CN112980842A

CN112980842A - Non-coding nucleotide sequence and application thereof in improving expression level of exogenous gene

Info

Publication number: CN112980842A
Application number: CN202110133688.0A
Authority: CN
Inventors: 王芳; 武海军; 严丹侃; 周本国; 韩科雷; 董庆; 陈莹; 马超
Original assignee: INSTITUTE OF TOBACCO ANHUI ACADEMY OF AGRICULTURAL SCIENCES
Current assignee: INSTITUTE OF TOBACCO ANHUI ACADEMY OF AGRICULTURAL SCIENCES
Priority date: 2021-02-01
Filing date: 2021-02-01
Publication date: 2021-06-18
Anticipated expiration: 2041-02-01
Also published as: CN112980842B

Abstract

The invention discloses a non-coding nucleotide sequence and application thereof in improving the expression level of an exogenous gene, belonging to the technical field of biology.

Description

Non-coding nucleotide sequence and application thereof in improving expression level of exogenous gene

Technical Field

The invention relates to the field of biotechnology, in particular to a nucleotide sequence, and especially relates to a non-coding nucleotide sequence and application thereof in improving the expression level of exogenous genes.

Background

With the development of protein engineering, increasing the expression level of foreign genes can increase the production efficiency of proteins, and becomes the key point of research, and at present, increasing the expression level of foreign genes mainly includes: the method has the characteristics of high protein expression level, and is a mainstream method for improving the expression level of the exogenous gene at present.

The expression of fusion protein in vitro refers to the process of obtaining target protein by recombining two genes by DNA technology and then expressing, separating and purifying in vitro, and the transient expression system of plants is one of the most common technical methods for expressing fusion protein in vitro. The plant transient expression system is a technology for transferring a target gene into a target cell in a relatively short time and establishing a temporary efficient expression system in the cell to obtain the transient high-level expression of the target gene. However, in the prior art, the expression of the fusion protein in vitro is realized by using a plant transient expression system, and the expression level of the fusion protein is low and is subject to various defects, so that the expression level of the fusion protein is not one of the main methods for improving the expression level of the exogenous gene at present.

Disclosure of Invention

The invention aims to provide a non-coding nucleotide sequence and application thereof in improving the expression level of a foreign gene so as to solve the technical problem of low protein expression level when a plant transient expression system expresses fusion protein in vitro.

The invention is realized by the following technical scheme:

the invention finds that the 5 'non-coding sequence of the subgenomic of Maize yellow mosaic virus (Maize yellow mosaic virus) plays an important role in the regulation and control of genes, the 5' non-coding sequence of the subgenomic can influence the translation level of the genes by regulating and controlling the translation initiation process, and the 5 'non-coding sequence can be utilized to improve the expression level of exogenous genes by considering that the characteristics of the 5' non-coding sequence have the characteristic of regulating the expression of the genes. Based on the nucleotide sequence, the invention provides a non-coding nucleotide sequence which is derived from maize yellow mosaic virus and is shown as SEQ ID NO.1, and the total length of the nucleotide sequence is 75 bp.

The invention also provides the application of the non-coding nucleotide sequence in improving the expression level of exogenous genes in plants.

As a further optimization scheme of the invention, the method for improving the expression level of the exogenous gene in the plant body comprises the following steps: connecting the non-coding nucleotide sequence to the upstream of the start codon of the coding region of the foreign gene to construct a fusion fragment, connecting the fusion fragment to a plant expression vector, and introducing the plant expression vector into a plant body to realize the expression of the foreign gene in the plant body.

As a further optimization scheme of the invention, the plant is tobacco.

Compared with the prior art, the invention has the following advantages: the invention provides a non-coding nucleotide sequence and application thereof in improving the expression level of an exogenous gene, wherein the nucleotide sequence can obviously improve the expression level of the exogenous gene at the translation level, provides a new way for the over-expression of the exogenous gene, has obvious promotion effect on the expression of the protein coded by the exogenous gene and has stronger application value.

Drawings

FIG. 1 is a graph comparing the results of increasing the expression level of GFP in tobacco leaves after the non-coding nucleotide sequence of the present invention was ligated upstream of the start codon of GFP.

Detailed Description

Example 1

1. Material

The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used therein are commercially available products unless otherwise specified.

2. Method of producing a composite material

2.1 obtaining non-coding nucleotide sequences

(1) Extracting the corn total RNA infected with the corn yellow mosaic virus by a Trizol method, and performing reverse transcription to obtain cDNA.

(2) Carrying out PCR reaction by using the obtained cDNA as a template and a first primer pair shown in SEQ ID NO. 2-3;

SEQ ID NO.2：F1：ATACAGAAGCTTCGAAGATA

SEQ ID NO.3：R1：GGCTGCTTATGTGTGAGACT

the amplification system is as follows: 10 XEX Taq buffer 5. mu.l, 2.5mM dNTPs 5. mu.l, 10. mu. M P1 and P2 each 2. mu.l, EX Taq enzyme (5U/. mu.l) 1. mu.l (purchased from Takara, Inc., Dalton) and sterile water to make up 50. mu.l.

The amplification reaction conditions are as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 30s for 35 cycles; extension at 72 ℃ for 10 min.

The target product was obtained in a size of 75 bp.

(3) The PCR product was purified using Qiagen gel purification kit (Qiagen, Germany) and then used in Promega

TA cloning of the PCR fragment was carried out by T EASY Vector (Promega, USA) under the following conditions: 2 × Promega ligase buffer 5 μ l,

mu.l of-T EASY Vector, 2. mu.l of PCR-recovered fragment, 1. mu.l of Promega T4-ligase (Promega, USA), and 1. mu.l of sterile water, mixing, and reacting at 4 ℃ for 16 hours.

(4) After the reaction, 10. mu.l of the reaction solution was added to a centrifuge tube containing 100. mu.l of Escherichia coli competent cells, gently mixed on ice and left for 30min, heat-shocked at 42 ℃ for 90s, immediately left on ice for 2-3min, and then added to the centrifuge tube 890. mu.l of LB liquid medium. After shaking culture of the centrifuge tube on a shaker at 37 ℃ for 1 hour, 300. mu.l of the culture broth was applied to a solid LB medium containing 100mmol/L ampicillin, 1mmol/L IPTG and 10mg/L and cultured at 37 ℃ for 14 to 16 hours. White plaques were then selected for sequencing by the department of Ongji. Clones containing the inserted sequence were designated T-UTR.

2.2 construction of plant expression vectors

The obtained sequence is connected to the multiple cloning site of an entry vector pDONR221 (proetin biotechnology (Beijing) Co., Ltd.) by utilizing a molecular biology experimental technology, and a conventional plant expression vector is constructed, and the specific steps comprise:

(1) performing PCR amplification by using a second primer pair by using the T-UTR as a template, performing double digestion on a PCR amplification product and an entry vector pDOOR 221 by using restriction enzymes EcolRI and XbaI respectively, and connecting to construct and obtain an entry vector pDOOR 221 UTR; the second primer pair is as follows:

SEQ ID NO.4：F2：cccaagcttATGGTGAGCAAGGGCGAGGAGCT

SEQ ID NO.5：R2：gctctagaGGCTGCTTATGTGTGAGACT。

(2) connecting the entry vector pDOOR 221UTR to a plant expression vector pGWB451 (Proteine Biotechnology (Beijing) Co., Ltd.) by using LR reaction to obtain pGWB451 UTR; the empty vector pGWB451 was also used for LR reaction and for control.

2.3 expression of foreign genes

The pGWB451 obtained by the reaction of the pGWB451UTR and LR is transiently transformed into tobacco leaves, and the expression of GFP in the tobacco leaves is detected by a fluorescence microscope after 4 days, and the method comprises the following specific steps:

two plasmids transform agrobacterium GV3101, the concentration OD of the bacterial liquid₆₀₀When the concentration is 1, the mixture is centrifuged at 5000 rpm for 5min at 4 ℃, and the supernatant is removed to leave the cells. The thalli is mixed in an infection solution (10mM MES,200uM acetosyringone, 10mM magnesium chloride) and is kept still for 3 hours at room temperature for standby. Injecting the back of tobacco leaf of Benshi tobacco of 6-leaf stage with syringe without needle, injecting bacterial liquid between veins by pressure, and culturing tobacco at 22 deg.C for 4 days. The GFP green fluorescence intensity was observed using a fluorescence confocal microscope.

As a result, as shown in FIG. 1, it can be seen that the clarity of green fluorescence in tobacco leaves transformed with pGWB451UTR was significantly higher than that of the control pGWB451, indicating that the insertion of the nucleotide of the present invention directly increased the expression level of the exogenous GFP gene.

The above is a detailed embodiment and a specific operation process of the present invention, which are implemented on the premise of the technical solution of the present invention, but the protection scope of the present invention is not limited to the above-mentioned examples.

Sequence listing

<110> institute of tobacco research of agronomy academy of sciences of Anhui province

<120> a non-coding nucleotide sequence and its application in improving exogenous gene expression level

<141> 2021-02-01

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 75

<212> DNA

<213> Maize yellow mosaic Virus (Maize yellow mosaic virus)

<400> 1

atacagaagc ttcgaagata gccagacaca cgtgagttgc aagtgctgga atcttagtct 60

cacacataag cagcc 75

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 2

atacagaagc ttcgaagata 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence ()

<400> 3

ggctgcttat gtgtgagact 20

<210> 4

<211> 32

<212> DNA

<213> Artificial sequence ()

<400> 4

cccaagctta tggtgagcaa gggcgaggag ct 32

<210> 5

<211> 28

<212> DNA

<213> Artificial sequence ()

<400> 5

gctctagagt tcctagctct gcgtccat 28

<210> 6

<211> 31

<212> DNA

<213> Artificial sequence ()

<400> 6

cccaagctta tacagaagct tcgaagatag c 31

Claims

1. A non-coding nucleotide sequence, which is shown as SEQ ID NO. 1.

2. Use of the non-coding nucleotide sequence of claim 1 to increase the expression level of a foreign gene in a plant.

3. The use of a non-coding nucleotide sequence to increase the expression level of a foreign gene in a plant according to claim 2, wherein the method for increasing the expression level of a foreign gene in a plant comprises: connecting the non-coding nucleotide sequence to the upstream of the start codon of the coding region of the foreign gene to construct a fusion fragment, connecting the fusion fragment to a plant expression vector, and introducing the plant expression vector into a plant body to realize the expression of the foreign gene in the plant body.

4. The use of a non-coding nucleotide sequence according to claim 2 to increase the expression level of a foreign gene in a plant, wherein the plant is nicotiana tabacum.