CN110734996B

CN110734996B - Molecular markers linked with caffeine content of tea tree and application thereof

Info

Publication number: CN110734996B
Application number: CN201910833668.7A
Authority: CN
Inventors: 方开星; 吴华玲; 王秋霜; 李波; 潘晨东; 秦丹丹; 李红建; 姜晓辉
Original assignee: Tea Research Institute Guangdong Academy of Agricultural Sciences
Current assignee: Tea Research Institute Guangdong Academy of Agricultural Sciences
Priority date: 2019-09-04
Filing date: 2019-09-04
Publication date: 2020-09-08
Anticipated expiration: 2039-09-04
Also published as: CN110734996A

Abstract

The invention discloses a group of molecular markers linked with the content of Caffeine (CAFFein, CAF) of tea trees and application thereof, and discovers that the molecular markers are positioned on the genome of tea trees and are Scaffold 3614: 66549. scaffold 349: 3413816 and Scaffold 920: 281727, the genotype of the SNP molecular marker locus related to the caffeine content of tea trees is very obviously related to the caffeine content. The detection method for detecting each site is further established, and the caffeine content of the tea tree can be evaluated by using one or more molecular marker sites, so that the method is further used for screening high-caffeine tea tree resources and molecular breeding and has great research value.

Description

Molecular markers linked with caffeine content of tea tree and application thereof

Technical Field

The invention relates to the technical field of molecular genetic breeding, in particular to a group of molecular markers linked with the content of Caffeine (CAF) of tea trees and application thereof.

Background

Tea (Camellia sinensis (L.) o.kuntze) belongs to the group of Camellia genus tea of the family theaceae, originated in the southwest region of china, with a cultivation history of over 5000 years to date. The tea leaves, coffee and cocoa are called three kinds of non-alcoholic beverages in the world, have important economic value and have important influence on society and culture.

The characteristic secondary metabolite caffeine in tea tree fresh tea is one of main influencing factors of tea flavor. The caffeine is an alkaloid with high content in tea, the content is generally 2-5%, and each 150ml of tea soup contains about 40mg of caffeine. Caffeine is a central nervous stimulant and thus has a refreshing effect; in addition, the caffeine also has the effects of enhancing physical strength, perseverance and durability, and researches show that the caffeine can enhance the activity of muscles, particularly muscles of upper limbs; the caffeine can also promote metabolism, and when 200m g caffeine is ingested, the metabolism rate can be improved by 7% in the next 3 hours, and the fat burning rate can be greatly improved; caffeine can aid in pain relief because it can accelerate the onset of other pain relief medications; caffeine has the effect of improving oxidation resistance, and caffeine can double the effect of antioxidant phenols.

However, some people are very sensitive to caffeine, even a small amount of caffeine can cause serious insomnia, accelerated heartbeat and increased blood pressure, and the probability of myocardial infarction after excessive caffeine intake is higher.

The existing research shows that caffeine is different among different producing areas and different varieties. In order to meet the requirements of different crowds, tea trees with different caffeine contents need to be cultivated. Meanwhile, because of the importance of the caffeine on the quality and physiological function of the tea, the method has important significance in breeding tea tree varieties with specific caffeine content. At present, tea tree breeding is mainly carried out by a conventional method, and a superior single plant is selected from a wild population and filial generations for systematic breeding. The method has long time and low efficiency, so that the new species is slowly updated, and the requirement of the public on the new species cannot be quickly met. The molecular marker assisted breeding can obviously improve the breeding efficiency because the breeding material can be selected in the seedling stage. The discovery of molecular markers closely linked with the excellent properties of tea trees is the basis for developing molecular marker-assisted selective breeding of tea trees.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a group of molecular markers linked with the caffeine content of tea trees and application thereof.

The invention aims to provide a molecular marker combination linked with the quantitative character of the caffeine content of tea trees.

The second purpose of the invention is to provide the application of the molecular marker combination or any one or two of the molecular markers in evaluating the caffeine content of tea trees.

The third purpose of the invention is to provide the application of the molecular marker combination or the primer of any one or two molecular markers in the molecular marker combination in the evaluation of the caffeine content of tea trees.

The fourth purpose of the invention is to provide a primer for detecting the SNP site 1.

The fifth object of the present invention is to provide a primer for detecting the SNP site 2.

The sixth purpose of the present invention is to provide a primer for detecting the SNP site 3.

The seventh purpose of the invention is to provide a kit for evaluating the caffeine content of tea trees.

