CN110643701B - Tiny RNA marker combination for gestational diabetes and application thereof - Google Patents

Tiny RNA marker combination for gestational diabetes and application thereof Download PDF

Info

Publication number
CN110643701B
CN110643701B CN201911024472.XA CN201911024472A CN110643701B CN 110643701 B CN110643701 B CN 110643701B CN 201911024472 A CN201911024472 A CN 201911024472A CN 110643701 B CN110643701 B CN 110643701B
Authority
CN
China
Prior art keywords
mir
gestational diabetes
marker combination
application
follows
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201911024472.XA
Other languages
Chinese (zh)
Other versions
CN110643701A (en
Inventor
罗茂
方丹
陈然
贺朝晖
吴剑波
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Southwest Medical University
Original Assignee
Southwest Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Southwest Medical University filed Critical Southwest Medical University
Priority to CN201911024472.XA priority Critical patent/CN110643701B/en
Publication of CN110643701A publication Critical patent/CN110643701A/en
Application granted granted Critical
Publication of CN110643701B publication Critical patent/CN110643701B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of biomedicine, and particularly discloses a microRNA marker combination related to gestational diabetes mellitus and application thereof, wherein the microRNA marker combination comprises miR-132 and miR-375. The miR-132 and miR-375 are located in peripheral blood serum or plasma. miR-132 and miR-375 can be used as diagnosis markers of gestational diabetes and provide a basis for early diagnosis of gestational diabetes.

Description

Tiny RNA marker combination for gestational diabetes and application thereof
Technical Field
The invention belongs to the technical field of biomedicine, and particularly relates to a gestational diabetes micro RNA marker combination and application thereof.
Background
Gestational diabetes is a pregnancy complication, at present, the clinical diagnosis is mainly to detect the blood sugar of pregnant women in the middle of pregnancy, and since the gestational diabetes may cause fetal deformity and serious patients harm the health of mothers and babies, the earlier diagnosis of gestational diabetes is more beneficial to patients.
The micro RNA (microRNA) is a non-coding RNA with 18-25 basic groups of molecular weight, is highly conserved in evolution, participates in regulation and control of expression after gene transcription, regulates gene expression after transcription and translation, and has close relation with gestational diabetes due to abnormal expression. Research reports that various microRNAs related to gestational diabetes mellitus, such as miR-222, miR-132, miR-29a and the like, can be detected and analyzed in peripheral blood serum or plasma of pregnant women in early pregnancy, and have important significance for timely diagnosing gestational diabetes mellitus.
However, due to the fact that the detection accuracy of a single microRNA is not enough, false positive or false negative results are prone to occur, the gestational diabetes mellitus is mostly a composition of different microRNAs, such as a composition of miR-222, miR-132 and miR-29a, and a composition of miR-375 and miR-29, but the composition of miR-132 and miR-375 is not seen yet. Although the composition disclosed at present has a certain potential for diagnosing gestational diabetes, due to the slow occurrence of gene mutation, some detection markers are eliminated or the detection precision is reduced, so that the development of the composition of miR-132 and miR-375 as a new gestational diabetes diagnosis marker is particularly necessary, and the application of the composition in the preparation of a gestational diabetes diagnosis kit has important clinical significance.
Disclosure of Invention
In order to solve the technical problems, the invention provides a gestational diabetes micro RNA marker combination and application thereof.
The invention provides a microRNA marker combination for gestational diabetes, which comprises miR-132 and miR-375.
Preferably, the miR-132 and miR-375 are located in peripheral blood serum or plasma.
Preferably, the upstream primer for amplifying miR-132 is as follows: 5' ACACTCCAGCTGGGTAGCAGCACGTAAATA ' 3', and the downstream primer is: 5' CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCGCAATA ' 3';
the upstream primer for amplifying miR-375 is as follows: 5 'CCCTTCTAGACCCAAGGCTGATGCCTGAGAGAG-3', and a downstream primer 5 'AAAGGTCCGCCGCCCGGGCCTCTTC-3'.
The invention also provides application of the micro RNA marker combination related to the gestational diabetes in preparing a gestational diabetes diagnosis kit.
Preferably, the kit comprises a sodium chloride-potassium chloride complex reagent.
Preferably, the formula of the sodium chloride-potassium chloride compound reagent is as follows: the concentration of sodium chloride is 5-10ng/μ L, the concentration of potassium chloride is 5-10ng/μ L, and the solvent is ddH 2 O。
Compared with the prior art, the gestational diabetes micro RNA marker combination and the application thereof provided by the invention have the following beneficial effects:
the innovation points of the invention are as follows:
(1) Gestational diabetes, which is mainly developed during pregnancy, is different from general diabetes, which is caused by various reasons and most of patients have a lifetime.
The existing research results show that the composition of miR-222, miR-132 and miR-29a can be used as a diagnostic marker of gestational diabetes; the composition of miR-375 and miR-29 can be used as a diagnostic marker of gestational diabetes; however, the composition of miR-132 and miR-375 can be used as a diagnostic marker of gestational diabetes mellitus. Due to the fact that the sensitivity degrees of different combined markers are different, the marker combination can be selected, the detection sensitivity can be improved, and the result reliability can be improved.
(2) The different reagents used by the detection kit are also important means for improving the detection sensitivity, and the detection sensitivity can be improved by matching with a sodium chloride-potassium chloride composite reagent with a certain concentration under the conditions of the selected miR-132 and miR-375 markers.
Detailed Description
The present invention is described in detail below with reference to specific examples, but the present invention should not be construed as being limited thereto. The experimental procedures in the following examples were carried out in a conventional manner unless otherwise specified, and materials, reagents and the like used in the following examples were commercially available unless otherwise specified.
The invention provides a microRNA marker combination related to gestational diabetes, which comprises miR-132 and miR-375. The miR-132 and miR-375 are located in peripheral blood serum or plasma.
To verify the effect of the marker combinations described above, we performed the following experiments:
50 pregnant women with gestational diabetes mellitus select fasting peripheral blood as experimental group, and 50 pregnant women with normal glucose tolerance test select fasting peripheral blood as control group. The data statistics adopts SPSS software to compare that P is less than 0.05, and the difference has statistical significance.
The screening criteria for pregnant women are as follows: 1. has no hereditary history, 2, no other combined symptoms, only shows gestational diabetes or normal (excluding the influence of other factors on gestational diabetes), 3, body Mass Index (BMI) is 18-25kg/m in the ideal range 2 4, 16-25 weeks gestation week, 5, 20-35 years old.
The fasting blood glucose and fasting insulin of the pregnant women in the statistical experimental group and the pregnant women in the control group are respectively detected, and the results are shown in table 1. From the fasting blood sugar and the fasting insulin of the pregnant women, the fasting blood sugar of the pregnant women with the gestational diabetes is high and normal, and the fasting insulin value is smaller than that of the normal group.
TABLE 1 fasting plasma glucose and fasting insulin of different pregnant women
Experimental group Control group
Fasting blood glucose FPG (mmol/L) 8.8±2.4 15.8±3.6
Fasting insulin FINS mean (mIU/L) 4.9±1.0 26.7±8.3
P ＜0.05 ＜0.05
Example 1 detection of miR-132 and miR-375 in peripheral blood of pregnant women with gestational diabetes
miR-132 and miR-375 are used for detecting serum RNA extracted according to the instruction of an RNA extraction kit (Invitrogen Ambion), reverse transcription is carried out according to the instruction of a TaqMan reverse transcription kit (American APPS company), and then RT-PCR reaction is carried out on different samples by taking a reverse transcription product as a template.
The upstream primer for amplifying miR-132 is as follows: 5 'ACACTCCAGCTGGGTAGCAGCACGTAAATA-3', shown in SEQ ID NO.1,
the downstream primer is: 5 'CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCGCAATA-3', SEQ ID NO.2;
the upstream primer for amplifying miR-375 is as follows: 5.
The RT-PCR amplification conditions of miR-132 and miR-375 are the same, and are 10min at 95 ℃;95 ℃ 15s,60 ℃ 60s,45 cycles.
The RT-PCR amplification system of miR-132 and miR-375 is as follows: RT-PCR was performed in a 21. Mu.L system using a 2 XSSYBR Green Mix reaction kit from Bori science, inc. according to the kit instructions.
Calculating Ct value by taking U6 Sn RNA as internal reference, and expressing relative expression quantity by 2-delta Ct, wherein delta Ct = C t sample -C t internal reference And calculating the relative expression amount of the sample aiming at the U6 Sn RNA. The relative expression amounts of the microRNAs of different groups are shown in Table 2, and the results show that miR-132 and miR-375 in the experimental group and the control group are remarkably different. The data of tables 1-2 were analyzed in combination.
TABLE 2 relative expression levels of microRNAs of different groups
Experimental group Control group
miR-132 10.67±2.3 18.63±3.1
miR-375 72.2±16.9 24.1±7.4
P ＜0.05 ＜0.05
Example 2 influence of different RT-PCR reaction systems on relative expression response values of miR-132 and miR-375 of non-pregnant diabetic patients.
And (2) detecting by using different RT-PCR reaction systems by taking cDNA obtained by reverse transcription of RNA extracted from the peripheral blood serum of the non-pregnant diabetic patient obtained in the example 1 as a template, wherein amplification primers and amplification conditions of miR-132 and miR-375 are the same as those in the example 1. The different reaction system settings were as follows:
reagent blank group: RT-PCR was performed in a 21. Mu.L system using the 2 XSSYBR Green Mix reaction kit from Bori science and technology, according to the kit instructions. ddH for cDNA in reagent blank group 2 O dissolved and the final concentration of cDNA was 20 ng/. Mu.L.
Reagent experimental group: essentially the same reaction system as the reagent blank except that equal volume of sodium chloride-potassium chloride complex reagent was used in place of ddH 2 O to achieve the purpose of dissolving cDNA. The concentration of sodium chloride in the sodium chloride-potassium chloride composite reagent is 5 ng/mu L, the concentration of potassium chloride is 5 ng/mu L, and the solvent is ddH 2 O。
The relative expression amounts of miR-132 and miR-375 in a reagent blank group and a reagent experimental group are respectively measured by the method in reference example 1, each group is tested in triplicate, and the results are shown in Table 3. As can be seen from the data in Table 3, the relative expression amounts of miR-132 and miR-375 in the reaction system of the sodium chloride-potassium chloride composite reagent are both improved, which indicates that the reaction actually has a higher response value, and is better suitable for the conditions that the content of miR-132 and miR-375 in blood is lower, the amount of the extracted cDNA template is less, and the sensitivity of the detection result is increased.
TABLE 3 relative expression amounts of microRNAs in different reaction systems
Figure BDA0002248245870000061
Figure BDA0002248245870000071
Example 3 influence of different RT-PCR reaction systems on relative expression response values of miR-132 and miR-375 of gestational diabetes patients.
In the case of the example 3, the following examples,
example 3 the same test conditions as in example 2 were set up using different RT-PCR reaction systems using cDNA reverse transcribed from RNA extracted from peripheral blood serum of a pregnant diabetic patient obtained in example 1 as a template. The results are shown in Table 4. In the table 4, in the reaction system of the sodium chloride-potassium chloride composite reagent, the relative expression amounts of miR-132 and miR-375 are both improved, which indicates that the reaction actually has a higher response value, and is better suitable for the conditions that the contents of miR-132 and miR-375 in blood are lower, and the amount of the extracted cDNA template is less, and the sensitivity of the detection result is increased.
TABLE 4 relative expression amounts of microRNAs in different reaction systems
Figure BDA0002248245870000072
Figure BDA0002248245870000081
While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including the preferred embodiment and all changes and modifications that fall within the scope of the invention.
It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.
Sequence listing
<110> southwest university of medical science
<120> gestational diabetes micro RNA marker combination and application thereof
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 30
<212> DNA
<213> Artificial sequence
<400> 1
acactccagc tgggtagcag cacgtaaata 30
<210> 2
<211> 44
<212> DNA
<213> Artificial sequence
<400> 2
ctcaactggt gtcgtggagt cggcaattca gttgagcgcc aata 44
<210> 3
<211> 31
<212> DNA
<213> Artificial sequence
<400> 3
ccctctagac cccaaggctg atgctgagaa g 31
<210> 4
<211> 29
<212> DNA
<213> Artificial sequence
<400> 4
aaaggtccgc cgcccggccc cgggtcttc 29

Claims (2)

1. The application of the microRNA marker combination related to gestational diabetes in the preparation of a gestational diabetes diagnosis kit is characterized in that the microRNA marker combination comprises miR-132 and miR-375;
the upstream primer for amplifying miR-132 is as follows: 5' ACACTCCAGCTGGGTAGCAGCACGTAAATA ' 3', and the downstream primer is: 5' CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCGCAATA ' 3';
the upstream primer for amplifying miR-375 is as follows: 5' CCCTTCTAGACCCAAGGCTGATGCTGAGAAG-;
the kit comprises a sodium chloride-potassium chloride composite reagent;
the formula of the sodium chloride-potassium chloride compound reagent is as follows: the concentration of sodium chloride is 5-10ng/μ L, the concentration of potassium chloride is 5-10ng/μ L, and the solvent is ddH 2 O。
2. The application of the microRNA marker combination related to gestational diabetes mellitus in the preparation of a gestational diabetes mellitus diagnostic kit according to claim 1, wherein the miR-132 and miR-375 are located in peripheral blood serum or plasma.
CN201911024472.XA 2019-10-25 2019-10-25 Tiny RNA marker combination for gestational diabetes and application thereof Active CN110643701B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911024472.XA CN110643701B (en) 2019-10-25 2019-10-25 Tiny RNA marker combination for gestational diabetes and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911024472.XA CN110643701B (en) 2019-10-25 2019-10-25 Tiny RNA marker combination for gestational diabetes and application thereof

Publications (2)

Publication Number Publication Date
CN110643701A CN110643701A (en) 2020-01-03
CN110643701B true CN110643701B (en) 2023-03-14

Family

ID=68994736

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911024472.XA Active CN110643701B (en) 2019-10-25 2019-10-25 Tiny RNA marker combination for gestational diabetes and application thereof

Country Status (1)

Country Link
CN (1) CN110643701B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114622009A (en) * 2022-02-28 2022-06-14 广州天源高新科技有限公司 miRNA molecular marker for early diagnosis of gestational diabetes and application thereof
CZ309886B6 (en) * 2022-08-12 2024-01-10 GeneSpector s.r.o. A gestational diabetes mellitus prediction method according to the expression profile of cardiovascular miRNAs

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102031261A (en) * 2010-10-27 2011-04-27 南京医科大学 Serum/plasma miRNA (micro Ribonucleic Acid) marker relevant to gestational diabetes and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102031261A (en) * 2010-10-27 2011-04-27 南京医科大学 Serum/plasma miRNA (micro Ribonucleic Acid) marker relevant to gestational diabetes and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Diabetes in Pregnancy and MicroRNAs: Promises and Limitations in Their Clinical Application.;Adriana Ibarra等;《Non-coding RNA》;20181112;第4卷(第32期);第ncrna4040032篇 *
妊娠期糖尿病妇女外周血miR-29、miR-375的表达及临床意义.;李伟 等;《南京医科大学学报》;20140331;第34卷(第3期);第334页摘要，第336页左栏第1段 *

Also Published As

Publication number Publication date
CN110643701A (en) 2020-01-03

Similar Documents

Publication Publication Date Title
CN103555724B (en) The Serum miRNA biomarker of diabetes B and application thereof
EP3369826B1 (en) Biomarker microrna for prediction of prognosis of head and neck cancer
Qin et al. Long non-coding RNA H19 is associated with polycystic ovary syndrome in Chinese women: a preliminary study
CN110643701B (en) Tiny RNA marker combination for gestational diabetes and application thereof
CN109797222B (en) Liver cancer diagnosis marker, detection primer, kit and application of liver cancer diagnosis marker
Lasabová et al. Overexpression of miR-21 and miR-122 in preeclamptic placentas
CN105420405A (en) Bovine serum microRNA molecular marker of milk cow fatty liver disease and milk cow perinatal period-associated metabolic disease
CN104450707B (en) A kind of application of Serum miRNA biomarker
CN111004850A (en) Application of circRNAs molecules in preparation of liver cancer diagnosis kit and kit applying molecules
CN111455044B (en) Exosome miRNA marker for early pregnancy diagnosis of ewes and application thereof
Liu et al. Low expression of miR-203 promoted diabetic nephropathy via increasing TLR4.
CN110387414B (en) Model for predicting gestational diabetes by using peripheral blood free DNA
CN103122387B (en) Rapid circulating tumor cell (CTCs) fluorescence PCR (Polymerase Chain Reaction) hypersensitivity detection kit and application thereof
CN106676167A (en) MiR-192 serving as specificity biomarker for early diagnosis of diabetic kidney disease and application of MiR-192
CN108300788B (en) Micro ribonucleic acid composition for detecting light brain trauma and application thereof
CN112852946A (en) Diagnostic biomarker and application thereof
CN110656171B (en) Use of small nucleolus ribonucleic acid SNORD33 as biomarker for preparing detection kit
CN109735612B (en) Biomolecule marker of Kawasaki disease coronary aneurysm complication and kit thereof
CN111321219A (en) Use of ACTA2 methylation as a diagnostic marker for asthma
CN111808966B (en) Application of miRNA in diagnosis of breast cancer disease risk
CN112266955B (en) Ankylosing spondylitis diagnostic marker and application thereof
CN113736877A (en) Pre-eclampsia diagnostic use and composition based on micro RNA27a
KR102165841B1 (en) Biomarker microRNA let-7b or microRNA-664a for diagnosing diabetes and use thereof
US11328791B2 (en) Method for determining the risk of developing acute kidney injury in a human subject with acute myocardial infarction and inhibiting such development
Sambashivaiah et al. Detection of differentially expressed circulating micro-RNA among Indians with Type 2 Diabetes using a global expression profile and systematic analysis

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant