CN110734996A

CN110734996A - group molecular marker linked with caffeine content of tea tree and application thereof

Info

Publication number: CN110734996A
Application number: CN201910833668.7A
Authority: CN
Inventors: 方开星; 吴华玲; 王秋霜; 李波; 潘晨东; 秦丹丹; 李红建; 姜晓辉
Original assignee: Tea Research Institute Guangdong Academy of Agricultural Sciences
Current assignee: Tea Research Institute Guangdong Academy of Agricultural Sciences
Priority date: 2019-09-04
Filing date: 2019-09-04
Publication date: 2020-01-31
Anticipated expiration: 2039-09-04
Also published as: CN110734996B

Abstract

The invention discloses groups of molecular markers linked with the Caffeine content of tea trees and application thereof, and discovers SNP molecular marker sites which are located at the sites of Scaffold 3614: 66549, Scaffold 349: 3413816 and Scaffold 920: 281727 on the genome of tea trees and are related to the Caffeine content for the first time, the genotype of the SNP molecular marker sites is extremely obviously related to the Caffeine content, a detection method for detecting each site is further established in step , the Caffeine content of the tea trees can be evaluated by using or a plurality of molecular marker sites in the SNP molecular marker sites, so that is further used for screening high-Caffeine tea tree resources and molecular breeding, and the SNP molecular marker sites have great research value.

Description

group molecular marker linked with caffeine content of tea tree and application thereof

Technical Field

The invention relates to the technical field of molecular genetic breeding, in particular to groups of molecular markers linked with the content of Caffeine (CAFFEIne) of tea trees and application thereof.

Background

Tea (Camellia sinensis (L.) o.kuntze) belongs to the group of Camellia genus tea of the family theaceae, originated in the southwest region of china, with a cultivation history of over 5000 years to date. The tea leaves, coffee and cocoa are called three kinds of non-alcoholic beverages in the world, have important economic value and have important influence on society and culture.

The characteristic secondary metabolite caffeine in tea tree tea leaves is which is a main influence factor of tea leaf taste, the caffeine is alkaloids with high content in tea leaves, the -like content is 2-5%, each 150ml of tea soup contains about 40mg of caffeine, the caffeine is central nerve stimulants and has a refreshing effect, in addition, the caffeine also has the effects of enhancing physical strength, stamina and durability, researches show that the caffeine can enhance muscle activity, particularly upper limb muscles, the caffeine can also promote metabolism, the metabolism rate can be improved by 7% in the next 3 hours after 200m g caffeine is ingested, the fat burning rate can be greatly improved, the caffeine can assist pain relieving, the onset of other pain relieving medicines can be accelerated, the caffeine has the effect of improving oxidation resistance, and the effect of antioxidant phenolic substances can be doubled.

However, some people are very sensitive to caffeine, even a small amount of caffeine can cause serious insomnia, accelerated heartbeat and increased blood pressure, and the probability of myocardial infarction after excessive caffeine intake is higher.

The existing research shows that caffeine is different among different producing areas and different varieties. In order to meet the requirements of different crowds, tea trees with different caffeine contents need to be cultivated. Meanwhile, because of the importance of the caffeine on the quality and physiological function of the tea, the method has important significance in breeding tea tree varieties with specific caffeine content. At present, tea tree breeding is mainly carried out by a conventional method, and a superior single plant is selected from a wild population and filial generations for systematic breeding. The method has long time and low efficiency, so that the new species is slowly updated, and the requirement of the public on the new species cannot be quickly met. The molecular marker assisted breeding can obviously improve the breeding efficiency because the breeding material can be selected in the seedling stage. The discovery of molecular markers closely linked with the excellent properties of tea trees is the basis for developing molecular marker-assisted selective breeding of tea trees.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides groups of molecular markers linked with the caffeine content of tea trees and application thereof.

The th object of the invention is to provide molecular marker combinations linked with quantitative character of caffeine content of tea trees.

The second purpose of the invention is to provide the application of the molecular marker combination or any or two molecular markers in the molecular marker combination in the evaluation of the caffeine content of tea trees.

The third purpose of the invention is to provide the application of the molecular marker combination or any or two molecular marker primers in the molecular marker combination in the evaluation of the caffeine content of tea trees.

The fourth purpose of the invention is to provide a primer for detecting the SNP site 1.

The fifth object of the present invention is to provide a primer for detecting the SNP site 2.

The sixth purpose of the present invention is to provide a primer for detecting the SNP site 3.

The seventh purpose of the invention is to provide kits for evaluating the caffeine content of tea trees.

An eighth object of the present invention is to provide methods for evaluating the caffeine content of tea tree.

The ninth purpose of the invention is to provide the molecular marker combination or any or several molecular markers therein, the primer, or or several in the kit for the application in molecular assisted breeding.

In order to achieve the purpose, the invention is realized by the following technical scheme:

the inventor finds three SNP locus molecular markers linked with caffeine through long-term exploratory research, and the method further establishes a detection method for detecting the loci, can be used for evaluating the caffeine content of tea trees, and further steps of resource screening and molecular breeding.

Therefore, the invention claims molecular marker combinations with tea tree caffeine content quantitative character linkage, which comprise SNP sites 1, 2 and 3, and are respectively located at the Scaffold 3614: 66549, Scaffold 349: 3413816 and Scaffold 920: 281727 of tea tree genomes, namely the 501 th base of the nucleotide sequence shown by SEQ ID NO. 1, the 501 th base of the nucleotide sequence shown by SEQ ID NO. 4 and the 501 th base of the nucleotide sequence shown by SEQ ID NO. 7.

SNP site 1 is located in the tea tree genome Scaffold 3614: 66549 (501 th base of the nucleotide sequence shown in SEQ ID NO: 1), the site is C or T, the genotype is significantly related to the caffeine content in tea tree dry matter, and correlation analysis and significance verification show that the caffeine content in tea soup dry matter corresponding to CC genotype sample is significantly different from that in TT and CT genotype sample. Statistically, when the genotype is double-mutation CC, the genotype with caffeine content lower than the normal average level in the dry matter of the tea tree is a sample of wild type TT or single-mutation CT.

SNP site 2 is located in the tea tree genome Scaffold 349: 3413816 (namely the 501 th base of the nucleotide sequence shown in SEQ ID NO: 4), the site is G or A, the genotype is very obviously related to the caffeine content in tea dry matter, and correlation analysis and significance verification show that the caffeine content in tea dry matter corresponding to GG genotype sample is very different from that in GA and AA genotype sample. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

SNP site 3 is located in the tea tree genome Scaffold 920: 281727 (namely the 501 th base of the nucleotide sequence shown in SEQ ID NO: 7), the site is G or A, the genotype is very obviously related to the caffeine content in the tea tree dry matter, and correlation analysis and significance verification show that the caffeine content in the tea soup dry matter corresponding to the GG genotype sample is very different from that in the GA and AA genotype samples. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

The content of the caffeine of the tea trees is specifically the proportion of the caffeine of the dry matter of the fresh tea leaves.

The application of the molecular marker combination or any or two molecular markers in the molecular marker combination in evaluating the caffeine content of tea trees also belongs to the protection scope of the invention.

The invention also claims the application of the molecular marker combination or any or two molecular marker primers in the molecular marker combination in the evaluation of the caffeine content of tea trees.

The nucleotide sequence of the primer of the SNP site 1 is shown as SEQ ID NO: 2 to 3.

And (3) primer F: GATGACACAACCCTCATCTG (SEQ ID NO: 2);

and (3) primer R: AATGTATGCCCGGTAAGGAC (SEQ ID NO: 3).

The nucleotide sequence of the primer of the SNP site 2 is shown as SEQ ID NO: 5 to 6.

And (3) primer F: TCTCTGCACTGTTGTCACTC (SEQ ID NO: 5);

and (3) primer R: CACCACACTTTCTTAGAAGG (SEQ ID NO: 6).

The nucleotide sequence of the primer of the SNP locus 3 is shown as SEQ ID NO: 8 to 9.

And (3) primer F: TTCGCATTCGTCCTTTTGGG (SEQ ID NO: 8);

and (3) primer R: ACGTGCTACATTCTCCATCC (SEQ ID NO: 9).

, the invention claims kits for evaluating the content of Caffeine (cafneine, CAF) of tea tree, which comprise reagents for detecting the combination of molecular markers or any or several of the molecular markers.

Preferably, the agent is a nucleic acid molecule having a nucleotide sequence set forth in SEQ ID NO: 2-3, and the nucleotide sequence of the primer of the SNP site 1 is shown as SEQ ID NO: 5-6 and/or the nucleotide sequence of SNP site 2 is shown as SEQ ID NO: 8-9, and a primer of SNP site 3.

Most preferably, the kit comprises a nucleic acid sequence as set forth in SEQ ID NO: 2-3, and the nucleotide sequence of the primer of the SNP site 1 is shown as SEQ ID NO: 5-6 and/or the nucleotide sequence of SNP site 2 is shown as SEQ ID NO: 8-9 SNP site 3 primers, 2 XTaq PCR Master Mix, ddH₂O。

The using method comprises the following steps:

(1) extracting total DNA of tea tree tender shoots by adopting a CTAB method, and ensuring that A260/A280 of each DNA sample is between 1.8 and 2.0 and the concentration is more than 100 mu g/mu L;

(2) PCR amplification

The PCR system (10. mu.l) was as follows:

2×Taq PCR Master Mix	5μl
		primer and method for producing the same	0.5. mu.l each
DNA template	1μl
		ddH₂O	3μl

The PCR amplification procedure was as follows:

(3) purification of the product

The PCR amplification product was subjected to gel electrophoresis, followed by recovery and purification using a commercially available gel electrophoresis DNA recovery kit.

(4) Sequencing and interpretation of results

The recovered and purified product was sent to sequencing company for Sanger sequencing, where the sequence was found in Scaffold 3614: 66549 by statistically judging that when the genotype is double mutation CC, the caffeine content in dry matter of tea tree is lower than normal average level, and the genotype is wild type TT or single mutation CT sample.

In the Scaffold 349: 3413816 site, statistically judging that when the genotype is double mutation GG, the caffeine content in the dry matter of tea tree is lower than the normal average level, and the genotype is wild type AA or single mutation GA sample.

In Scaffold 920: 281727 site, statistically judging that when the genotype is double mutation GG, the caffeine content in the dry matter of tea tree is lower than the normal average level, and the genotype is wild type AA or single mutation GA sample.

Meanwhile, the invention claims methods for evaluating the caffeine content of tea trees, and the genotypes of the molecular marker combination or any or several molecular markers in the molecular marker combination are detected.

Preferably, the primer is used for detecting the genotype of the molecular marker SNP locus.

The application of the molecular marker combination or any or more molecular markers in the molecular marker combination, the primers, or or more molecular markers in the kit in molecular assisted breeding also belongs to the protection scope of the invention.

Compared with the prior art, the invention has the following beneficial effects:

the invention discovers molecular marker combinations with tea tree caffeine content quantitative character linkage for the first time, wherein the molecular marker combinations comprise SNP sites 1, 2 and 3 which are respectively positioned in tea tree genome Scaffold 3614: 66549, Scaffold 349: 3413816 and Scaffold 920: 281727, and the genotypes of the molecular marker combinations are extremely obviously related to the caffeine content.

SNP site 1 is located in the tea tree genome Scaffold 3614: 66549 the genotype of the dry matter of tea tree has a significant correlation with caffeine content, and correlation analysis and significance verification show that the caffeine content in the dry matter of tea soup corresponding to CC genotype sample has a significant difference compared with TT and CT genotype samples. Statistically, when the genotype is double-mutation CC, the genotype with caffeine content lower than the normal average level in the dry matter of the tea tree is a sample of wild type TT or single-mutation CT.

SNP site 2 is located in the tea tree genome Scaffold 349: 3413816, the genotype of the tea is very obviously related to the caffeine content in the dry matter of the tea tree, and correlation analysis and significance verification show that the caffeine content in the dry matter of the tea soup corresponding to the GG genotype sample has very obvious difference compared with the GA and AA genotype samples. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

SNP site 3 is located in the tea tree genome Scaffold 920: 281727, the genotype thereof is very obviously related to the caffeine content in tea dry matter, and correlation analysis and significance verification show that the caffeine content in tea dry matter corresponding to the GG genotype sample has very obvious difference compared with GA and AA genotype samples. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

, a detection method for detecting the three SNP sites can be established, the method can be used for evaluating the caffeine content of tea trees and is further used for steps of tea tree resource screening and molecular breeding, which is the basis for developing molecular marker-assisted selective breeding of tea trees and has great research value.

Drawings

FIG. 1 shows the caffeine content of the population used in different seasons.

Fig. 2 shows the Scaffold 3614: 66549 site and primer scheme, N denotes Scaffold 3614: 66549 the base to be detected at position is underlined and the primer is the upstream primer and the downstream primer.

FIG. 3 shows Scaffold 349: 3413816, site and primer scheme, N denotes a Scaffold 349: 3413816, the thick and underlined part is the upstream and downstream primers.

Fig. 4 shows a Scaffold 920: 281727 with primers, N denotes Scaffold 920: 281727, the thick and underlined part is the upstream and downstream primers.

FIG. 5 shows samples 2-70 in Scaffold 3614: 66549 site genotype SNaPshot sequencing result (reverse complement).

FIG. 6 shows samples 2-77 in Scaffold 3614: 66549 site genotype SNaPshot sequencing result (reverse complement).

FIG. 7 shows samples 2-72 in Scaffold 3614: 66549 site genotype SNaPshot sequencing result (reverse complement).

FIG. 8 shows samples 2-69 at Scaffold 349: 3413816 locus.

FIG. 9 shows samples 2-68 at Scaffold 349: 3413816 locus.

FIG. 10 shows samples 2-77 at Scaffold 349: 3413816 locus.

FIG. 11 shows samples 2-72 at Scaffold 920: the result of SNaPshot sequencing of the genotype at position 281727 (reverse complement).

FIG. 12 shows samples 2-94 in Scaffold 920: the result of SNaPshot sequencing of the genotype at position 281727 (reverse complement).

FIG. 13 shows samples 2-97 in Scaffold 920: the result of SNaPshot sequencing of the genotype at position 281727 (reverse complement).

FIG. 14 shows Scaffold 349: 3413816 locus genotype mapping.

FIG. 15 shows a Scaffold 920: 281727: site genotype sequencing charts.

Detailed Description

The present invention is further illustrated in detail in the accompanying drawings and the following examples, which are for the purpose of explanation only and are not intended to limit the scope of the invention.

Example 1

, Experimental specimens

191 parts of tea plant material located in the east China tea plant germplasm resources pool ( east, End, 113.3OE,24.3ON) were collected, of which east 124 parts, Fujian 20 parts, west 15 parts, Zhejiang 9 parts, Hunan 6 parts, Yunnan 6 parts, Jiangxi 1 parts, Guizhou 1 part, Taiwan 1 part, another 8 parts of Kenya tea species progeny, and 1 part of Grougian species progeny, the selected material had pan representativeness.

The method comprises the steps of randomly distributing selected resources in a resource library, carrying out conventional water and fertilizer management by adopting double-row single-plant planting, wherein each row is 4m, the row spacing is 1.5 m, and the plant spacing is 35 cm. in the resource library, trimming the resources at the end of 2016 year, applying base fertilizer in a deep pit, trimming 4 tons of organic fertilizer, 0.75 tons of peanut bran and 10 jin of compound fertilizer per mu, trimming and topdressing outside roots after spring tea and summer tea in 2017, 30 jin of compound fertilizer and 60 jin of urea per mu, picking two tea tree new tips buds in 3-month 15 days, 6-month 25 days and 9-month 28 days in 2017 respectively, making steamed green samples, and preparing tea soup according to a water extraction method.

Analysis of phenotypic data

1. Experimental procedure

The method comprises the steps of detecting Caffeine, Caffeine Caffeine (CAF) related to tea tree taste in tea soup by using a high performance liquid chromatography, and detecting by referring to a national standard method.

2. Results of the experiment

The caffeine content is shown in table 1.

Table 1 percentage of dry matter for different resources caf (caffeine) in different quarters:

the variation of caffeine content in the population is shown in table 2 and figure 1.

Table 2 CAF trait (caffeine content) phenotypic variation:

third, genotype and character correlation analysis

1. Experimental procedure

Extracting total DNA of 191 tea tree resource tender shoots by adopting a CTAB method, and ensuring that A260/A280 of each DNA sample is between 1.8 and 2.0 and the concentration is more than 100 mu g/mu L. The extracted DNA samples are detected to be positioned at SNP site 1(Scaffold 3614: 66549), SNP site 2(Scaffold 349: 3413816) and SNP site 3(Scaffold 920: 281727) of the tea tree genome (http:// tpia. teaplnt. org/index. html) of the 'Shuchazao' CSS cultivar. And (4) performing association analysis of the traits and the markers, judging the significance level of the association by using a P value, wherein the significance level is that the P value is less than 1.25E-05.

2. Results of the experiment

The seasonal P-values of these three SNP sites are shown in Table 3.

Table 3: p values of three SNP sites in different seasons

Example 2 verification of SNP sites

Experimental methods

The genotypes of SNP site 1(Scaffold 3614: 66549), SNP site 2(Scaffold 349: 3413816) and SNP site 3(Scaffold 920: 281727) were verified in another populations containing 98 germplasms.

1. The caffeine content of each sample was measured. The specific detection method was the same as in example 1.

2. The genotype of SNP site 1(Scaffold 3614: 66549), SNP site 2(Scaffold 349: 3413816) and SNP site 3(Scaffold 920: 281727) of each sample was detected by the SnaPShot technology platform.

The method designs primers with different lengths aiming at different mutation sites, after the reaction, products can detect a plurality of SNP sites in sequencing reactions through electrophoretic separation, five-color fluorescence detection and Gene mapper analysis, the site-specific sequence analysis is carried out by using the SNaPshot, the basic principle of the method follows a dideoxy termination method in direct DNA sequencing, except that only ddNTPs with different fluorescence labels are arranged in PCR reaction, because the 3' end of the primer of each SNP site is close to the SNP site, each primers only extend nucleotides according to the sequence of a template under the action of polymerase, and then the type of the extended nucleotide is detected by using an advanced fluorescence detection system.

(1) Primer design

According to Scaffold 3614: 66549 primers are designed at genomic positions and synthesized. Wherein, Scaffold 3614: 66549 the upstream and downstream are extended by 500 bp. The nucleotide sequence is shown as SEQ ID NO:1 (FIG. 2, in which N represents the base to be detected at the position of Scaffold 3614: 66549).

PCR primers:

F：GATGACACAACCCTCATCTG(SEQ ID NO：2)；

R：AATGTATGCCCGGTAAGGAC(SEQ ID NO：3)。

single base extension primer:

gactACTAACTTTACGCCCACGACCCA。

according to Scaffold 349: 3413816 primers are designed at genomic locations and synthesized. Wherein, Scaffold 349: 3413816 are extended by 500bp respectively. The nucleotide sequence is shown as SEQ ID NO:4 (FIG. 3, in which N represents the base to be detected at position Scaffold 349: 3413816).

PCR primers:

and (3) primer F: TCTCTGCACTGTTGTCACTC (SEQ ID NO: 5);

and (3) primer R: CACCACACTTTCTTAGAAGG (SEQ ID NO: 6).

Single base extension primer:

actgactgactaAGGATCTAGTCCCTGCATAAATAACA。

according to Scaffold 920: 281727 primers are designed at genomic locations and synthesized. Wherein, Scaffold 920: 281727 are extended by 500bp respectively. The nucleotide sequence is shown as SEQ ID NO:7 (FIG. 4, wherein N represents the nucleotide to be detected at the position of Scaffold 920: 281727).

PCR primers:

and (3) primer F: TTCGCATTCGTCCTTTTGGG (SEQ ID NO: 8);

and (3) primer R: ACGTGCTACATTCTCCATCC (SEQ ID NO: 9).

Single base extension primer:

tgactgactgactgactgactgactgactgactTAGCATCTAAGAAAGAGGATTTA。

(2) PCR amplification

The PCR system (10. mu.l) was as follows:

2×Taq PCR Master Mix	5μl
		PrimerMix (ratio according to amplification)	1μl
DNA template	1μl
		ddH₂O	3μl

The PCR amplification procedure was as follows:

(3) PCR product purification

Purification was performed using shrimp alkaline enzyme purification. The main functional components of shrimp alkaline enzyme MIX (EX-SAP) are SAP and ExoI.SAP enzyme, which can dephosphorize residual dNTPs and ExoI degrade free single-stranded primers. Mu.l of the PCR product was taken and 2. mu.l of EX-SAP enzyme was added. The specific reaction system is as follows:

digestive system Components	Volume (μ l)
		ddH₂O	0.75
SAP(1U/ul)	0.5
		ExoI(5U/ul)	0.15
10*SAPbuffer	0.6
		PCR product	4
Total volume	6

Digestion incubation was then performed on a PCR instrument: at 37 ℃ for 40min, at 85 ℃ for 5min, at 4 ℃ for forever.

(4) SnaPshot reaction

The PCR product was used as a template for the SNaPshot reaction.

The SNaPshot reaction system is shown below:

reagent	Dosage (mu l)
		SNaPshot Mix	0.5
Pooled PCR Products	3
		Pooled Primers	1
dH₂O	0.5
		Total volume	5

The SNaPshot reaction procedure was:

then, the SNaPshot product was purified, and 2ul of SAPmix was directly added to the SNaPshot reaction product, and the specific reaction system was as follows:

components	Volume (μ l)
		Water (W)	0.9
SAP(1U/ul)	0.5
		10*SAP buffer	0.6
Total of	2

The SNaPshot product digestion reaction was performed on a PCR instrument with the following reaction program: at 37 ℃ for 40min, at 75 ℃ for 15 min, at 4 ℃ for forever.

(5) Detection on machine

Mu.l of the digested SNaPshot reaction product was added to 8. mu.l of deionized formamide containing 0.4% LIZ120, denatured at 95 ℃ for 5min, quenched at-20 ℃ and then sequenced on 3730 XL.

(6) Analysis of results

The fsa results obtained by GeneMarker analysis were used to derive peak maps and table files, and to calculate the SNP mutants for each sample.

Second, experimental results

The caffeine content and the genotypes of the SNP1, SNP2 and SNP3 sites of each sample are shown in Table 4, and the sequencing results of some samples by SNaPshot are shown in FIGS. 5 to 13.

Table 4 dry matter content and genotype of resource CAF in the population:

the results of the significance analysis show that the ratio of Scaffold 3614: 66549 the genotype is very significantly related to caffeine content, with correlation coefficient of-0.48 and p-value of 5.45 × 10^-7The F value (6.91/3.94) is 28.9, the mutation is recessive, and the caffeine content in the tea soup dry matter corresponding to the CC genotype sample is very different from that in the TT and CT genotype samples. Statistically, when the genotype is double-mutation CC, the genotype with caffeine content lower than the normal average level in the dry matter of the tea tree is a sample of wild type TT or single-mutation CT.

Scaffold 349: 3413816 genotype is very significantly related to caffeine content, the correlation coefficient is-0.4, and p-value is-4.04 × 10^-5And the F value (6.91/3.94) is 18.5, the mutation is recessive, and the caffeine content in the tea soup dry matter corresponding to the GG genotype sample is very different from that in the GA and AA genotype samples. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

Scaffold 920: 281727 genotype is very significantly related to caffeine content, with a correlation coefficient of-0.45 and a p-value of 3.16X 10^-6And the F value (6.91/3.94) is 18.7, the mutation is recessive, and the caffeine content in the tea soup dry matter corresponding to the GG genotype sample is very different from that in the GA and AA genotype samples. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

EXAMPLE 3 kit for evaluating caffeine content in tea Tree

, composition

The nucleotide sequence is shown as SEQ ID NO: 2-3, and the nucleotide sequence of the primer for detecting the SNP site 1 is shown as SEQ ID NO: 5-6, and the nucleotide sequence of the primer for detecting the SNP site 2 is shown as SEQ ID NO: 8-9 of primers for detecting SNP site 3, 2 XTaq PCR Master Mix, ddH₂O。

Wherein, SNP site 1 primer F: GATGACACAACCCTCATCTG (SEQ ID NO: 2);

SNP site 1 primer R: AATGTATGCCCGGTAAGGAC (SEQ ID NO: 3);

SNP site 2 primer F: TCTCTGCACTGTTGTCACTC (SEQ ID NO: 5);

SNP site 2 primer R: CACCACACTTTCTTAGAAGG (SEQ ID NO: 6);

SNP site 3 primer F: TTCGCATTCGTCCTTTTGGG (SEQ ID NO: 8);

SNP site 3 primer R: ACGTGCTACATTCTCCATCC (SEQ ID NO: 9);

second, use method

(2) PCR amplification

The nucleotide sequences thereof are shown in SEQ ID NO: 2-3 and SEQ ID NO: 5-6, and detecting SNP site 1 and SNP site 2.

The PCR system (10. mu.l) was as follows:

The PCR amplification procedure was as follows:

(3) purification of the product

(4) Sequencing and interpretation of results

Converting SEQ ID NO: 2-3, recovering and purifying the amplification product of the primer, sending the amplification product to a sequencing company for sequencing by a Sanger method, and comparing the sequencing result with the sequence shown in SEQ ID NO:1, and the sequence of the sequences shown in figure 2 (bold and underlined are the upstream and downstream primers), Scaffold 3614: 66549 the site is at 137 th base of the amplification product. Statistically, when the genotype is double-mutation CC, the genotype with caffeine content lower than the normal average level in the dry matter of the tea tree is a sample of wild type TT or single-mutation CT.

Converting SEQ ID NO: 5-6, recovering and purifying the amplification product of the primer, sending the amplification product to a sequencing company for sequencing by a Sanger method, and comparing the sequencing result with the sequence shown in SEQ ID NO:4, and the sequence of nucleotides shown in figure 3 (bold and underlined are the upstream and downstream primers), Scaffold 349: 3413816 is located at the 160 th base of the amplification product. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

Converting SEQ ID NO: and (3) recovering and purifying amplification products of the primers shown in 8-9, sending the amplification products to a sequencing company for sequencing by a Sanger method, and comparing the sequencing result with the sequence shown in SEQ ID NO:4, and the sequence of nucleotides shown in figure 4 (bold and underlined for the upstream and downstream primers), a Scaffold 920: 281727 is located at the 106 th base of the amplification product. Statistically, when the genotype is double mutation GG, the genotype with caffeine content lower than the normal average level in the dry matter of the tea plant is the sample of wild type AA or single mutation GA.

Example 4 application of 4 kits for evaluating caffeine content in tea tree

Experimental methods

98 tea plant specimens from example 2 were tested using the kit of example 3.

Second, experimental results

The detection result is compared with the detection result of the SnaPShot technology platform adopted in the example 2, the kit can be used for evaluating the caffeine content of tea trees, the sequencing peak diagram of a part of sample of SNP2 is shown in figure 14, and the sequencing peak diagram of a part of sample of SNP3 is shown in figure 15.

Sequence listing

<110> institute of tea, institute of agricultural and scientific academy of east province

<120> group molecular markers linked with caffeine content of tea tree and application thereof

<160>9

<170>SIPOSequenceListing 1.0

<210>1

<211>1001

<212>DNA

<213>Camellia sinensis

<400>1

gagtcatggg tttcttaaat ttctctaaaa aatatttagg tggtgactct gtatctggca 60

aaatagtcca tttttggcaa tttgattcaa aatcagtttt ccaacatatt tgccgaattg 120

ggactttttg gtgattatct atttcacatt gcacatgtga aatcagattc agaaccgtgg 180

gagtccgata ctgtagggct tattcgtctt ccgaaaaggg gcatgcaaag tcgaactaca 240

agtcccctgg ggaggatgga ttgcaaaatt accgtacaca gtagcaatcc cgtctttaaa 300

ggcgtacttt accaactgat ggaccattga tgacacaacc ctcatctgat gtagccaggg 360

tcttcccagt agtagattga aagtgtccga aacatccatg acatagaatt taacctgatg 420

ctcagacggg ccgagtagga tatggctctt aaacattacc atgacatctt ggctcgtatt 480

gtcatataag cctaaacggc ntgggtcgtg ggcgtaaagt tagtcggcct cacaccgatg 540

gcataggcgg tccttaccgg gcatacatta atcgccgatc cgttatctac caacaccact 600

ggaatccact ttttctgact ttccagcgtt acatataagg gccaattgtg gttagcaccc 660

tcaggtggta actctttatc tataaaagat atcactggcg taacatcccc ggatgtaacc 720

aatgatacca attggtcagc agtggtttcg atagggagtt tggtccggtt cattgcctct 780

agcagcagtg cctgtctatg ctcccgagat gccatgatta gcccccagat tgatatgtcg 840

gcctgaatct tcttaagctg tttcaagacc aggttttctt caacatcctt ctcttttgat 900

ttctcgaccc ccactgtcct tgatatatgc catcttttag ggttatcacc cattggtacc 960

cctttcggtc tagattaccc tgactttaag gtctccttct c 1001

<210>2

<211>20

<212>DNA

<213>Camellia sinensis

<400>2

cttcatctcc accacacttc 20

<210>3

<211>20

<212>DNA

<213>Camellia sinensis

<400>3

aatgtatgcc cggtaaggac 20

<210>4

<211>1001

<212>DNA

<213>Camellia sinensis

<400>4

ataatctttt tgtacttgtt caggtggaat gaagcaatca accgagagtc caggaacatt 60

gaatgctagg tcgtcgatct tccaagtctc ctccatccgt gtgattgctg tgcccgctct 120

cagattgtcc ccaaatcttg agatgatcac acttgattgg ccagaatgcg cgatcatcgt 180

gccctccacc atccgatagt cctcgatttt cgtgcccatg gtggtctccc aataggtagg 240

gtaggttccg ggggactgga ttctggtgag gtaagagtcc tctaaataca ctagcagacc 300

acttctttgg ctgaagtaac caaacatgac atgcttgatc atctctgcac tgttgtcact 360

ccgatcggct aggtccgtct gatccgcgga caatttcaac acgaagcaat cgacgctcaa 420

gattcgtttt tcgcccacgt attgtgctag ggaaaacaca gccgatacag ccacaggatc 480

tagtccctgc ataaataaca ntatgttttt tacatagagg aaaataatat ctgtcacatg 540

aattctactc cattttttaa ccttctaaga aagtgtggtg aaaaaaatat taaatccatt 600

gggtaaaata taacagtctt taacataaca atatggcgaa ctatacattc aattctagaa 660

aatgtctcat ttttatagat ttttatgaaa gggatcaacc ttcttttttt ttattggaag 720

cactatataa ataatgtcaa atagttttcc aaacttatct aaataaagtt ttaataattt 780

taatccacac attttgaatt taatttactt atttttagta gataacatta ccacagtcaa 840

aaagagtgcc aacatgaacc tccagcacac ttgaagagca cttgacgatc atattgggaa 900

agttaccagc cagcactccc aaaaaaaaaa aaagaaaaaa agataaaaga ttaaaaaaat 960

tagtaaaaag tgactttaca aaaaggaata ttccacctct g 1001

<210>5

<211>20

<212>DNA

<213>Camellia sinensis

<400>5

tctctgcact gttgtcactc 20

<210>6

<211>20

<212>DNA

<213>Camellia sinensis

<400>6

caccacactt tcttagaagg 20

<210>7

<211>1001

<212>DNA

<213>Camellia sinensis

<400>7

agggagactt ttatcttgag agctagaaga agagaaagtt agagaaaaga aagagaagta 60

ggaagaaaat caaagggaat tcacattcgt ccttttggag ttgagaattg aacacttagg 120

tgatttcgaa aatcataaat gaggtgtgtt aaactaatat cgttcagcta cagttactca 180

gtaaattctc tttctcagag gctacgcagg tgtagtttga gttaaacttg gccacttaaa 240

ctaatggaac cattaggggc ccaagctaat tagttcctag aacaaaggag agaggacgga 300

gaagcataga gaaagttaga gagaaacttt tttcttgaga gatagaagag atagttagag 360

aaaagaaaga gaaacgggaa aaaaatcatt gggaattcgc attcgtcctt ttgggcttga 420

gaattgaaca gttggggaat ttgggaaacc ttaaatgcgg tgcttatgtt taactaatat 480

cgttaagtgc caattactca ntaaatcctc tttcttagat gctaagcaag atttagtgta 540

gttaaacttg gccacttaag ctaatggaac agttagggtc ccaagcgaat tagtttccta 600

gaacaaaaga tagaaggatg gagaatgtag cacgttcgtg agggaccccg ctactacagt 660

tcggactcga tttgtgtcac ggttcttaat ctgaaccaaa gagtccaaat ccggcaaatc 720

gttttgagaa acagattttt tgaaaagaag tgccaaacat ggactgcttt gctagatata 780

gagtcgccac ctaaatattt ttttaaaatg gggaaattta ggaaacccta acttggtgcc 840

aaaggccacg tgtccgtcat tgccaaagtt gcctgggctc gggagcttgg gtacgattgg 900

ggaaggtcag ctatgagcac cccctctcgc ccgatccgaa gatcggcctc tactaaccgt 960

gatatccgtt tttgaaaacg ttatgtgttc ttaaaccaat t 1001

<210>8

<211>20

<212>DNA

<213>Camellia sinensis

<400>8

ttcgcattcg tccttttggg 20

<210>9

<211>20

<212>DNA

<213>Camellia sinensis

<400>9

acgtgctaca ttctccatcc 20

Claims

1, molecular marker combinations linked with the tea tree caffeine content quantitative character, which is characterized by comprising SNP sites 1, 2 and 3, and the SNP sites are respectively positioned in a tea tree genome Scaffold 3614: 66549, Scaffold 349: 3413816 and Scaffold 920: 281727, namely, the 501 th base of a nucleotide sequence shown by SEQ ID NO. 1, the 501 th base of a nucleotide sequence shown by SEQ ID NO. 4 and the 501 th base of a nucleotide sequence shown by SEQ ID NO. 7.

2. Use of a combination of molecular markers as claimed in claim 1 or any or two of the molecular markers in the assessment of caffeine content in tea tree.

3. Use of a primer that detects the combination of molecular markers of claim 1 or any or two of the molecular markers therein for the assessment of caffeine content in tea tree.

4. The primer for detecting SNP site 1 according to claim 1, which has a nucleotide sequence as set forth in SEQ ID NO: 2 to 3.

5. The primer for detecting SNP site 2 according to claim 1, which has a nucleotide sequence shown in SEQ ID NO: 5 to 6.

6. The primer for detecting SNP site 3 according to claim 1, which has a nucleotide sequence as set forth in SEQ ID NO: 8 to 9.

A kit for evaluating the caffeine content of Camellia sinensis, comprising reagents for detecting the combination of molecular markers of claim 1 or any or two of the molecular markers.

8. The kit of claim 7, wherein the reagent is any or several of the primers of claims 4 to 6.

A method of for assessing the caffeine content of Camellia sinensis, comprising determining the genotype of the combination of molecular markers of claim 1 or any or two of the molecular markers.

10. Use of the molecular marker combination of claim 1 or any or several molecular markers thereof, the primer of claim 4, the primer of claim 5, the primer of claim 6, or or several of the kits of claim 7 in molecular assisted breeding.