An eighth object of the present invention is to provide a method for evaluating the caffeine content of tea trees.

The ninth purpose of the invention is to provide the application of the molecular marker combination or any one or more molecular markers in the molecular marker combination, the primer or one or more of the kits in molecular assisted breeding.

In order to achieve the purpose, the invention is realized by the following technical scheme:

the inventor discovers three molecular markers of SNP sites linked with caffeine through long-term exploratory research. The method can be further used for establishing a detection method for detecting the locus, and can be used for evaluating the caffeine content of tea trees so as to be further used for resource screening and molecular breeding.

Therefore, the invention claims a molecular marker combination linked with the quantitative character of the caffeine content of tea trees, which comprises SNP loci 1, 2 and 3 which are respectively positioned in the Scaffold3614 of the genome of the tea trees: 66549. scaffold 349: 3413816 and Scaffold 920: 281727, i.e., the 501 th base of the nucleotide sequence shown by SEQ ID NO. 1, the 501 th base of the nucleotide sequence shown by SEQ ID NO. 4 and the 501 th base of the nucleotide sequence shown by SEQ ID NO. 7.

SNP site 1 is located in the tea tree genome Scaffold 3614: 66549 (501 th base of the nucleotide sequence shown in SEQ ID NO: 1), the site is C or T, the genotype is significantly related to the caffeine content in tea tree dry matter, and correlation analysis and significance verification show that the caffeine content in tea soup dry matter corresponding to CC genotype sample is significantly different from that in TT and CT genotype sample. Statistically, when the genotype is double-mutation CC, the genotype with caffeine content lower than the normal average level in the dry matter of the tea tree is a sample of wild type TT or single-mutation CT.

SNP site 2 is located in the tea tree genome Scaffold 349: 3413816 (namely the 501 th base of the nucleotide sequence shown in SEQ ID NO: 4), the site is G or A, the genotype is very obviously related to the caffeine content in tea dry matter, and correlation analysis and significance verification show that the caffeine content in tea dry matter corresponding to GG genotype sample is very different from that in GA and AA genotype sample. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

SNP site 3 is located in the tea tree genome Scaffold 920: 281727 (namely the 501 th base of the nucleotide sequence shown in SEQ ID NO: 7), the site is G or A, the genotype is very obviously related to the caffeine content in the tea tree dry matter, and correlation analysis and significance verification show that the caffeine content in the tea soup dry matter corresponding to the GG genotype sample is very different from that in the GA and AA genotype samples. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

The content of the caffeine of the tea trees is specifically the proportion of the caffeine of the dry matter of the fresh tea leaves.

The application of the molecular marker combination or any one or two of the molecular markers in evaluating the caffeine content of the tea tree also belongs to the protection scope of the invention.

The invention also claims application of the molecular marker combination or primers of any one or two molecular markers in the molecular marker combination in evaluation of the caffeine content of tea trees.

The nucleotide sequence of the primer of the SNP site 1 is shown as SEQ ID NO: 2 to 3.

And (3) primer F: GATGACACAACCCTCATCTG (SEQ ID NO: 2);

and (3) primer R: AATGTATGCCCGGTAAGGAC (SEQ ID NO: 3).

The nucleotide sequence of the primer of the SNP site 2 is shown as SEQ ID NO: 5 to 6.

And (3) primer F: TCTCTGCACTGTTGTCACTC (SEQ ID NO: 5);

and (3) primer R: CACCACACTTTCTTAGAAGG (SEQ ID NO: 6).

The nucleotide sequence of the primer of the SNP locus 3 is shown as SEQ ID NO: 8 to 9.

And (3) primer F: TTCGCATTCGTCCTTTTGGG (SEQ ID NO: 8);

and (3) primer R: ACGTGCTACATTCTCCATCC (SEQ ID NO: 9).

Further, the invention claims a kit for evaluating the content of Caffeine (CAFFEIne, CAF) of tea trees, which comprises a reagent for detecting the molecular marker combination or any one or more molecular markers in the molecular marker combination.

Preferably, the agent is a nucleic acid molecule having a nucleotide sequence set forth in SEQ ID NO: 2-3, and the nucleotide sequence of the primer of the SNP site 1 is shown as SEQ ID NO: 5-6 and/or the nucleotide sequence of SNP site 2 is shown as SEQ ID NO: 8-9, and a primer of SNP site 3.

Most preferably, the kit contains a primer of SNP site 1 with a nucleotide sequence shown in SEQ ID NO. 2-3, a primer of SNP site 2 with a nucleotide sequence shown in SEQ ID NO. 5-6, and/or a primer of SNP site 3 with a nucleotide sequence shown in SEQ ID NO. 8-9, 2 × Taq PCR Master Mix, ddH₂O。

The using method comprises the following steps:

(1) extracting total DNA of tea tree tender shoots by adopting a CTAB method, and ensuring that A260/A280 of each DNA sample is between 1.8 and 2.0 and the concentration is more than 100 mu g/mu L;

(2) PCR amplification

The PCR system (10. mu.l) was as follows:

2×Taq PCR Master Mix	5μl
		primer and method for producing the same	0.5. mu.l each
DNA template	1μl
		ddH₂O	3μl

The PCR amplification procedure was as follows:

(3) purification of the product

The PCR amplification product was subjected to gel electrophoresis, followed by recovery and purification using a commercially available gel electrophoresis DNA recovery kit.

(4) Sequencing and interpretation of results

The recovered and purified product was sent to sequencing company for Sanger sequencing, where the sequence was found in Scaffold 3614: 66549 by statistically judging that when the genotype is double mutation CC, the caffeine content in dry matter of tea tree is lower than normal average level, and the genotype is wild type TT or single mutation CT sample.

In the Scaffold 349: 3413816 site, statistically judging that when the genotype is double mutation GG, the caffeine content in the dry matter of tea tree is lower than the normal average level, and the genotype is wild type AA or single mutation GA sample.

In Scaffold 920: 281727 site, statistically judging that when the genotype is double mutation GG, the caffeine content in the dry matter of tea tree is lower than the normal average level, and the genotype is wild type AA or single mutation GA sample.

Meanwhile, the invention claims a method for evaluating the caffeine content of tea trees, which detects the genotype of the molecular marker combination or any one or more molecular markers in the molecular marker combination.

Preferably, the primer is used for detecting the genotype of the molecular marker SNP locus.

The application of the molecular marker combination or any one or more molecular markers in the molecular marker combination, the primer or one or more molecular markers in the kit in molecular assisted breeding also belongs to the protection scope of the invention.

Compared with the prior art, the invention has the following beneficial effects:

the invention discovers a molecular marker combination linked with the caffeine content quantitative character of tea trees for the first time, wherein the molecular marker combination comprises SNP loci 1, 2 and 3 which are respectively positioned in a tea tree genome Scaffold 3614: 66549. scaffold 349: 3413816 and Scaffold 920: 281727, the genotype of which is very significantly correlated with the caffeine content.

SNP site 1 is located in the tea tree genome Scaffold 3614: 66549 the genotype of the dry matter of tea tree has a significant correlation with caffeine content, and correlation analysis and significance verification show that the caffeine content in the dry matter of tea soup corresponding to CC genotype sample has a significant difference compared with TT and CT genotype samples. Statistically, when the genotype is double-mutation CC, the genotype with caffeine content lower than the normal average level in the dry matter of the tea tree is a sample of wild type TT or single-mutation CT.

SNP site 2 is located in the tea tree genome Scaffold 349: 3413816, the genotype of the tea is very obviously related to the caffeine content in the dry matter of the tea tree, and correlation analysis and significance verification show that the caffeine content in the dry matter of the tea soup corresponding to the GG genotype sample has very obvious difference compared with the GA and AA genotype samples. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

SNP site 3 is located in the tea tree genome Scaffold 920: 281727, the genotype thereof is very obviously related to the caffeine content in tea dry matter, and correlation analysis and significance verification show that the caffeine content in tea dry matter corresponding to the GG genotype sample has very obvious difference compared with GA and AA genotype samples. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

Further establishing a detection method for detecting the three SNP sites, which can be used for evaluating the caffeine content of tea trees and further used for tea tree resource screening and molecular breeding. The method is the basis for developing molecular marker-assisted selective breeding of tea trees and has great research value.

Drawings

FIG. 1 shows the caffeine content of the population used in different seasons.

Fig. 2 shows the Scaffold 3614: 66549 site and primer scheme, N denotes Scaffold 3614: 66549 the base to be detected at position is underlined and the primer is the upstream primer and the downstream primer.

FIG. 3 shows Scaffold 349: 3413816, site and primer scheme, N denotes a Scaffold 349: 3413816, the thick and underlined part is the upstream and downstream primers.

Fig. 4 shows a Scaffold 920: 281727 with primers, N denotes Scaffold 920: 281727, the thick and underlined part is the upstream and downstream primers.

FIG. 5 shows samples 2-70 in Scaffold 3614: 66549 site genotype SNaPshot sequencing result (reverse complement).

FIG. 6 shows samples 2-77 in Scaffold 3614: 66549 site genotype SNaPshot sequencing result (reverse complement).

FIG. 7 shows samples 2-72 in Scaffold 3614: 66549 site genotype SNaPshot sequencing result (reverse complement).

FIG. 8 shows samples 2-69 at Scaffold 349: 3413816 locus.

FIG. 9 shows samples 2-68 at Scaffold 349: 3413816 locus.

FIG. 10 shows samples 2-77 at Scaffold 349: 3413816 locus.

FIG. 11 shows samples 2-72 at Scaffold 920: the result of SNaPshot sequencing of the genotype at position 281727 (reverse complement).

FIG. 12 shows samples 2-94 in Scaffold 920: the result of SNaPshot sequencing of the genotype at position 281727 (reverse complement).

FIG. 13 shows samples 2-97 in Scaffold 920: the result of SNaPshot sequencing of the genotype at position 281727 (reverse complement).

FIG. 14 shows Scaffold 349: 3413816 locus genotype mapping.

FIG. 15 shows a Scaffold 920: 281727: site genotype sequencing charts.

Detailed Description

The invention is described in further detail below with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

Example 1

First, experiment sample

191 parts of tea plant materials in a tea plant germplasm resource library (Guangdong, Engde, 113.3OE,24.3ON) in Guangdong province are collected, wherein 124 parts of Guangdong, 20 parts of Fujian, 15 parts of Guangxi, 9 parts of Zhejiang, 6 parts of Hunan, 6 parts of Yunnan, 1 part of Jiangxi, 1 part of Guizhou and 1 part of Taiwan are collected. In addition, 8 kenya tea progeny, 1 grurgia progeny, the material selected is broadly representative.

The selected resources are randomly distributed in the resource library. Double-row single-plant planting is adopted, each row is 4m, the row spacing is 1.5 m, and the plant spacing is 35 cm. And performing conventional water and fertilizer management on the resource library. The resources are trimmed at the end of 2016 years and base fertilizer is applied in deep pits, 4 tons of organic fertilizer, 0.75 ton of peanut bran and 10 jin of compound fertilizer are applied per mu. And (3) pruning and topdressing 30 jin of compound fertilizer and 60 jin of urea per mu after the spring tea and summer tea in 2017. Picking young sprout of tea tree with two leaves at 15 days in 3 months, 25 days in 6 months and 28 days in 9 months in 2017, making steamed green sample, and preparing tea soup by water extraction method.

Analysis of phenotypic data

1. Experimental procedure

The method comprises the steps of detecting Caffeine, Caffeine Caffeine (CAF) related to tea tree taste in tea soup by using a high performance liquid chromatography, and detecting by referring to a national standard method.

2. Results of the experiment

The caffeine content is shown in table 1.

Table 1 percentage of dry matter for different resources caf (caffeine) in different quarters:

the variation of caffeine content in the population is shown in table 2 and figure 1.

Table 2 CAF trait (caffeine content) phenotypic variation:

third, genotype and character correlation analysis

1. Experimental procedure

Extracting total DNA of 191 tea tree resource tender shoots by adopting a CTAB method, and ensuring that A260/A280 of each DNA sample is between 1.8 and 2.0 and the concentration is more than 100 mu g/mu L. The extracted DNA samples are detected to be positioned at SNP site 1(Scaffold 3614: 66549), SNP site 2(Scaffold 349: 3413816) and SNP site 3(Scaffold 920: 281727) of the tea tree genome (http:// tpia. teaplnt. org/index. html) of the 'Shuchazao' CSS cultivar. And (4) performing association analysis of the traits and the markers, judging the significance level of the association by using a P value, wherein the significance level is that the P value is less than 1.25E-05.

2. Results of the experiment

The seasonal P-values of these three SNP sites are shown in Table 3.

Table 3: p values of three SNP sites in different seasons

Example 2 verification of SNP sites

First, experiment method

The genotypes of SNP site 1(Scaffold 3614: 66549), SNP site 2(Scaffold 349: 3413816) and SNP site 3(Scaffold 920: 281727) were verified in another population of 98 germplasms.

1. The caffeine content of each sample was measured. The specific detection method was the same as in example 1.

2. The genotype of SNP site 1(Scaffold 3614: 66549), SNP site 2(Scaffold 349: 3413816) and SNP site 3(Scaffold 920: 281727) of each sample was detected by the SnaPShot technology platform.

After the method designs primers with different lengths for different mutation sites to carry out the SNaPshot reaction, products can detect a plurality of SNP sites in one sequencing reaction through electrophoretic separation, five-color fluorescence detection and Gene mapper analysis. Site-directed sequence analysis was performed using the SNaPshot, the basic principle of which followed the dideoxy termination method in direct DNA sequencing, except that only different fluorescently labeled ddNTPs were present in the PCR reaction. Since the 3' end of each primer at each SNP site is located close to the SNP site, each primer is extended by a polymerase by only one nucleotide depending on the sequence of the template. The type of nucleotide that is extended is then detected using an advanced fluorescence detection system.

(1) Primer design

According to Scaffold 3614: 66549 primers are designed at genomic positions and synthesized. Wherein, Scaffold 3614: 66549 the upstream and downstream are extended by 500 bp. The nucleotide sequence is shown as SEQ ID NO:1 (FIG. 2, in which N represents the base to be detected at the position of Scaffold 3614: 66549).

PCR primers:

F：GATGACACAACCCTCATCTG(SEQ ID NO：2)；

R：AATGTATGCCCGGTAAGGAC(SEQ ID NO：3)。

single base extension primer:

gactACTAACTTTACGCCCACGACCCA。

according to Scaffold 349: 3413816 primers are designed at genomic locations and synthesized. Wherein, Scaffold 349: 3413816 are extended by 500bp respectively. The nucleotide sequence is shown as SEQ ID NO:4 (FIG. 3, in which N represents the base to be detected at position Scaffold 349: 3413816).

PCR primers:

and (3) primer F: TCTCTGCACTGTTGTCACTC (SEQ ID NO: 5);

and (3) primer R: CACCACACTTTCTTAGAAGG (SEQ ID NO: 6).

Single base extension primer:

actgactgactaAGGATCTAGTCCCTGCATAAATAACA。

according to Scaffold 920: 281727 primers are designed at genomic locations and synthesized. Wherein, Scaffold 920: 281727 are extended by 500bp respectively. The nucleotide sequence is shown as SEQ ID NO:7 (FIG. 4, wherein N represents the nucleotide to be detected at the position of Scaffold 920: 281727).

PCR primers:

and (3) primer F: TTCGCATTCGTCCTTTTGGG (SEQ ID NO: 8);

and (3) primer R: ACGTGCTACATTCTCCATCC (SEQ ID NO: 9).

Single base extension primer:

tgactgactgactgactgactgactgactgactTAGCATCTAAGAAAGAGGATTTA。

(2) PCR amplification

The PCR system (10. mu.l) was as follows:

2×Taq PCR Master Mix	5μl
		PrimerMix (ratio according to amplification)	1μl
DNA template	1μl
		ddH₂O	3μl

The PCR amplification procedure was as follows:

(3) PCR product purification

Purification was performed using shrimp alkaline enzyme purification. The main functional components of shrimp alkaline enzyme MIX (EX-SAP) are SAP and ExoI.SAP enzyme, which can dephosphorize residual dNTPs and ExoI degrade free single-stranded primers. Mu.l of the PCR product was taken and 2. mu.l of EX-SAP enzyme was added. The specific reaction system is as follows:

digestive system Components	Volume (μ l)
		ddH₂O	0.75
SAP(1U/ul)	0.5
		ExoI(5U/ul)	0.15
10*SAPbuffer	0.6
		PCR product	4
Total volume	6

Digestion incubation was then performed on a PCR instrument: at 37 ℃ for 40min, at 85 ℃ for 5min, at 4 ℃ for forever.

(4) SnaPshot reaction

The PCR product was used as a template for the SNaPshot reaction.

The SNaPshot reaction system is shown below:

reagent	Dosage (mu l)
		SNaPshot Mix	0.5
Pooled PCR Products	3
		Pooled Primers	1
dH₂O	0.5
		Total volume	5

The SNaPshot reaction procedure was:

then, the SNaPshot product was purified, and 2ul of SAPmix was directly added to the SNaPshot reaction product, and the specific reaction system was as follows:

components	Volume (μ l)
		Water (W)	0.9
SAP(1U/ul)	0.5
		10*SAP buffer	0.6
Total of	2

The SNaPshot product digestion reaction was performed on a PCR instrument with the following reaction program: at 37 ℃ for 40min, at 75 ℃ for 15 min, at 4 ℃ for forever.

(5) Detection on machine

Mu.l of the digested SNaPshot reaction product was added to 8. mu.l of deionized formamide containing 0.4% LIZ120, denatured at 95 ℃ for 5min, quenched at-20 ℃ and then sequenced on 3730 XL.

(6) Analysis of results

The fsa results obtained by GeneMarker analysis were used to derive peak maps and table files, and to calculate the SNP mutants for each sample.

Second, experimental results

The caffeine content and the genotypes of the SNP1, SNP2 and SNP3 sites of each sample are shown in Table 4, and the sequencing results of some samples by SNaPshot are shown in FIGS. 5 to 13.

Table 4 dry matter content and genotype of resource CAF in the population:

significance analysis nodeThe results show that the genotype of the Scaffold 3614: 66549 is very obviously related to the caffeine content, the correlation coefficient is-0.48, and the p-value is 5.45 × 10^-7The F value (6.91/3.94) is 28.9, the mutation is recessive, and the caffeine content in the tea soup dry matter corresponding to the CC genotype sample is very different from that in the TT and CT genotype samples. Statistically, when the genotype is double-mutation CC, the genotype with caffeine content lower than the normal average level in the dry matter of the tea tree is a sample of wild type TT or single-mutation CT.

The genotype of Scaffold 349: 3413816 is very obviously related to the caffeine content, the correlation coefficient is-0.4, and the p-value is-4.04 × 10^-5And the F value (6.91/3.94) is 18.5, the mutation is recessive, and the caffeine content in the tea soup dry matter corresponding to the GG genotype sample is very different from that in the GA and AA genotype samples. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

The genotype of Scaffold 920: 281727 is very significantly related to the caffeine content, the correlation coefficient is-0.45, and the p-value is 3.16 × 10^-6And the F value (6.91/3.94) is 18.7, the mutation is recessive, and the caffeine content in the tea soup dry matter corresponding to the GG genotype sample is very different from that in the GA and AA genotype samples. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

Example 3 kit for evaluating caffeine content of tea tree

A, make up

A primer with a nucleotide sequence shown as SEQ ID NO. 2-3 for detecting SNP site 1, a primer with a nucleotide sequence shown as SEQ ID NO. 5-6 for detecting SNP site 2, a primer with a nucleotide sequence shown as SEQ ID NO. 8-9 for detecting SNP site 3, 2 × Taq PCR Master Mix, ddH₂O。

Wherein, SNP site 1 primer F: GATGACACAACCCTCATCTG (SEQ ID NO: 2);

SNP site 1 primer R: AATGTATGCCCGGTAAGGAC (SEQ ID NO: 3);

SNP site 2 primer F: TCTCTGCACTGTTGTCACTC (SEQ ID NO: 5);

SNP site 2 primer R: CACCACACTTTCTTAGAAGG (SEQ ID NO: 6);

SNP site 3 primer F: TTCGCATTCGTCCTTTTGGG (SEQ ID NO: 8);

SNP site 3 primer R: ACGTGCTACATTCTCCATCC (SEQ ID NO: 9);

second, use method

(2) PCR amplification

The nucleotide sequences thereof are shown in SEQ ID NO: 2-3 and SEQ ID NO: 5-6, and detecting SNP site 1 and SNP site 2.

The PCR system (10. mu.l) was as follows:

The PCR amplification procedure was as follows:

(3) purification of the product

(4) Sequencing and interpretation of results

Converting SEQ ID NO: 2-3, recovering and purifying the amplification product of the primer, sending the amplification product to a sequencing company for sequencing by a Sanger method, and comparing the sequencing result with the sequence shown in SEQ ID NO:1, and the sequence of the sequences shown in figure 2 (bold and underlined are the upstream and downstream primers), Scaffold 3614: 66549 the site is at 137 th base of the amplification product. Statistically, when the genotype is double-mutation CC, the genotype with caffeine content lower than the normal average level in the dry matter of the tea tree is a sample of wild type TT or single-mutation CT.

Converting SEQ ID NO: 5-6, recovering and purifying the amplification product of the primer, sending the amplification product to a sequencing company for sequencing by a Sanger method, and comparing the sequencing result with the sequence shown in SEQ ID NO:4, and the sequence of nucleotides shown in figure 3 (bold and underlined are the upstream and downstream primers), Scaffold 349: 3413816 is located at the 160 th base of the amplification product. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

Converting SEQ ID NO: and (3) recovering and purifying amplification products of the primers shown in 8-9, sending the amplification products to a sequencing company for sequencing by a Sanger method, and comparing the sequencing result with the sequence shown in SEQ ID NO:4, and the sequence of nucleotides shown in figure 4 (bold and underlined for the upstream and downstream primers), a Scaffold 920: 281727 is located at the 106 th base of the amplification product. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

Example 4 application of kit for evaluating caffeine content of tea tree

First, experiment method

98 tea plant specimens from example 2 were tested using the kit of example 3.

Second, experimental results

The detection result is consistent with that of the embodiment 2 adopting a SnaPShot technology platform, and the kit can be used for evaluating the caffeine content of tea trees. The partial sample sequencing peak map of SNP2 is shown in FIG. 14, and the partial sample sequencing peak map of SNP3 is shown in FIG. 15.

Sequence listing

<110> institute of tea leaf of academy of agricultural sciences of Guangdong province

<120> a group of molecular markers linked with caffeine content of tea trees and application thereof

<160>9

<170>SIPOSequenceListing 1.0

<210>1

<211>1001

<212>DNA

<213>Camellia sinensis

<400>1

gagtcatggg tttcttaaat ttctctaaaa aatatttagg tggtgactct gtatctggca 60

aaatagtcca tttttggcaa tttgattcaa aatcagtttt ccaacatatt tgccgaattg 120

ggactttttg gtgattatct atttcacatt gcacatgtga aatcagattc agaaccgtgg 180

gagtccgata ctgtagggct tattcgtctt ccgaaaaggg gcatgcaaag tcgaactaca 240

agtcccctgg ggaggatgga ttgcaaaatt accgtacaca gtagcaatcc cgtctttaaa 300

ggcgtacttt accaactgat ggaccattga tgacacaacc ctcatctgat gtagccaggg 360

tcttcccagt agtagattga aagtgtccga aacatccatg acatagaatt taacctgatg 420

ctcagacggg ccgagtagga tatggctctt aaacattacc atgacatctt ggctcgtatt 480

gtcatataag cctaaacggc ntgggtcgtg ggcgtaaagt tagtcggcct cacaccgatg 540

gcataggcgg tccttaccgg gcatacatta atcgccgatc cgttatctac caacaccact 600

ggaatccact ttttctgact ttccagcgtt acatataagg gccaattgtg gttagcaccc 660

tcaggtggta actctttatc tataaaagat atcactggcg taacatcccc ggatgtaacc 720

aatgatacca attggtcagc agtggtttcg atagggagtt tggtccggtt cattgcctct 780

agcagcagtg cctgtctatg ctcccgagat gccatgatta gcccccagat tgatatgtcg 840

gcctgaatct tcttaagctg tttcaagacc aggttttctt caacatcctt ctcttttgat 900

ttctcgaccc ccactgtcct tgatatatgc catcttttag ggttatcacc cattggtacc 960

cctttcggtc tagattaccc tgactttaag gtctccttct c 1001

<210>2

<211>20

<212>DNA

<213>Camellia sinensis

<400>2

cttcatctcc accacacttc 20

<210>3

<211>20

<212>DNA

<213>Camellia sinensis

<400>3

aatgtatgcc cggtaaggac 20

<210>4

<211>1001

<212>DNA

<213>Camellia sinensis

<400>4

ataatctttt tgtacttgtt caggtggaat gaagcaatca accgagagtc caggaacatt 60

gaatgctagg tcgtcgatct tccaagtctc ctccatccgt gtgattgctg tgcccgctct 120

cagattgtcc ccaaatcttg agatgatcac acttgattgg ccagaatgcg cgatcatcgt 180

gccctccacc atccgatagt cctcgatttt cgtgcccatg gtggtctccc aataggtagg 240

gtaggttccg ggggactgga ttctggtgag gtaagagtcc tctaaataca ctagcagacc 300

acttctttgg ctgaagtaac caaacatgac atgcttgatc atctctgcac tgttgtcact 360

ccgatcggct aggtccgtct gatccgcgga caatttcaac acgaagcaat cgacgctcaa 420

gattcgtttt tcgcccacgt attgtgctag ggaaaacaca gccgatacag ccacaggatc 480

tagtccctgc ataaataaca ntatgttttt tacatagagg aaaataatat ctgtcacatg 540

aattctactc cattttttaa ccttctaaga aagtgtggtg aaaaaaatat taaatccatt 600

gggtaaaata taacagtctt taacataaca atatggcgaa ctatacattc aattctagaa 660

aatgtctcat ttttatagat ttttatgaaa gggatcaacc ttcttttttt ttattggaag 720

cactatataa ataatgtcaa atagttttcc aaacttatct aaataaagtt ttaataattt 780

taatccacac attttgaatt taatttactt atttttagta gataacatta ccacagtcaa 840

aaagagtgcc aacatgaacc tccagcacac ttgaagagca cttgacgatc atattgggaa 900

agttaccagc cagcactccc aaaaaaaaaa aaagaaaaaa agataaaaga ttaaaaaaat 960

tagtaaaaag tgactttaca aaaaggaata ttccacctct g 1001

<210>5

<211>20

<212>DNA

<213>Camellia sinensis

<400>5

tctctgcact gttgtcactc 20

<210>6

<211>20

<212>DNA

<213>Camellia sinensis

<400>6

caccacactt tcttagaagg 20

<210>7

<211>1001

<212>DNA

<213>Camellia sinensis

<400>7

agggagactt ttatcttgag agctagaaga agagaaagtt agagaaaaga aagagaagta 60

ggaagaaaat caaagggaat tcacattcgt ccttttggag ttgagaattg aacacttagg 120

tgatttcgaa aatcataaat gaggtgtgtt aaactaatat cgttcagcta cagttactca 180

gtaaattctc tttctcagag gctacgcagg tgtagtttga gttaaacttg gccacttaaa 240

ctaatggaac cattaggggc ccaagctaat tagttcctag aacaaaggag agaggacgga 300

gaagcataga gaaagttaga gagaaacttt tttcttgaga gatagaagag atagttagag 360

aaaagaaaga gaaacgggaa aaaaatcatt gggaattcgc attcgtcctt ttgggcttga 420

gaattgaaca gttggggaat ttgggaaacc ttaaatgcgg tgcttatgtt taactaatat 480

cgttaagtgc caattactca ntaaatcctc tttcttagat gctaagcaag atttagtgta 540

gttaaacttg gccacttaag ctaatggaac agttagggtc ccaagcgaat tagtttccta 600

gaacaaaaga tagaaggatg gagaatgtag cacgttcgtg agggaccccg ctactacagt 660

tcggactcga tttgtgtcac ggttcttaat ctgaaccaaa gagtccaaat ccggcaaatc 720

gttttgagaa acagattttt tgaaaagaag tgccaaacat ggactgcttt gctagatata 780

gagtcgccac ctaaatattt ttttaaaatg gggaaattta ggaaacccta acttggtgcc 840

aaaggccacg tgtccgtcat tgccaaagtt gcctgggctc gggagcttgg gtacgattgg 900

ggaaggtcag ctatgagcac cccctctcgc ccgatccgaa gatcggcctc tactaaccgt 960

gatatccgtt tttgaaaacg ttatgtgttc ttaaaccaat t 1001

<210>8

<211>20

<212>DNA

<213>Camellia sinensis

<400>8

ttcgcattcg tccttttggg 20

<210>9

<211>20

<212>DNA

<213>Camellia sinensis

<400>9

acgtgctaca ttctccatcc 20

Claims

1. The application of a molecular marker combination or primers of any one or two molecular markers in the molecular marker combination in evaluating the caffeine content of tea trees is characterized in that the molecular marker combination comprises SNP sites 1, 2 and 3 which are respectively positioned in the Scaffold 3614: 66549. scaffold 349: 3413816 and Scaffold 920: 281727, i.e., the 501 th base of the nucleotide sequence shown by SEQ ID NO. 1, the 501 th base of the nucleotide sequence shown by SEQ ID NO. 4 and the 501 th base of the nucleotide sequence shown by SEQ ID NO. 7.

2. The use of claim 1, wherein the primer of SNP site 1 has a nucleotide sequence as set forth in SEQ ID NO: 2 to 3.

3. The use of claim 1, wherein the primer for SNP site 2 has a nucleotide sequence as set forth in SEQ ID NO: 5 to 6.

4. The use of claim 1, wherein the primer for SNP site 3 has a nucleotide sequence as set forth in SEQ ID NO: 8 to 9.

5. A method for evaluating the caffeine content of Camellia sinensis, comprising detecting the genotype of the combination of molecular markers according to claim 1 or any one or both of the molecular markers.