CN110656121B

CN110656121B - Method for regulating and controlling cell size of escherichia coli

Info

Publication number: CN110656121B
Application number: CN201911038423.1A
Authority: CN
Inventors: 刘立明; 郭亮; 陈修来; 刁文文; 刘佳; 罗秋玲
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2019-10-29
Filing date: 2019-10-29
Publication date: 2022-04-29
Anticipated expiration: 2039-10-29
Also published as: CN110656121A

Abstract

The invention discloses a method for regulating and controlling the size of escherichia coli cells, and belongs to the technical field of biological engineering. The invention regulates the cell size of Escherichia coli by deleting the coding gene csrA of the carbon storage regulatory factor and the fusion protein gene hns-gfp of the over-expression histidine analogue and the green fluorescent protein. The results show that the Escherichia coli can realize the regulation and control of the cell size of the Escherichia coli by controlling the concentration of an inducer on the basis of deletion of a carbon storage regulatory factor gene and overexpression of a fusion protein of a histidine analogue and a green fluorescent protein, and compared with an original strain, the cell size of the Escherichia coli can be increased by 1379% under induction of different anhydrous tetracycline (aTc). This provides a new strategy for regulating the cell size of Escherichia coli.

Description

Method for regulating and controlling cell size of escherichia coli

Technical Field

The invention relates to a method for regulating and controlling the size of escherichia coli cells, and belongs to the technical field of biological engineering.

Background

Escherichia coli (Escherichia coli) has become the most widely used host bacterium in the aspects of metabolic engineering and synthetic biology at present due to clear genetic background, mature gene operation means, better compatibility and rapid growth advantage. Meanwhile, Escherichia coli is also used for producing polymers such as Polyhydroxyalkanoate (PHA), poly beta hydroxyalkanoate (PHB), etc.

During the fermentation process of producing polymers, intracellular polymers accumulate to occupy intracellular space, which seriously affects cell growth, thereby reducing the yield of polymers. Coli cells are microscopic in morphology, which not only limits the accumulation of polymer, but also increases the cost of product isolation. Therefore, effectively increasing the cell size is a problem to be solved in the process of producing polymers by using escherichia coli. At present, methods for increasing the cell size of escherichia coli mainly control the formation of cell walls, control the formation of peptidoglycan, and control cell division, but these methods control the cell size and cause cell growth to decrease, and the methods cannot control the distribution of the content in the cells.

Disclosure of Invention

The first purpose of the invention is to provide a method for regulating and controlling the size of Escherichia coli cells, wherein an inducer is added in the cell culture process, and the concentration of the inducer is regulated to regulate the size of the Escherichia coli cells; the Escherichia coli does not express a carbon storage regulatory factor, and overexpresses a fusion protein of histidine analogue and green fluorescent protein; the non-expression includes deletion or silencing.

In one embodiment of the invention, the induction agent comprises anhydrotetracycline.

In one embodiment of the invention, the overexpression is: the tetracycline-inducible promoter is adopted to transcribe the gene encoding the histidine analog and green fluorescent protein fusion protein.

In one embodiment of the present invention, the concentration of the inducer is 0 to 150 ng/mL.

In one embodiment of the present invention, the amino acid sequence of the carbon storage regulator corresponds to the amino acid sequence encoded by the gene access number 947176 at NCBI.

In one embodiment of the present invention, the amino acid sequence of the histidine analog is identical to the amino acid sequence encoded by the gene of access number:945829 at NCBI.

In one embodiment of the present invention, the amino acid sequence of the green fluorescent protein is identical to the amino acid sequence encoded by the gene for accession number MK816963 at NCBI.

In one embodiment of the invention, the amino acid sequence of the fusion protein is shown in SEQ ID NO.1, and the nucleotide sequence encoding the fusion protein is shown in SEQ ID NO. 2.

In one embodiment of the invention, the Escherichia coli comprises Escherichia coli (Escherichia coli) JM 109. The Escherichia coli JM109 was purchased from TaKaRa.

In one embodiment of the present invention, the non-expression carbon storage regulatory factor is specifically:

(1) designing a primer carrying a csrA homologous arm according to a csrA gene (NCBI accession number:947176)3 'and a 45bp sequence at a 5' end in Escherichia coli K-12, and amplifying a knockout frame containing the csrA homologous arm and a kanamycin resistance gene by adopting a PCR technology and taking a pKD4 plasmid as a template;

(2) the above knock-out cassette was introduced into E.coli harboring pKD46 plasmid.

In one embodiment of the present invention, the overexpression of the histidine analog and green fluorescent protein fusion protein is specifically:

(1) coli JM109 genome as template, PCR technology to respectively amplify gene hns coding histidine analog and gene gfp coding green fluorescent protein, and one-step homologous recombination to connect to plasmid pTetR to obtain recombinant plasmid pTetR/P_TET-HNS-GFP；

(2) The recombinant plasmid pTetR/P_TET-HNS-GFP into E.coli. In an embodiment of the present inventionIn this embodiment, the gene encoding the fusion protein is ligated into the pTetR vector for free expression.

In one embodiment of the invention, carbon storage regulator (access number:947176) is knocked out using homologous recombination.

The third purpose of the invention is to provide the application of the method for regulating the cell size of the Escherichia coli in the industrial production of polymers.

The invention has the beneficial effects that:

i) the invention provides a method for regulating and controlling the size of an escherichia coli cell, wherein the size of the escherichia coli cell is respectively increased by 57.1%, 56.4%, 38.1%, 427.8%, 541.2%, 605.7% and 1379%;

ii) the method adopted by the invention is simple, easy to control and low in production cost, and is beneficial to popularization and application of industrial production;

iii) the invention provides a new idea for regulating the cell size of Escherichia coli.

Drawings

FIG. 1 is an electrophoretic identification chart (csrA knock-out) of homologous recombination positive recombinants, wherein M is 2000bp marker, 1 and 2 are blank controls, 3 is colony PCR verification after carbon storage regulatory factor gene knock-out, 4 is wild type Escherichia coli carbon storage regulatory factor gene, and 5 is colony PCR verification after carbon storage regulatory factor gene is homologous recombination by kanamycin resistance gene.

FIG. 2 shows the recombinant plasmid pTetR/P_TET-HNS-GFP construction scheme.

FIG. 3 shows the recombinant plasmid pTetR/P_TET-map of HNS-GFP.

FIG. 4 shows the effect of different inducer concentrations on the morphology of E.coli cells.

FIG. 5 is a graph showing the effect of different inducer concentrations on E.coli cell size.

Detailed Description

The content of the 3-hydroxybutyric acid-lactic acid polymer measured by gas chromatography:

GC-2014 gas chromatograph from Shimadzu was used. The chromatographic column is HP-5 capillary column with length of 30m and inner diameter of 320 μm, and the stationary phase is 250nm thick phenylmethylpolysiloxane. The detector is a flame ionization detector. Carrier gas: high purity nitrogen, gas: hydrogen, combustion-supporting gas: air. An AOC-20S model autosampler was used, acetone as the cleaning agent.

The GC analysis program was set up as follows:

column temperature: starting at 80 ℃, and staying for 1.5 min; heating to 140 deg.C at a rate of 30 deg.C/min, and standing for 0 min; heating to 240 ℃ at the speed of 40 ℃/min, and staying for 2 min; the total time was 8 min.

The hydrogen flow rate was 50mL/min and the air flow rate was 400 mL/min. The injection port temperature is 240 ℃, and the detector temperature is 250 ℃.

Example 1: knock-out of gene csrA encoding carbon storage regulator of coli JM109

According to the sequence of 45bp at the 5 'end and the 3' end of a carbon storage regulatory factor gene csrA in Escherichia coli K-12 in an NCBI database, upstream and downstream homologous arm amplification primers csrA-1 and csrA-2 are designed, a kanamycin resistance gene knockout frame containing the csrA homologous arm is amplified by using the csrA-1 and csrA-2 with pKD4 as a template, and the sequence is named as csrAK.

csrAK was electrotransformed into E.coli JM109 competent cells containing pKD46 plasmid (electrotransformation voltage and time were 2500V and 5ms, respectively). After being rapidly recovered in 1mL LB medium at 37 ℃ for 1h at 150rpm, the culture medium was plated on LB solid medium plates containing kanamycin (30. mu.g/mL). After inverted culture for 24h, positive transformants are identified by colony PCR method by using identification primers FRT-U and csrA-D, and PCR amplified fragments of the positive transformants are about 1806bp after the csrA gene of escherichia coli is successfully replaced by kanamycin resistance gene. The pCP20 plasmid was transformed to the above-mentioned positive transformant to eliminate kanamycin resistance gene, after overnight culture at 42 ℃, single colonies that could grow on a non-resistant plate but not on a kanamycin-containing plate were selected and verified by using the identifying primers FRT-U and csrA-D, the length of the gene fragment where csrA was successfully knocked out was about 413bp, FIG. 1 is PCR verification.

The correct strain was verified and named e.coli JM109 Δ csrA. The primer sequences are shown in Table 1.

TABLE 1 primer sequences for PCR amplification of knock-out fragments and overexpression of genes

Primer name	Primer sequences
		csrA-1	ACAGAGAGACCCGACTCTTTTAATCTTTCAAGGAGCAAAGAATGGTGTAGGCTGGAGCTGCTTC
csrA-2	TTTGAGGGTGCGTCTCACCGATAAAGATGAGACGCGGAAAGATTACATATGAATATCCTCCTTAG
		FRT-U	GTGTAGGCTGGAGCTGCTTC
csrA-D	GCCACCTCACCACACGCC
		Hns-A：	GGTACCAGATCTACTAGTTTGCTTGATCAGGAAATCGTCG
Hns-S：	ACGCGTCGACAAAGAGGAGAAAGATATCATGAGCGAAGCACTTAAAATTCTG
		GFP-A：	TTGATGCCTGGAGATCCTTACTCGAGTTACTTGTACAGCTCGTCCATGCC
GFP-S:	CAAACTAGTAGATCTGGTACCGTGAGCAAGGGCGAGGAG

Example 2: overexpression of fusion protein of histidine analog and green fluorescent protein

PCR amplification of histidine analog genes (NCBI access number:945829) was performed using primers Hns-A and Hns-S, based on the genome of Escherichia coli K-12 in NCBI database as a template; the green fluorescent protein gene (NCBI access number: MK816963) was amplified using primers GFP-A and GFP-S (shown in FIG. 2).

The primer sequences are shown in Table 1.

The amplified fragment is connected to pTetR plasmid which is double digested by EcoR I and Xho I by adopting a one-step homologous recombination mode, wherein the underlined parts of Hns-A and GFP-S primers are nucleotide sequences of fusion tags.

Transforming the above-mentioned ligated product into E.coli JM109 competent cells, coating LB plate with chloramphenicol resistance, picking up transformants, extracting plasmids, and verifying sequencing to obtain plasmid pTetR/P_TETHNS-GFP (FIG. 3).

The constructed plasmid pTetR/P_TETTransformation of E.coli JM 109. delta. csrA cells with-HNS-GFP to obtain a positive transformant E.coli JM 109. delta. csrA pTetR/P_TET-HNS-GFP。

Example 3: controlling the concentration of the inducer to regulate the size of the Escherichia coli cells

Coli JM 109. delta. CsrA pTetR/P is induced by the following method_TET-HNS-GFP expressing histidine analog and green fluorescent protein fusion protein:

(1) the constructed genetically engineered bacterium E.coli JM109 delta CsrAptetR/P_TETInoculating HNS-GFP into an LB slant culture medium to culture for 12 h;

(2) inoculating the slant seeds obtained in the step (1) into an LB culture medium, and culturing for 6 h;

(3) inoculating the seed liquid obtained in the step (2) into an LB fermentation medium, and culturing to OD₆₀₀At 0.6, different concentrations of anhydrotetracycline were added for induction, with anhydrotetracycline concentrations of 0.25ng/mL, 0.5ng/mL, 1ng/mL, 10ng/mL, 50ng/mL, 100ng/mL, and 150ng/mL, respectively. Induction ofAfter 12h, the cells were collected and washed with sterile physiological saline.

(4) Changes in the cell length of E.coli were observed using a Nikon positive fluorescence microscope (Nikon ECLIPSE 80i) (shown in FIGS. 4 and 5).

The results showed that the control of the cell size of E.coli could be achieved by controlling the concentration of the inducer, and the cell size of E.coli was increased by 57.1%, 56.4%, 38.1%, 427.8%, 541.2%, 605.7% and 1379% under the induction of anhydrotetracycline (aTc) of 0.25ng/mL, 0.5ng/mL, 1ng/mL, 10ng/mL, 50ng/mL, 100ng/mL and 150ng/mL, respectively, compared to the starting strain (average cell length of 1.57 μm).

Example 4: application of method for regulating and controlling escherichia coli cell size in polymer production

The phaA (NCBI accession number: AAA21972.1) and phaB (NCBI accession number: AAA21973.1) genes were artificially synthesized and expressed with pEtac vector (construction method: Shen. Pyrococcus furiosus. alpha. -amylase gene in different hosts [ D]City, university of south Jiangnan, 2003.) to obtain plasmid pEtac/P_Tac-phaAB。

phaC (NCBI access number: BAA36200.1) was synthesized and ligated with pSC101 vector to give plasmid pSC101/P_TET-phaC。

Artificially synthesized pct gene (NCBI access number: LC126829.1) fragment and pSC101/P_TETThe alpha-phaC ligation gives pSC101/P_TET-phaC-pct。

Transformation of the plasmid obtained above to E.coli JM 109. delta. CsrAptetR/P_TETAnd (3) coating competent cells of HNS-GFP on a kanamycin, ampicillin and chloramphenicol three-resistance LB plate for screening, and identifying a positive transformant obtained by colony PCR (polymerase chain reaction) to obtain the escherichia coli genetic engineering bacteria for regulating and producing the polymer, wherein the escherichia coli genetic engineering bacteria is named PLH-1.

Inoculating the engineering strain PLH-1 stored in a glycerin pipe on an LB culture medium slant, taking a loop to a seed culture medium (20mL/100mL triangular flask), culturing at 37 ℃ and 200rpm for 12h, then inoculating a fermentation culture medium (3L/5L fermentation tank) with 10% inoculation amount (V/V), wherein the temperature is 37 ℃, the rotation speed is 800rpm, the aeration amount is 1vvm, 8mM KOH is adjusted to 7.0, the fermentation time is 72h, and 100ng/mL aTc and 0.4mmol/L IPTG are added when culturing for 8 h.

Measured by gas chromatography: the above method can make the content of the polymer (3-hydroxybutyrate-lactate polymer) reach 25 wt%, and the yield of the polymer is increased by 25% compared with the control strain obtained by using E.coli JM109 as a host.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> a method for regulating and controlling the size of Escherichia coli cells

<160> 10

<170> PatentIn version 3.3

<210> 1

<211> 382

<212> PRT

<213> Artificial sequence

<400> 1

Met Ser Glu Ala Leu Lys Ile Leu Asn Asn Ile Arg Thr Leu Arg Ala

1 5 10 15

Gln Ala Arg Glu Cys Thr Leu Glu Thr Leu Glu Glu Met Leu Glu Lys

20 25 30

Leu Glu Val Val Val Asn Glu Arg Arg Glu Glu Glu Ser Ala Ala Ala

35 40 45

Ala Glu Val Glu Glu Arg Thr Arg Lys Leu Gln Gln Tyr Arg Glu Met

50 55 60

Leu Ile Ala Asp Gly Ile Asp Pro Asn Glu Leu Leu Asn Ser Leu Ala

65 70 75 80

Ala Val Lys Ser Gly Thr Lys Ala Lys Arg Ala Gln Arg Pro Ala Lys

85 90 95

Tyr Ser Tyr Val Asp Glu Asn Gly Glu Thr Lys Thr Trp Thr Gly Gln

100 105 110

Gly Arg Thr Pro Ala Val Ile Lys Lys Ala Met Asp Glu Gln Gly Lys

115 120 125

Ser Leu Asp Asp Phe Leu Ile Lys Gln Thr Ser Arg Ser Gly Thr Met

130 135 140

Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile Leu Val

145 150 155 160

Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val Ser Gly Glu

165 170 175

Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe Ile Cys

180 185 190

Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr Thr Leu

195 200 205

Thr Tyr Gly Val Gln Cys Phe Ser Arg Tyr Pro Asp His Met Lys Gln

210 215 220

His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln Glu Arg

225 230 235 240

Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala Glu Val

245 250 255

Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys Gly Ile

260 265 270

Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu Tyr Asn

275 280 285

Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys Asn Gly

290 295 300

Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly Ser Val

305 310 315 320

Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp Gly Pro

325 330 335

Val Leu Leu Pro Asp Asn His Tyr Leu Ser Thr Gln Ser Ala Leu Ser

340 345 350

Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu Phe Val

355 360 365

Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys

370 375 380

<210> 2

<211> 1149

<212> DNA

<213> Artificial sequence

<400> 2

atgagcgaag cacttaaaat tctgaacaac atccgtactc ttcgtgcgca ggcaagagaa 60

tgtacacttg aaacgctgga agaaatgctg gaaaaattag aagttgttgt taacgaacgt 120

cgcgaagaag aaagcgcggc tgctgctgaa gttgaagagc gcactcgtaa actgcagcaa 180

tatcgcgaaa tgctgatcgc tgacggtatt gacccgaacg aactgctgaa tagccttgct 240

gccgttaaat ctggcaccaa agctaaacgt gctcagcgtc cggcaaaata tagctacgtt 300

gacgaaaacg gcgaaactaa aacctggact ggccaaggcc gtactccagc tgtaatcaaa 360

aaagcaatgg atgagcaagg taaatccctc gacgatttcc tgatcaagca aactagtaga 420

tctggtacca tggtgagcaa gggcgaggag ctgttcaccg gggtggtgcc catcctggtc 480

gagctggacg gcgacgtaaa cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat 540

gccacctacg gcaagctgac cctgaagttc atctgcacca ccggcaagct gcccgtgccc 600

tggcccaccc tcgtgaccac cctgacctac ggcgtgcagt gcttcagccg ctaccccgac 660

cacatgaagc agcacgactt cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc 720

accatcttct tcaaggacga cggcaactac aagacccgcg ccgaggtgaa gttcgagggc 780

gacaccctgg tgaaccgcat cgagctgaag ggcatcgact tcaaggagga cggcaacatc 840

ctggggcaca agctggagta caactacaac agccacaacg tctatatcat ggccgacaag 900

cagaagaacg gcatcaaggt gaacttcaag atccgccaca acatcgagga cggcagcgtg 960

cagctcgccg accactacca gcagaacacc cccatcggcg acggccccgt gctgctgccc 1020

gacaaccact acctgagcac ccagtccgcc ctgagcaaag accccaacga gaagcgcgat 1080

cacatggtcc tgctggagtt cgtgaccgcc gccgggatca ctctcggcat ggacgagctg 1140

tacaagtaa 1149

<210> 3

<211> 64

<212> DNA

<213> Artificial sequence

<400> 3

acagagagac ccgactcttt taatctttca aggagcaaag aatggtgtag gctggagctg 60

cttc 64

<210> 4

<211> 65

<212> DNA

<213> Artificial sequence

<400> 4

tttgagggtg cgtctcaccg ataaagatga gacgcggaaa gattacatat gaatatcctc 60

cttag 65

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<400> 5

gtgtaggctg gagctgcttc 20

<210> 6

<211> 18

<212> DNA

<213> Artificial sequence

<400> 6

gccacctcac cacacgcc 18

<210> 7

<211> 40

<212> DNA

<213> Artificial sequence

<400> 7

ggtaccagat ctactagttt gcttgatcag gaaatcgtcg 40

<210> 8

<211> 52

<212> DNA

<213> Artificial sequence

<400> 8

acgcgtcgac aaagaggaga aagatatcat gagcgaagca cttaaaattc tg 52

<210> 9

<211> 50

<212> DNA

<213> Artificial sequence

<400> 9

ttgatgcctg gagatcctta ctcgagttac ttgtacagct cgtccatgcc 50

<210> 10

<211> 39

<212> DNA

<213> Artificial sequence

<400> 10

caaactagta gatctggtac cgtgagcaag ggcgaggag 39

Claims

1. The application of the method for regulating and controlling the cell size of the escherichia coli in the industrial production of the 3-hydroxybutyrate-lactate polymer is characterized in that the method for regulating and controlling the cell size of the escherichia coli specifically comprises the following steps: adding an inducer in the cell culture process, and regulating the concentration of the inducer to regulate the size of the escherichia coli cells; the Escherichia coli does not express a carbon storage regulatory factor, and overexpresses histidine analogues and green fluorescent protein; said non-expression comprises deletion or silencing; the inducer is anhydrous tetracycline; the amino acid sequence of the carbon storage regulator is consistent with the amino acid sequence coded by the Gene ID: 947176 on NCBI;

said application is to containphaA、phaB、phaCAnd transformation of plasmid of pct Gene intoE. coli JM109ΔCsrA pTetR/P_TET-competent cells of HNS-GFP; the overexpression adopts a tetracycline inducible promoter to transcribe a gene encoding the histidine analogue and green fluorescent protein fusion protein; the gene coding the fusion protein is connected to a pTetR vector for expression;

the concentration of the inducer is 100 ng/mL; the amino acid sequence of the fusion protein is shown as SEQ ID NO. 1.

2. The use of claim 1, wherein the E.coli comprises E.coli (E.coli: (E.coli) (E.coli))Escherichia coli）JM109。

3. The use of claim 1, wherein said non-expression of a carbon storage regulator is a knock-out of a carbon storage regulator using homologous recombination.