CN110643729A - SNP molecular marker locus linked with content of gallocatechin gallate of tea tree and application thereof - Google Patents
SNP molecular marker locus linked with content of gallocatechin gallate of tea tree and application thereof Download PDFInfo
- Publication number
- CN110643729A CN110643729A CN201910834182.5A CN201910834182A CN110643729A CN 110643729 A CN110643729 A CN 110643729A CN 201910834182 A CN201910834182 A CN 201910834182A CN 110643729 A CN110643729 A CN 110643729A
- Authority
- CN
- China
- Prior art keywords
- content
- gallocatechin gallate
- molecular marker
- tea tree
- tea
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SNP molecular marker locus linked with the content of tea tree Gallocatechin gallate (GCG) and application thereof, and discovers the SNP molecular marker locus which is positioned on a tea tree genome Scaffold441:849397 and is related to the content of the tea tree Gallocatechin gallate for the first time, wherein the genotype of the SNP molecular marker locus is remarkably related to the content of the Gallocatechin gallate. A detection method for detecting the locus is further established, can be used for evaluating the content of gallocatechin gallate of tea trees, is further used for screening high GCG (gallocatechin gallate) tea tree resources and molecular breeding, and has great research value.
Description
Technical Field
The invention relates to the technical field of molecular genetic breeding, in particular to an SNP molecular marker locus linked with the content of tea tree Gallocatechin gallate (Gallocatechin gallate) and application thereof.
Background
Tea (Camellia sinensis (L.) o.kuntze) belongs to the group of Camellia genus tea of the family theaceae, originated in the southwest region of china, with a cultivation history of over 5000 years to date. The tea leaves, coffee and cocoa are called three kinds of non-alcoholic beverages in the world, have important economic value and have important influence on society and culture.
The characteristic secondary metabolite catechin compound in the tea tree sprout is the main influencing factor of tea flavor. The catechin compounds are derivatives of 2-phenylbenzopyran, belong to flavan-3-alcohols in flavonoid compounds and account for 12-24% of dry weight of tea leaves. Catechins can be classified into C (Catechin), cat echin, GC (gallocatechin ), EGC (epigallocatechin, epigallocatechin), EC (epicatechin ), EGCG (epigallocatechin gallate, epigallocatechin-3-gate), GCG (Catechin gallate, gallocatechin gate), ECG (epicatechin gallate, epicatechin-3-gate), and CG (Catechin gallate, cathechin gate), which are related to the bitter taste of tea soup, depending on the number of hydroxyl groups in the B ring, isomers at the 2,3 positions of the C ring, and whether a galloyl group is attached to the 3 position of the C ring.
The secondary metabolite of the tea not only influences the quality of the tea, but also has various physiological functions. The gallocatechin gallate is a phenolic acid compound, can obviously inhibit the melanin generation of B16 cells and the activity of tyrosinase, is in a dose-dependent relationship, can inhibit the melanin generation through various ways, and has good application prospect in the fields of health care products and skin care products.
At present, tea tree breeding is mainly carried out by a conventional method, and a superior single plant is selected from a wild population and filial generations for systematic breeding. The method has long time and low efficiency, so that the new species is slowly updated, and the requirement of the public on the new species cannot be quickly met. The molecular marker assisted breeding can obviously improve the breeding efficiency because the breeding material can be selected in the seedling stage.
The discovery of molecular markers closely linked with the excellent properties of tea trees is the basis for developing molecular marker-assisted selective breeding of tea trees, but at present, due to the limitation of the progress of the traditional QTL positioning research, SNP molecular marker loci influencing the content of gallocatechin gallate cannot be found.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides an SNP molecular marker locus linked with the content of tea tree gallocatechin gallate and application thereof.
The first purpose of the invention is to provide a molecular marker linked with the quantitative character of the gallocatechin gallate content of tea trees.
The second purpose of the invention is to provide the application of the molecular marker in evaluating the content of the tea tree gallocatechin gallate.
The third purpose of the invention is to provide the primer of the molecular marker.
The fourth purpose of the invention is to provide the application of the primer in evaluating the content of the tea tree gallocatechin gallate.
The fifth purpose of the invention is to provide a kit for evaluating the content of the gallocatechin gallate of the tea tree.
The sixth purpose of the invention is to provide a method for evaluating the content of the gallocatechin gallate of the tea tree.
The seventh purpose of the invention is to provide the application of the molecular marker SNP locus, the primer or the kit in molecular assisted breeding.
In order to achieve the purpose, the invention is realized by the following technical scheme:
the inventor finds out a SNP locus molecular marker linked with Gallocatechin gallate (GCG) through long-term exploratory research. Further, a detection method for detecting the locus is established by utilizing the site, and the method can be used for evaluating the content of gallocatechin gallate of tea trees so as to be further used for resource screening and molecular breeding.
Therefore, the invention claims a molecular marker linked with the quantitative character of the gallocatechin gallate content of tea trees, wherein the molecular marker is positioned at the SNP site of the Scaffold441:849397 of the genome of the tea trees, namely the 501 th base of the nucleotide sequence shown by SEQ ID NO. 1.
The tea tree genome Scaffold441:849397 has a C or T locus, the genotype of the tea tree genome is very obviously related to the content of gallocatechin gallate in tea tree dry matter, and correlation analysis and significance verification show that the content of gallocatechin gallate in tea soup dry matter corresponding to the TT genotype sample is very obviously different from that of CC and CT genotype samples. Statistically judging that when the genotype of the sample is double mutation TT, the genotype of the dried substances in the tea tree, the genotype of which the content of the gallocatechin gallate is high and the probability is higher than the normal average level, is a wild type CC or single mutation CT sample.
The content of the tea tree gallocatechin gallate is specifically the proportion of the dry matter gallocatechin gallate of the fresh tea leaves.
The application of the molecular marker SNP locus in evaluating the content of the tea tree gallocatechin gallate also belongs to the protection scope of the invention.
The invention also requires a primer for detecting the molecular marker, wherein the nucleotide sequence of the primer is shown as SEQ ID NO. 2-3.
And (3) primer F: TGTTGACAATAGCCCTGGAG (SEQ ID NO: 2);
and (3) primer R: CAAGGATCTTACAGTTGCGG (SEQ ID NO: 3).
The application of the primer in evaluating the content of the tea tree gallocatechin gallate also belongs to the protection scope of the invention.
Further, the invention claims a kit for evaluating the content of the gallocatechin gallate of the tea tree, which comprises a reagent for detecting the molecular marker SNP locus.
Preferably, the reagent is the primer, and the nucleotide sequence of the primer is shown as SEQ ID NO. 2-3.
Most preferably, the kit contains a primer with a nucleotide sequence shown as SEQ ID NO. 2-3, 2 xTaq PCR Master Mix, ddH2O。
The using method comprises the following steps:
(1) extracting total DNA of tea tree tender shoots by adopting a CTAB method, and ensuring that A260/A280 of each DNA sample is between 1.8 and 2.0 and the concentration is more than 100 mu g/mu L;
(2) PCR amplification
The PCR system (10. mu.l) was as follows:
| 2×Taq PCR Master Mix | 5μl |
| primer and method for producing the same | 0.5. mu.l each |
| DNA template | 1μl |
| ddH2O | 3μl |
The PCR amplification procedure was as follows:
(3) purification of the product
The PCR amplification product was subjected to gel electrophoresis, followed by recovery and purification using a commercially available gel electrophoresis DNA recovery kit.
(4) Sequencing and interpretation of results
And (3) sending the recovered and purified product to a sequencing company for Sanger method sequencing, and statistically judging that when the genotype of the sample is double-mutation TT, the genotype of the tea tree with the gallocatechin gallate content which is higher than the normal average level in a large probability is the wild-type CC or single-mutation CT sample.
Meanwhile, the invention claims a method for evaluating the content of gallocatechin gallate of tea trees, which detects the genotype of the molecular marker SNP locus.
Preferably, the primer is used for detecting the genotype of the molecular marker SNP locus.
The molecular marker, the primer, the kit or the application of the kit in molecular assisted breeding or tea quality evaluation also belong to the protection scope of the invention.
Compared with the prior art, the invention has the following beneficial effects:
the invention discovers the SNP molecular marker loci related to the content of the tea tree gallocatechin gallate for the first time, the SNP molecular marker loci are positioned on the tea tree genome Scaffold441:849397, the genotype of the SNP molecular marker loci is very obviously related to the content of the gallocatechin gallate, and the content of the gallocatechin gallate in tea soup dry matter corresponding to a TT genotype sample is very obviously different from that of CC and CT genotype samples. Statistically judging that when the genotype of the sample is double mutation TT, the genotype of the dried substances in the tea tree, the genotype of which the content of the gallocatechin gallate is high and the probability is higher than the normal average level, is a wild type CC or single mutation CT sample. A detection method for detecting the locus is further established, and the method can be used for evaluating the content of gallocatechin gallate of tea trees so as to be further used for tea tree resource screening and molecular breeding. The method is the basis for developing molecular marker-assisted selective breeding of tea trees and has great research value.
Drawings
FIG. 1 shows the gallocatechin gallate content of the population used for the whole genome correlation analysis in different seasons.
FIG. 2 is a schematic diagram of the sites of Scaffold441:849397 and primers, wherein N represents the base to be detected at the position of Scaffold441:849397, and the bold and underlined parts are the upstream and downstream primers.
FIG. 3 shows the sequencing results (reverse complement) of the genotypes of samples 2-71 at the Scaffold441: 849397.
FIG. 4 shows the sequencing results (reverse complement) of the genotypes of samples 2-97 at the Scaffold441: 849397.
FIG. 5 shows the sequencing results (reverse complement) of the genotypes of samples 2-87 at the Scaffold441: 849397.
Detailed Description
The invention is described in further detail below with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.
Example 1
First, experiment sample
191 parts of tea plant materials in a tea plant germplasm resource library (Guangdong, Engde, 113.3OE,24.3ON) in Guangdong province are collected, wherein 124 parts of Guangdong, 20 parts of Fujian, 15 parts of Guangxi, 9 parts of Zhejiang, 6 parts of Hunan, 6 parts of Yunnan, 1 part of Jiangxi, 1 part of Guizhou and 1 part of Taiwan are collected. In addition, 8 kenya tea progeny, 1 grurgia progeny, the material selected is broadly representative.
The selected resources are randomly distributed in the resource library. Double-row single-plant planting is adopted, each row is 4m, the row spacing is 1.5m, and the plant spacing is 35 cm. And performing conventional water and fertilizer management on the resource library. The resources are trimmed at the end of 2016 years and base fertilizer is applied in deep pits, 4 tons of organic fertilizer, 0.75 ton of peanut bran and 10 jin of compound fertilizer are applied per mu. And (3) pruning and topdressing 30 jin of compound fertilizer and 60 jin of urea per mu after the spring tea and summer tea in 2017. Picking young sprout of tea tree with two leaves at 15 days in 3 months, 25 days in 6 months and 28 days in 9 months in 2017, making steamed green sample, and preparing tea soup by water extraction method.
Analysis of phenotypic data
1. Experimental procedure
Detecting gallocatechin gallate (GCG) related to tea tree taste in the tea soup by high performance liquid chromatography, and detecting with national standard method.
Analyzing the index size range, the average value, the standard deviation and the variation coefficient of the content of the gallocatechin gallate by using SPSS software. Quantitative traits were ranked into 10 grades with 0.5 standard deviation for calculation of the Shannon-Wiener diversity index for traits. The Best Linear Unbiased Prediction (BLUP) method is used, a one-year multipoint model is adopted to estimate the breeding value, and the generalized heritability is estimated at the same time.
2. Results of the experiment
The content of gallocatechin gallate is shown in Table 1.
Table 1 percentage of dry matter of different resources GCG for different quarters:
the variation of the gallocatechin gallate content of the population is shown in Table 2 and FIG. 1.
TABLE 2 phenotypic variation of the GCG trait (gallocatechin gallate content):
third, genotype and character correlation analysis
1. Experimental procedure
Extracting total DNA of 191 tea tree resource tender shoots by adopting a CTAB method, and ensuring that A260/A280 of each DNA sample is between 1.8 and 2.0 and the concentration is more than 100 mu g/mu L. And (3) detecting the genotypes of the SNP loci (Scaffold441:849397) respectively positioned in the genome (http:// tpia. teaplnt. org/index. html) of the tea tree of the Shucha' CSS cultivar by using the extracted DNA sample, carrying out association analysis on the characters and the markers, judging the significance level of the association by using the P value, and judging the significance level when the P value is less than 1.25E-05.
2. Results of the experiment
The P values of the SNP sites in different seasons are shown in Table 3.
Table 3: different seasons, scuffold 441: p value at position 849397
Example 2 validation of molecular markers in another population
First, experiment method
The SNP site located in Scaffold441:849397 was verified in another population containing 98 germplasm.
1. Detecting the content of gallocatechin gallate in each sample. The specific detection method was the same as in example 1.
2. The SNP loci of Scaffold441:849397 of each sample are detected by using a SnaPShot technology platform.
After the method designs primers with different lengths for different mutation sites to carry out the SNaPshot reaction, products can detect a plurality of SNP sites in one sequencing reaction through electrophoretic separation, five-color fluorescence detection and Gene mapper analysis. Site-directed sequence analysis was performed using the SNaPshot, the basic principle of which followed the dideoxy termination method in direct DNA sequencing, except that only different fluorescently labeled ddNTPs were present in the PCR reaction. Since the 3' end of the primer at each SNP site is located close to the SNP site, each primer is extended by a polymerase by only one nucleotide depending on the sequence of the template. The type of nucleotide that is extended is then detected using an advanced fluorescence detection system.
(1) Primer design
Primers were designed and synthesized at genomic positions according to Scaffold441: 849397. Wherein, the upstream and downstream of the Scaffold441:849397 are extended by 500bp respectively. The nucleotide sequence is shown as SEQ ID NO:1 (FIG. 2, wherein N represents a base to be detected at the position of Scaffold441: 849397).
PCR primers:
F：TGTTGACAATAGCCCTGGAG(SEQ ID NO:2)；
R：CAAGGATCTTACAGTTGCGG(SEQ ID NO:3)。
single base extension primer:
gactgactgactgactgtAAAGCAGCAGTCAAGCGGCTTTC。
(2) PCR amplification
The PCR system (10. mu.l) was as follows:
| 2×Taq PCR Master Mix | 5μl |
| PrimerMix (ratio according to amplification) | 1μl |
| DNA template | 1μl |
| ddH2O | 3μl |
The PCR amplification procedure was as follows:
(3) PCR product purification
Purification was performed using shrimp alkaline enzyme purification. The main functional components of shrimp alkaline enzyme MIX (EX-SAP) are SAP and ExoI.SAP enzyme, which can dephosphorize residual dNTPs and ExoI degrade free single-stranded primers. Mu.l of the PCR product was taken and 2. mu.l of EX-SAP enzyme was added. The specific reaction system is as follows:
| digestive system Components | Volume (μ l) |
| ddH2O | 0.75 |
| SAP(1U/μl) | 0.5 |
| ExoI(5U/μl) | 0.15 |
| 10*SAPbuffer | 0.6 |
| PCR product | 4 |
| |
6 |
Digestion incubation was then performed on a PCR instrument: at 37 ℃ for 40min, at 85 ℃ for 5min, at 4 ℃ for forever.
(4) SnaPshot reaction
The PCR product was used as a template for the SNaPshot reaction.
The SNaPshot reaction system is shown below:
| reagent | Dosage (mu l) |
| SNaPshot Mix | 0.5 |
| Pooled PCR Products | 3 |
| Pooled Primers | 1 |
| dH2O | 0.5 |
| Total volume | 5 |
The SNaPshot reaction procedure was:
then, the SNaPshot product was purified, and 2ul of SAP mix was directly added to the SNaPshot reaction product, and the specific reaction system was as follows:
| components | Volume (μ L) |
| Water (W) | 0.9 |
| SAP(1U/ul) | 0.5 |
| 10*SAP buffer | 0.6 |
| Total of | 2 |
The SNaPshot product digestion reaction was performed on a PCR instrument with the following reaction program: at 37 ℃ for 40min, at 75 ℃ for 15min, at 4 ℃ for forever.
(5) Detection on machine
mu.L of digested SNaPshot reaction product was added to 8. mu.L of deionized formamide containing 0.4% LIZ120, denatured at 95 ℃ for 5min, quenched at-20 ℃ and sequenced on 3730 XL.
(6) Analysis of results
The fsa results obtained by GeneMarker analysis were used to derive peak maps and table files, and to calculate the SNP mutants for each sample.
Second, experimental results
The gallocatechin gallate content of each sample and the genotype of the SNP site of Scaffold441:849397 are shown in Table 3, and the sequencing results of some samples of SNaPshot are shown in FIGS. 3 to 5.
Table 3 verifies the content of GCG on dry matter and the genotype of the resource in the population:
the significant analysis result shows that the genotype of the Scaffold441:849397 is very significantly related to the content of the gallocatechin gallate, the correlation coefficient is 0.53, and the p-value is 6.96 multiplied by 10-6The F value (6.91/3.94) is 22.6, the mutation is invisible, and the content of gallocatechin gallate in the tea soup dry matter corresponding to the genotype of the TT genotype sample is very different from that of the CC and CT genotype samples. Statistically judging that when the genotype of the sample is double mutation TT, the content of gallocatechin gallate in the dry matter of the tea tree is approximateGenotypes with higher than normal mean levels are samples of wild type CC or single mutation CT.
Example 3A kit for evaluating the content of gallocatechin gallate of tea tree
A, make up
The nucleotide sequence of the primer is shown as SEQ ID NO 2-3, 2 XTaq PCR Master Mix, ddH2O。
Wherein, the primer F: TGTTGACAATAGCCCTGGAG (SEQ ID NO: 2);
and (3) primer R: CAAGGATCTTACAGTTGCGG (SEQ ID NO: 3).
Second, use method
(1) Extracting total DNA of tea tree tender shoots by adopting a CTAB method, and ensuring that A260/A280 of each DNA sample is between 1.8 and 2.0 and the concentration is more than 100 mu g/mu l;
(2) PCR amplification
The PCR system (10. mu.l) was as follows:
| 2×Taq PCR Master Mix | 5μl |
| primer and method for producing the same | 0.5. mu.l each |
| DNA template | 1μl |
| ddH2O | 3μl |
The PCR amplification procedure was as follows:
(3) purification of the product
The PCR amplification product was subjected to gel electrophoresis, followed by recovery and purification using a commercially available gel electrophoresis DNA recovery kit.
(4) Sequencing and interpretation of results
And (3) sending the recovered and purified product to a sequencing company for sequencing by a Sanger method, and comparing the sequencing result with the sequence shown in SEQ ID NO:1, and the sites of the Scaffold441:849397 are located at the 102bp position of the amplified product according to the sequence shown in FIG. 2 (the bold and underlined parts are the upstream and downstream primers). Statistically judging that when the genotype of the sample is double mutation TT, the genotype of the dried substances in the tea tree, the genotype of which the content of the gallocatechin gallate is high and the probability is higher than the normal average level, is a wild type CC or single mutation CT sample.
Example 4 application of kit for evaluating content of gallocatechin gallate of tea tree
First, experiment method
98 tea plant specimens from example 2 were tested using the kit of example 3.
Second, experimental results
The detection result is consistent with that of the embodiment 2 adopting a SnaPShot technology platform, and the kit can be used for evaluating the content of the tea tree gallocatechin gallate.
Sequence listing
<110> institute of tea leaf of academy of agricultural sciences of Guangdong province
<120> SNP molecular marker locus linked with content of gallocatechin gallate of tea tree and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1001
<212> DNA
<213> Camellia sinensis
<400> 1
ctcctaccag tgagaagctc gagaagcacg acaccgaagc tataaacgtc acccttgaaa 60
gtggccgtca atgtctgact atattcagga ggaatatacc ctaatgtccc caccaaatct 120
gtcgttacat gggtatcgta agggtgaagc aaccttgaga gaccaaaatc tgctaaatga 180
gcttcgaatt tttcatccaa caaaatgtta ctagttttta tgtctctatg aattatattt 240
ggctccttat gcaagtaagc caagccatga ccggctcctt gagctatctt cagcctcgtg 300
tcccacctaa gaagcgaacc cccatcaacc cgctcatgta gccaataatc caagcttcca 360
ttctccatat atgagtaaat caataacctg tcatttccat gttgacaata gccctggaga 420
gaaacaaggt ttcgatgctg agctcttgag agagcttcca cttcagcttg gaattcacgt 480
tccatctgcc cgcaatcccc ngaaagccgc ttgactgctg ctttcacgcc attgggaagg 540
ttggctttgt aaaccaggcc aaatcctcca cacccaatta tgtttgcctg gttaaaattg 600
cccgtggatt tcaacaactc cgcaactgta agatccttgc attccgagtt ctgaaaaagc 660
actaattttg aatacccgag cgcttcggat aacctatgtg gcctcccggt ttcttcatcc 720
aaattttcaa ctacatctcc aacacccctc cttgacattt tgagcataac aatggccacg 780
agcactgcaa tggcaactcc tacactgata gtgattccaa agatgctgct tcgaccaaat 840
ttgctatttg aaccagatga gatagcgggt tgagtcccca tattattaat agctctacaa 900
ggggagtcta ttgtcccgca aagtccagga ttaccctcaa agcttgatcc aggaaagctc 960
aagaactgac ccccggttgg aattgcaccc cgcaaatgat t 1001
<210> 2
<211> 20
<212> DNA
<213> Camellia sinensis
<400> 2
tgttgacaat agccctggag 20
<210> 3
<211> 20
<212> DNA
<213> Camellia sinensis
<400> 3
caaggatctt acagttgcgg 20
Claims (8)
1. A molecular marker linked with the quantitative character of the gallocatechin gallate content of tea trees is characterized in that the molecular marker is positioned at an SNP site of a Scaffold441:849397 genome of the tea trees, namely the 501 th base of a nucleotide sequence shown as SEQ ID NO. 1.
2. Use of the molecular marker of claim 1 for evaluating the content of gallocatechin gallate of tea tree.
3. The primer for detecting the molecular marker of claim 1, wherein the nucleotide sequence is shown as SEQ ID NO 2-3.
4. Use of the primer according to claim 3 for evaluating the content of tea tree gallocatechin gallate.
5. A kit for evaluating the content of gallocatechin gallate, which comprises a reagent for detecting the molecular marker SNP site as claimed in claim 1.
6. The kit according to claim 5, wherein the reagent is the primer according to claim 3.
7. A method for evaluating the content of gallocatechin gallate, which is characterized in that the genotype of the molecular marker SNP site as claimed in claim 1 is detected.
8. Use of the molecular marker of claim 1, the primer of claim 3, or the kit of claim 5 for molecular assisted breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910834182.5A CN110643729B (en) | 2019-09-04 | 2019-09-04 | SNP molecular marker locus linked with content of gallocatechin gallate of tea tree and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910834182.5A CN110643729B (en) | 2019-09-04 | 2019-09-04 | SNP molecular marker locus linked with content of gallocatechin gallate of tea tree and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110643729A true CN110643729A (en) | 2020-01-03 |
| CN110643729B CN110643729B (en) | 2020-09-18 |
Family
ID=69010037
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910834182.5A Active CN110643729B (en) | 2019-09-04 | 2019-09-04 | SNP molecular marker locus linked with content of gallocatechin gallate of tea tree and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110643729B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106676102A (en) * | 2017-02-23 | 2017-05-17 | 中国林业科学研究院亚热带林业研究所 | Single nucleotide polymorphism (SNP) molecular marker related to content of arachidonic acid in grease of camellia oleifera seeds, and application of SNP molecular marker |
| CN106755308A (en) * | 2016-11-22 | 2017-05-31 | 中国农业科学院茶叶研究所 | Screen the '-hydroxylase gene functional label of flavonoids 3 ', 5 ' and its application, application process of dihydroxy catechin tea tree high |
| CN106755528A (en) * | 2017-02-23 | 2017-05-31 | 中国林业科学研究院亚热带林业研究所 | A kind of SNP marker related to Seed of Camellia oleifera oil content and its application |
| CN106868132A (en) * | 2017-02-23 | 2017-06-20 | 中国林业科学研究院亚热带林业研究所 | Palmitic acid, oleic acid, linolenic acid content are related in a kind of grease to Seed of Camellia oleifera SNP marker and its application |
| CN108220467A (en) * | 2016-12-19 | 2018-06-29 | 深圳华大生命科学研究院 | Molecular labeling and its application |
-
2019
- 2019-09-04 CN CN201910834182.5A patent/CN110643729B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106755308A (en) * | 2016-11-22 | 2017-05-31 | 中国农业科学院茶叶研究所 | Screen the '-hydroxylase gene functional label of flavonoids 3 ', 5 ' and its application, application process of dihydroxy catechin tea tree high |
| CN108220467A (en) * | 2016-12-19 | 2018-06-29 | 深圳华大生命科学研究院 | Molecular labeling and its application |
| CN106676102A (en) * | 2017-02-23 | 2017-05-17 | 中国林业科学研究院亚热带林业研究所 | Single nucleotide polymorphism (SNP) molecular marker related to content of arachidonic acid in grease of camellia oleifera seeds, and application of SNP molecular marker |
| CN106755528A (en) * | 2017-02-23 | 2017-05-31 | 中国林业科学研究院亚热带林业研究所 | A kind of SNP marker related to Seed of Camellia oleifera oil content and its application |
| CN106868132A (en) * | 2017-02-23 | 2017-06-20 | 中国林业科学研究院亚热带林业研究所 | Palmitic acid, oleic acid, linolenic acid content are related in a kind of grease to Seed of Camellia oleifera SNP marker and its application |
Non-Patent Citations (1)
| Title |
|---|
| EN-HUAXIA ET AL.: "Tea Plant Information Archive: a comprehensive genomics and bioinformatics platform for tea plant", 《PLANT BIOTECHNOLOGY JOURNAL》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110643729B (en) | 2020-09-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhou et al. | Development and cross-species transferability of EST-SSR markers in Siberian wildrye (Elymus sibiricus L.) using Illumina sequencing | |
| CN111961750A (en) | KASP primer for detecting tomato yellow leaf curl virus disease resistance gene Ty-1 and application thereof | |
| CN105087768B (en) | A kind of method of the anti-bean weevil kind of molecular marking supplementary breeding mung bean | |
| CN110760603B (en) | Molecular marker locus linked with theanine content of tea tree and application thereof | |
| CN110551844B (en) | Sugarcane cultivar genome SSR molecular marker development method and application | |
| CN110819731B (en) | SNP molecular markers linked with (+) -catechin content of tea tree and application thereof | |
| CN110714092B (en) | Molecular marker locus located in flavonol synthetase gene and linked with (+) -catechin content of tea tree and application thereof | |
| CN110734996B (en) | Molecular markers linked with caffeine content of tea tree and application thereof | |
| CN111154890A (en) | CYP3A2 gene as molecular marker for drug resistance detection of homozokor, primer, preparation method and application thereof | |
| CN113046467B (en) | SNP locus obviously associated with wheat stripe rust resistance and application thereof in genetic breeding | |
| CN110408723B (en) | SNP molecular marker linked with caffeine content of tea tree and application thereof | |
| CN110468231B (en) | Group of molecular markers linked with (+) -catechin content of tea trees and application thereof | |
| CN110643729B (en) | SNP molecular marker locus linked with content of gallocatechin gallate of tea tree and application thereof | |
| CN110607383B (en) | Molecular marker locus linked with tea tree epicatechin content and application thereof | |
| CN110438256B (en) | Molecular marker locus linked with epigallocatechin gallate content of tea tree and application thereof | |
| CN110438255B (en) | Molecular marker locus linked with tea tree epicatechin gallate content and application thereof | |
| CN110468230B (en) | Molecular marker locus linked with tea tree secondary metabolite content and located on receptor-like protein kinase gene and application thereof | |
| CN105420354B (en) | Conventional rice variety Huaihe River rice No. 5 and Huaihe River rice No. 18 identification methods based on InDel label | |
| CN110835653B (en) | Molecular marker site located on ABC transporter gene and linked with (+) -catechin content of tea tree and application thereof | |
| CN110885893B (en) | Molecular marker locus located on WD-repetitive protein gene and linked with tea tree epicatechin content and application thereof | |
| Zhang et al. | A genetic diversity analysis of wild Lespedeza populations based on morphological characters, allozyme and RAPD methods | |
| CN105483281A (en) | SNP molecular marker for identifying Shanghai colorful waxy corn NO.1 and identifying method thereof | |
| CN116445657B (en) | ISSR-PCR reaction system for garlic fruits, marking method and application | |
| WO2021042448A1 (en) | Molecular marker combination for quantity trait linkage of caffeine content in tea tree | |
| WO2021042449A1 (en) | Molecular marker combination having quantitative trait linkage with tea tree (+)- catechin content |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |