at 12000rpm for 10 min;

4) carefully discard the supernatant, add 1mL of 75% ethanol solution (7.5 mL absolute ethanol mixed with 2.5mL DEPC water), reverse the RNA precipitation, centrifugal at 12000rpm for 10min, repeat the step twice;

5) carefully pouring out the supernatant, drying for 10min to volatilize ethanol, adding a proper amount of DEPC (diethyl phthalate) to dissolve RNA precipitate, sampling, carrying out electrophoretic detection, and determining the concentration and the quality of RNA.

The results of total RNA extraction are shown in FIG. 2. As can be analyzed from the figure, the integrity of the extracted straw mushroom total RNA is better, 28S is about twice of 18S, and the extracted straw mushroom total RNA is basically not degraded and can be used for subsequent experiments.

(2) Preparation of cDNA library by reverse transcription

The first strand cDNA synthesis is further completed with reference to the reverse transcription kit instructions, and the specific procedures can be referred to as follows:

first, the total RNA extracted in step (1) was treated to remove DNA genome contamination, and specifically, in a 200. mu. LRNase-Free PCR tube, the reactants were added in the following amounts:

2 mu g of total RNA extracted in the step (1);

AccuRT Reaction Mix，2μL；

Nuclease-free H₂o, adding to the total volume of 8 mu L;

mixing, and incubating at 42 deg.C for 2 min;

then, the following ingredients were added in order,

AccuRT Reaction Stopper，2μL；

5×All-in-One RT MasterMix，4μL；

Nuclease-free H₂O，6μL；

after mixing, reaction on a PCR instrument: the first strand cDNA synthesis was completed at 25 deg.C, 10min, 42 deg.C, 50min, 85 deg.C, 5 min.

(II) PCR amplification

In addition, since the entire length of the transmembrane region (VvEBD) of the gene is targeted for amplification during PCR amplification (actual function of the gene can be confirmed by verifying the region), the primer sequences for PCR amplification are first designed as follows:

VvEBD-F，5’-ACAAGCTTATGTCCCCTACAGTTGCTCGCT-3’，

VvEBD-R，5’-CACCAGTGTAACGCAGCGTAGAG-3’；

then, the cDNA after reverse transcription in the step (I) is used as a template, and the VvEBD is obtained by PCR amplification by using the VvEBD-F/R as a primer.

During PCR amplification, a 20. mu.L amplification system is designed as follows:

cDNA template, 1. mu.L;

forward primer VvEBD-F (10. mu.M), 0.75. mu.L;

reverse primer VvEBD-R (10. mu.M), 0.75. mu.L;

2×pfu Mix，10μL；

ddH₂O，7.5μL；

the amplification procedure was: 94 ℃ for 5 min; 94 deg.C, 30s, 57 deg.C, 30s, 30 cycles, 72 deg.C, 10 min.

And after the PCR amplification is finished, carrying out electrophoresis detection and purifying the amplification product for later use. After further sequencing verification of the amplification product, the size of the band was consistent with the expected size.

The VvEBD has a full length of 2211 bp, and a base sequence shown in SEQ ID NO.1, and specifically comprises the following steps:

ATGTCCCCTACAGTTGCTCGCTCATCACGTCAGAAAATCCTGATAGCTTCTCACACCGAGGTCAAAATATCAATTCCCTTGACGCCATGGATTTGGCTGTTGTCGCTGGATATTCGGAAAGCAGCAGAATCCCTTCTCCTAATTTCTTCAACTCTTTATGCGGCTAACGCTTTGAAGGCGTACTCTGTTTCCTCGTTCGCGCTACCCGCCTTCACTGTTAATACTTCCTGGACCGTCTTAGAATTATATTTACTCGTCATTGTCTCCGTTCTATACACCCTCTGGGCACAGAGTCATATTGTCAATCCCAAGGAACCAGCACCCTCACCAGCACCCTCACCTGCAACACTTTCTGTACCCCTTCAATCCCCACGCTCATCCTCCCCTCGTCTTGCCGACCACCGTGATTATAAACGCAACAACTCCGTTATCCCACAAGCAAAAAGTAACATGACCTATATATGGATGTCTGTTCCGAAAAATTACAGACAATCCTCTGATGATGGTATTTTAACTGGTGTACTGTTTGGCCCAATCATTGCATGTGCATTGCTCGTTTCAGCCCTGAGACTTCTATCGGATAACGCCCCCACCCTACCTGCTGCATGGAGGATTGAGACCCCGGTAGCATTGCACAACCCACAATGGCAAATTTCTAGCATGGAAGCACTTGTCCTCTCGCGGCTGAATCTCGTTGACCTTGCTAGCTTCTGCTCCGCTTTGCTACTACTCCATGTGGGGGCATCCTGGTGGCTCGAATCTCGATGTTCGACTAGCGGGAATGCGTCGGAGGGTGAACGAACATCAGTTCCGCGAAGTGAAGGGTTGCGCTCGTGGTACTACATTATATTTACCACATGCGTTAGCTTGGGAATGTTTGGGATCAAACATCTGCTCGAGGACTTTGGGTGCCCCTTTTGGCGATATCTGAGTCCATTTGAGGCGATTATCGCGGCTTCGTTTTATCAGTTTGCTTTGTATCTATCCATCCGCTTGGCTCATCGCGGCTTCACCCTTGGTGAGCTCGGACTGGTCTGCTTTGGCGGTACAGCGCTGTTCATGGAGTTCCTGAATATCACCATCGCAAGGATATGGCCCGTCACAACCCCCTTTATAAAGACGTATCGGTTACCGACACCGCTTGTTATCTTTCAAGTTGCTCTGATTGCTGGTTCATTCCTGACGGGGTTTATCTTGTCCCCATTCCTGGTCCTTTCGCGGTATATTGCACAACGCCCCATTCGTCGCCTCCGGCATCCAGAAGACAAATTGCGCCACAGACGCTACCTTGCTCTAGGGTTTTATGTAGGCACAATTTTGATTGTTGGTGGGCTAATTGGCATGTGGACTCGATGGTGCCTCGGGAAGCGGGATCCTTGGCTTTGGGTCATTTTCTGGCTCCTCGAAGGAAAAAAGCAGTGGACGCGGCCGGCGCTTCTCTGTTATTGGGCTTTCCTGGGTTCTCTGAGTGTCGCTGGCTGGAATCGCCAGCTTGCAAGGTCGCGCAAATACCGACCGCGAAGTGCAACCGTGGATGTCGACGTACCAGGAATTCGCGAAACGACGGCGATTCCGACACTCAGTGAAGCAGCATCAATTCCACAGGGAACCAGTGCATCAACTACGGGAACTAGCAGTGCACTTGGACTGACTTTCTATAATCTACCGAATGGTACCAACGTATCAAATGTGGCCACGGACTTGTTGGATGCTGCAGACAAACATGTGCCGACGTTAAGGCTAAACGCAAGACGAAAGTTTTTCCATGCATTGGCGATCGTAATGTTTGTTCCGGGAGTGGGAATCGACCCGGCATTTACGCACTTGTCATTCAGTGCAGCATTTGCATTGTTCACGTTTGCGGAATACATCCGATACTTTGCAGTTTATCCCTTTGGGGCGGCGGTTCATGTATTCATGAACGAATTCCTTGATCACAGGGACAGTGGAACGGCCATTCTCAGTCATTTCTATCTTCTGACGGGCTGTGCAGGCGCAGTTTGGCTGGAGGGGCCATCACAATTGCTCCAATTCAGTGGGATACTGGCCCTGGGTGTAGGGGATGCGCTGGCATCTGTGGTAGGAAAGCGCATGGGGGTGCACCGATGGATGAGCAGCACGGCCAAGACCGTTGAGGGCAGCATCGCGTTCACTCTGTCCATCGTGCTTTCAGCATGGCTGTTGCGGCTTGTCGGATTTGCGGAGGCATTC

(III) fusion PCR

It should be noted that, for the convenience of subsequent observation and detection, the inventors further fused the amplification product obtained in step (ii) with the EGFP gene by using the fusion PCR technique, and the specific process is briefly described as follows.

(1) Obtaining EGFP Gene

Taking the existing plasmid containing the EGFP gene as a template, and utilizing an EGFP-F/R primer to perform PCR amplification to obtain an EGFP gene sequence (the PCR reaction system and the program refer to the step (II)), wherein the specific sequence of the EGFP-F/R primer is as follows:

EGFP-F，5’-ACACTGGTGATGGTGAGCAAGGGCG-3’，

EGFP-R，5’-TTGCGGCCGCTTACTTGTACAGCTCGTCCATG-3’。

(2) first step fusion PCR

The 50 μ L first-step fusion PCR reaction system was designed as follows:

upstream fragment (VvEBD amplified in step (II)), 1 μ L;

downstream fragments (amplified EGFP product from step (1)), 1. mu.L;

pfu mix，25μL；

ddH₂O，23μL；

first step PCR procedure: 95 deg.C for 5 min; 95 ℃, 30s, 57 ℃, 30s, 15 cycles; 72 deg.C, 10 min.

(3) Second step fusion PCR

In a 50-L first-step fusion PCR reaction system, the following reactants are directly added:

upstream primer RH-F of upstream fragment, 1 μ L;

downstream fragment downstream primer RH-R, 1 μ L;

pfu mix，25μL；；

ddH₂O，23μL；

second step PCR procedure: 95 deg.C for 5 min; 95 deg.C, 30s, 57 deg.C, 30s, 30 cycles, 72 deg.C, 10 min;

the specific sequences of the primer RH-F and the primer RH-R are as follows:

RH-F，5’-GCGTTACACTGGTGATGGTGAGCAAGG-3’，

RH-R，5’-TTGCGGCCGCTTACTTGTACAGCTCG-3’。

and after the PCR is finished, carrying out electrophoresis detection on the amplification product and recovering for later use.

In order to verify the correctness of the fusion fragment, after the fusion fragment is further connected with a T vector by referring to the prior art, escherichia coli DH5 alpha competent cells are transformed, ampicillin-resistant LB plates are utilized for screening, and correct transformants are selected for sequencing verification, so that the correctness of the fusion fragment is ensured.

(IV) enzyme digestion and connection to construct recombinant expression plasmid

Performing HindIII and Not I double enzyme digestion on the fusion fragment product and the plasmid pYES2/NT/A in the step (III), recovering the enzyme digestion products, and connecting to construct a recombinant expression plasmid.

In the double digestion process, 20. mu.L of digestion system is designed as follows:

HindⅢ，0.4μL；

NotⅠ，0.4μL；

plasmid pYES2/NT/A (or fusion fragment product), 1. mu.g;

10×buffer，2μL；

ddH₂o, adding to 20 mu L;

the enzyme was cleaved at 37 ℃ for 45 min.

For T4 DNase ligation, a 10. mu.l ligation system was designed as follows:

pYES2/NT/A enzyme digestion product, 2. mu.l;

fusing PCR enzyme digestion product, 5 mul;

T4 ligase，1μl；

5×T4 ligase buffer，2μl；

enzyme-linked for about 12-14 h at 16 ℃.

The results of PCR amplification products at different stages and electrophoresis of recombinant plasmids are summarized in FIG. 3. As can be seen from FIG. 3, the amplification results of the relevant primers and the plasmid construction results are all expected.

Example 2

Based on the ligation products in example 1, the inventors directly transformed the strain Saccharomyces cerevisiae INVSC1 for transformation verification, and the specific experimental procedures are briefly described as follows.

(1) Fast transforming yeast

Specific operations are referenced as follows:

1) taking out salmon sperm, boiling in boiling water for 5min, and immediately placing on ice for use;

2) taking 1mL of bacterial liquid (Saccharomyces cerevisiae INVSC1 strain is inoculated in YPD liquid culture medium in advance, and shaking to bacterial liquid OD₆₀₀= 0.6), centrifuging at 12000rpm for 30s, discarding the supernatant, and collecting the thallus;

3) adding reagents in sequence according to the proportion:

PEG3350, 240. mu.L, 10 × LiAc, 36. mu.L, salmon sperm (vortex pretreatment before addition), 10. mu.L, plasmid, 2. mu.L (plasmid concentration not less than 100 ng/. mu.L), H₂O、72μL；

Mixing, and incubating at 42 deg.C for 3 h;

4) taking the reaction system after the incubation in the step (3), centrifuging at 12000rpm for 30s, removing the supernatant, and adding 120 mu LH₂O resuspending the cells, coating the cells on a solid culture medium for SC-Ura screening,

and (3) carrying out inverted culture in an incubator at 30 ℃ for 2-3 days.

(2) Screening and identification of transformants

Selecting positive transformants from the SC-Ura screening medium plate, inoculating the positive transformants into 5mL of SC-Ura screening liquid medium, adding 5 mu L of kanamycin resistance (100 mg/mL), and culturing until the bacterial liquid is turbid;

and then, amplifying the VvEBD/EGFP fusion gene by using the bacterial liquid as a template and VvEBD-F and EGFP-R as primers to perform PCR identification on the bacterial liquid.

(3) Laser confocal microscopy after induced protein expression

Selecting correct transformants screened and identified in the step (2), inoculating the transformants into 5mL of SC-Ura induction liquid culture medium, performing shake culture at 30 ℃, sampling at the time points of 24h, 36h and 48h of culture respectively, and checking the cell expression condition by using a laser confocal microscope.

The results of the cell electron microscopy of a part of the recombinant yeast are shown in FIG. 4. Analysis can see that: the recombinant protein was successfully expressed in yeast cells, but the expression level was low. The expression condition of the arabidopsis ethylene receptor gene fusion EGFP gene in yeast cells is compared to find that the arabidopsis fusion protein has obviously stronger fluorescence intensity. The analysis shows that the arabidopsis ethylene receptor binding domain is smaller and can be folded more correctly in a yeast expression system, but the straw mushroom ethylene receptor part is longer, so that an amino acid chain can not be folded correctly in the yeast system, and a part of cells do not have fluorescence; another reason is that yeast cells lost the recombinant plasmids pYES2/NT/AvvEBD/EGFP and pYES2/NT/A-AtEBD/EGFP during passage, so yeast cells lost the plasmids did not fluoresce.

(4) Detection of binding ability of expressed VvEBD protein to ethylene

According to the observation result in the step (3), it can be seen that the brightness of the transformant cell is high when the transformant cell is induced to express for 24h or 36h, that is, the protein expression amount is ideal, so that the subsequent experiment is to perform the ethylene binding capacity detection experiment on the yeast cell induced to express for 24 h.

Taking the bacterial liquid induced and expressed for 24 hours in the step (3), centrifugally collecting about 0.7g of yeast cells in a chloramphenicol bottle, sealing, vacuumizing, immediately introducing 10mL of ethylene gas, and standing for 4 hours at 22 ℃ (shaking the bottle for 2-3 times in the middle to ensure that the thalli can be fully contacted with ethylene);

after the ethylene gas is finished, uncovering the seal to blow off the ethylene gas, diluting the cells with sterile water, transferring the cells into a neochloramphenicol bottle, sealing the bottle, vacuumizing the bottle, and standing the bottle for 90min at 65 ℃ to fully release the unbound ethylene;

and finally, extracting ethylene gas released from the chloramphenicol bottle, and detecting the ethylene release amount by using a GC method, wherein the ethylene release amount is the ethylene binding capacity of the Volvariella volvacea ethylene protein receptor.

In the experiment, recombinant cells of saccharomyces cerevisiae transformed into pYES2/NT/A unloaded plasmid are used as a blank control, and recombinant cells transformed into Arabidopsis ethylene receptor (AtEBD) are used as a positive control.

The arabidopsis ethylene receptor AtEBD base sequence is as follows: ATGGAAGTCTGCAATTGTATTGAACCGCAATGGCCAGCGGATGAATTGTTAATGAAATACCAATACATCTCCGATTTCTTCATTGCGATTGCGTATTTTTCGATTCCTCTTGAGTTGATTTACTTTGTGAAGAAATCAGCCGTGTTTCCGTATAGATGGGTACTTGTTCAGTTTGGTGCTTTTATCGTTCTTTGTGGAGCAACTCATCTTATTAACTTATGGACTTTCACTACGCATTCGAGAACCGTGGCGCTTGTGATGACTACCGCGAAGGTGTTAACCGCTGTTGTCTCGTGTGCTACTGCGTTGATGCTTGTTCATATTATTCCTGATCTTTTGAGTGTTAAGACTCGGGAGCTTTTCTTGAAAAATAAAGCTGC are provided.

When gas chromatography is detected, the specific parameters are set as follows: using hydrogen ion flame detector (FID), and separating with GDX-5022 m × 3mm, N₂The total flow rate is 20 mL/min, the FID hydrogen flow rate is 40 mL/min, the sample inlet (WBI) temperature is 110 ℃, the chromatographic column temperature is 60 ℃, and the FID detector temperature is 150 ℃.

Further plots are shown in FIG. 5 based on the test data. Analysis can see that: VvEBD and AtEBD have obvious difference compared with the blank control group, the capacity of combining ethylene is far greater than that of the blank control group, the obvious ethylene combination capacity is provided, and the capacity of combining ethylene of AtEBD is stronger, which is probably similar to the expression condition of protein, because AtEBD fragments are smaller and are easier to fold into correct forms, more AtEBD genes are expressed in the same yeast cells, so the ethylene combination capacity is stronger; in contrast, VvEBD is less ethylene binding and may not fold correctly, or may be expressed but not active in yeast cells because it is too large. In summary, both VvEBD and AtEBD have the ability to bind and release ethylene, which is consistent with the characterization of the ethylene receptor binding domain of the ethylene receptor gene, and thus the fragment is the ethylene receptor binding domain.

SEQUENCE LISTING

<110> Henan university of agriculture

<120> one straw mushroom ethylene receptor protein

<130> none

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 2211

<212> DNA

<213> Volvariella volvacea

<400> 1

atgtccccta cagttgctcg ctcatcacgt cagaaaatcc tgatagcttc tcacaccgag 60

gtcaaaatat caattccctt gacgccatgg atttggctgt tgtcgctgga tattcggaaa 120

gcagcagaat cccttctcct aatttcttca actctttatg cggctaacgc tttgaaggcg 180

tactctgttt cctcgttcgc gctacccgcc ttcactgtta atacttcctg gaccgtctta 240

gaattatatt tactcgtcat tgtctccgtt ctatacaccc tctgggcaca gagtcatatt 300

gtcaatccca aggaaccagc accctcacca gcaccctcac ctgcaacact ttctgtaccc 360

cttcaatccc cacgctcatc ctcccctcgt cttgccgacc accgtgatta taaacgcaac 420

aactccgtta tcccacaagc aaaaagtaac atgacctata tatggatgtc tgttccgaaa 480

aattacagac aatcctctga tgatggtatt ttaactggtg tactgtttgg cccaatcatt 540

gcatgtgcat tgctcgtttc agccctgaga cttctatcgg ataacgcccc caccctacct 600

gctgcatgga ggattgagac cccggtagca ttgcacaacc cacaatggca aatttctagc 660

atggaagcac ttgtcctctc gcggctgaat ctcgttgacc ttgctagctt ctgctccgct 720

ttgctactac tccatgtggg ggcatcctgg tggctcgaat ctcgatgttc gactagcggg 780

aatgcgtcgg agggtgaacg aacatcagtt ccgcgaagtg aagggttgcg ctcgtggtac 840

tacattatat ttaccacatg cgttagcttg ggaatgtttg ggatcaaaca tctgctcgag 900

gactttgggt gccccttttg gcgatatctg agtccatttg aggcgattat cgcggcttcg 960

ttttatcagt ttgctttgta tctatccatc cgcttggctc atcgcggctt cacccttggt 1020

gagctcggac tggtctgctt tggcggtaca gcgctgttca tggagttcct gaatatcacc 1080

atcgcaagga tatggcccgt cacaaccccc tttataaaga cgtatcggtt accgacaccg 1140

cttgttatct ttcaagttgc tctgattgct ggttcattcc tgacggggtt tatcttgtcc 1200

ccattcctgg tcctttcgcg gtatattgca caacgcccca ttcgtcgcct ccggcatcca 1260

gaagacaaat tgcgccacag acgctacctt gctctagggt tttatgtagg cacaattttg 1320

attgttggtg ggctaattgg catgtggact cgatggtgcc tcgggaagcg ggatccttgg 1380

ctttgggtca ttttctggct cctcgaagga aaaaagcagt ggacgcggcc ggcgcttctc 1440

tgttattggg ctttcctggg ttctctgagt gtcgctggct ggaatcgcca gcttgcaagg 1500

tcgcgcaaat accgaccgcg aagtgcaacc gtggatgtcg acgtaccagg aattcgcgaa 1560

acgacggcga ttccgacact cagtgaagca gcatcaattc cacagggaac cagtgcatca 1620

actacgggaa ctagcagtgc acttggactg actttctata atctaccgaa tggtaccaac 1680

gtatcaaatg tggccacgga cttgttggat gctgcagaca aacatgtgcc gacgttaagg 1740

ctaaacgcaa gacgaaagtt tttccatgca ttggcgatcg taatgtttgt tccgggagtg 1800

ggaatcgacc cggcatttac gcacttgtca ttcagtgcag catttgcatt gttcacgttt 1860

gcggaataca tccgatactt tgcagtttat ccctttgggg cggcggttca tgtattcatg 1920

aacgaattcc ttgatcacag ggacagtgga acggccattc tcagtcattt ctatcttctg 1980

acgggctgtg caggcgcagt ttggctggag gggccatcac aattgctcca attcagtggg 2040

atactggccc tgggtgtagg ggatgcgctg gcatctgtgg taggaaagcg catgggggtg 2100

caccgatgga tgagcagcac ggccaagacc gttgagggca gcatcgcgtt cactctgtcc 2160

atcgtgcttt cagcatggct gttgcggctt gtcggatttg cggaggcatt c 2211

Claims (3)

1. The straw mushroom ethylene receptor protein is characterized in that the protein is named as VvEBD, and the full length of a base sequence of the protein is 2211 bp, and is shown as SEQ ID NO. 1.

2. The method for preparing Volvariella volvacea ethylene receptor protein VvEBD as claimed in claim 1, which is obtained by PCR amplification method, wherein the PCR amplification steps are as follows:

(1) extracting straw mushroom total RNA and carrying out reverse transcription to obtain cDNA for later use;

(2) the primer sequences for PCR amplification were designed as follows:

VvEBD-F，5’-ACAAGCTTATGTCCCCTACAGTTGCTCGCT-3’，

VvEBD-R，5’-CACCAGTGTAACGCAGCGTAGAG-3’；

and (2) carrying out PCR amplification by taking the cDNA subjected to reverse transcription in the step (1) as a template and the VvEBD-F/R as a primer pair to obtain a target gene VvEBD.

3. Use of the Volvariella volvacea ethylene receptor protein VvEBD according to claim 1 in Volvariella volvacea, wherein the ethylene receptor protein binds ethylene and thereby regulates the maturation process of Volvariella volvacea.

Images