CN103555724B - The Serum miRNA biomarker of diabetes B and application thereof - Google Patents
The Serum miRNA biomarker of diabetes B and application thereof Download PDFInfo
- Publication number
- CN103555724B CN103555724B CN201310508125.0A CN201310508125A CN103555724B CN 103555724 B CN103555724 B CN 103555724B CN 201310508125 A CN201310508125 A CN 201310508125A CN 103555724 B CN103555724 B CN 103555724B
- Authority
- CN
- China
- Prior art keywords
- hsa
- mir
- mirna
- patients
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of serum miRNA composition, is following serum miRNA:hsa-miR-23a, at least one in hsa-let-7i, hsa-miR-486.The present invention also provides the fluorescent quantitation detected for 2-patients with type Ⅰ DM simultaneously and detects Primer composition, comprises hsa-miR-23a, the RT primer of each miRNA, FW primer and RV primer in hsa-let-7i, hsa-miR-486.The serum miRNA marker assessed for the early diagnosis of 2-patients with type Ⅰ DM and risk provided by the invention, utilizes this Serum miRNA biomarker to can be used for diagnosing experimenter whether to suffer from 2-patients with type Ⅰ DM or the early diagnosis of 2-patients with type Ⅰ DM and risk and assesses.
Description
Technical field
The invention belongs to biotechnology and medical field, relate to a kind of for diabetes B detect and early diagnosis based on the biomarker of serum miRNA and the detection method of expression amount thereof.
Background technology
Diabetes are a kind of important endocrine metabolism chronic diseases, and the diabetic subject's number whole world increases fast, has become the third-largest Non Communicable Diseases (NCD) of the harm humans health after cardiovascular disorder, tumour.According to the suggestion of WHO, diabetes can be divided into type 1 diabetes, diabetes B, specificity diabetes and gestational diabetes.
Diabetes B is also Adult Onset's patients with type Ⅰ DM, how the sequela of 35 ~ 40 years old, accounts for diabetic subject more than 90%.At present, the index for the diagnosis of 2-patients with type Ⅰ DM and classification comprises: fasting plasma glucose (FPG), oral glucose tolerance test 2 hours blood glucose (OGTT2h), Glycohemoglobin HbA1c and comprise the typical diabetic symptom of diuresis, polydipsia and the weight loss without other inducements.But these methods are mainly used in the diagnosis and classification of having diabetes, early diagnosis and risk assessment cannot be carried out.About the clinical criteria of 2-patients with type Ⅰ DM, China adopts WHO(1999 at present) diabetes diagnostic criterion (table 1).
Table 1 carbohydrate metabolism is classified
IFG or IGT is referred to as IGR (IGR, i.e. pre-diabetes).
MiRNA is the noncoding RNA of a class, miRNA is the important regulating and controlling factor of genetic expression, in the generation evolution of the growth of biology, growth and differentiation and various diseases, play different roles, miRNA plays very important effect in carbohydrate metabolism and lipid metabolism regulation and control.MiRNA suppresses translation by the specific position that is combined in the 3 ＇-non-coding region of said target mrna or said target mrna is degraded.Circulation miRNA has good application prospect as the molecular marker of the diagnosis and prognosis of cancer, cardiovascular disorder etc.
MiRNA and Regular Insulin generate, the growth of insulin secretion, insulin activity and pancreas islet etc. is all closely related, may play very important effect in the pathogenic process of diabetes.Although obtained a lot of progress about the relation research between miRNA and pathogenesis of diabetes mellitus, great majority are miRNA expression and functional studies in diabetes animal model and illing tissue, about the research of diabetics's serum miRNA is also fewer, need further deeply.
The 2-patients with type Ⅰ DM especially monitoring of Susceptible population and risk assessment is the powerful guarantee taking early intervention measure and effective containment Present Global diabetes outburst trend.Although have OGTT2h and HbA1c to the dependent diagnostic standard of 2-patients with type Ⅰ DM at present, but at present clinically still effective means is lacked to the early diagnosis of 2-patients with type Ⅰ DM and risk assessment, need responsive and specific Non-Invasive serological index, especially based on the non-invasive index of miRNA.
Summary of the invention
The technical problem to be solved in the present invention is to provide the serum miRNA marker that a class is assessed for the early diagnosis of 2-patients with type Ⅰ DM and risk, utilizes this Serum miRNA biomarker to can be used for diagnosing experimenter whether to suffer from 2-patients with type Ⅰ DM or the early diagnosis of 2-patients with type Ⅰ DM and risk and assesses.
In order to solve the problems of the technologies described above, the invention provides a kind of serum miRNA composition, for following serum miRNA:hsa-miR-23a, at least one in hsa-let-7i, hsa-miR-486 (being any one or the combination of any two kinds or the combination of 3 kinds):
The miRNA sequence of hsa-miR-23a is: AUCACAUUGCCAGGGAUUUCC;
The miRNA sequence of hsa-let-7i is: UGAGGUAGUAGUUUGUGCUGUU;
The miRNA sequence of hsa-miR-486 is: UCCUGUACUGAGCUGCCCCGAGC.
Improvement as miRNA combination thing of the present invention: serum miRNA composition comprises: namely hsa-miR-23a, hsa-let-7i and hsa-miR-486(, are made up of hsa-miR-23a, hsa-let-7i and hsa-miR-486).
The present invention also provides a kind of fluorescent quantitation detection Primer composition detected for 2-patients with type Ⅰ DM simultaneously, and this Primer composition comprises the detection primer of each miRNA in serum miRNA composition described in claim 1;
The sequence of the RT primer of each miRNA, FW primer (forward primer) and RV primer (reverse primer) is as follows:
The improvement of Primer composition is detected: fluorescent quantitation detects primer and comprises: the detection primer of hsa-miR-23a, hsa-let-7i and hsa-miR-486 tri-kinds of miRNA as the fluorescent quantitation for the detection of 2-patients with type Ⅰ DM of the present invention.
The present invention also provides the application of above-mentioned serum miRNA composition in the diagnostic reagent preparing 2-patients with type Ⅰ DM and pre-diabetes or instrument simultaneously.
The present invention also provides above-mentioned serum miRNA simultaneously and detects the application of primer in the diagnostic reagent preparing 2-patients with type Ⅰ DM and pre-diabetes or instrument.
Present invention also offers detection method and the application thereof of miRNA expression amount.The invention provides the reverse transcription-fluorescent quantitative PCR technique based on stem ring (SYBR Green dye method) detecting Serum miRNA biomarker.
The determination method of 2-patients with type Ⅰ DM serum miRNA involved in the present invention, comprises the steps:
(1) serum sample collection and clinical grouping: gather serum sample from hospital, simultaneity factor collects complete demography and Clinical Laboratory data.
(2) extract test kit (TRK-1001) with the biological RNA in connection river and extract total serum IgE from tested sample serum, filter out candidate miRNA by Solexa/Illumina high-flux sequence;
(3) real time fluorescence quantifying PCR method (SYBR Green dye method) screening is adopted to can be used as detecting the miRNA of mark.
The detection method that the present invention uses can be selected from: one or more in RT-PCR method, Solexa sequencing technologies, Real-time PCR method.
Invention further discloses serum as important biomarker, effect in the diagnosis of 2-patients with type Ⅰ DM, particularly illustrate the value that has-miR-23a assesses in the early diagnosis of 2-patients with type Ⅰ DM and risk, for the research of diabetes serum miRNA from now on provides theoretical foundation, and provide new thought for the molecular diagnosis of diabetes, there is certain theory significance and potential practical value.
Accompanying drawing explanation
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.
Fig. 1 is the main flow figure of miRNA biomarker of the present invention screening;
A, B, C of Fig. 2 are that display hsa-miR-23a, hsa-let-7i, hsa-miR-486 express and there is notable difference comparison diagram in 2-patients with type Ⅰ DM (T2D), pre-diabetes (IGT/FGT) patient and normal glucose tolerance (NGT) control group respectively;
Fig. 3 is display hsa-miR-23a, hsa-let-7i, hsa-miR-486 and hsa-miR-199a are as result figure during marker, 2-patients with type Ⅰ DM (T2D), pre-diabetes (IGT/FGT) patient and normal glucose tolerance (NGT) control group being carried out to cluster analysis;
Fig. 4 is display hsa-miR-23a, hsa-let-7i, hsa-miR-486, for the ROC analysis chart that 2-patients with type Ⅰ DM (T2D) is diagnosed;
Fig. 5 is the ROC analysis chart that display has-miR-23a diagnoses for pre-diabetes (IGT/FGT).
Embodiment
The invention will be further elaborated by the following examples.
The collection of embodiment 1, clinical sample and the arrangement of clinical data.
The present inventor obtains a large amount of serum sample that Zhejiang Prov. Hospital of Traditional Chinese Medicine provides between in November, 2011 in March, 2013, and simultaneity factor have collected complete sample demography and Clinical Laboratory data.Adopting WHO(1999) collection clinical sample is divided into normal glucose tolerance (NGT), pre-diabetes (IFG/IGT) and 2-patients with type Ⅰ DM (T2D) three groups by diabetes diagnostic criterion (see table 1).With reference to WHO(1999) the multi-class classification standard (table 1) of diabetes diagnostic criterion.
Embodiment 2,2-patients with type Ⅰ DM serological specificity miRNA express spectra Solexa/Illumina high-flux sequence primary dcreening operation
(1) screening of order-checking sample: by the arrangement to sample data, the present inventor have selected 5 routine 2-patients with type Ⅰ DM (T2D) (50.60 ± 5.13 from the clinical serum sample collected, age range 42-55, man: 3, female: serum sample 2), abundant mixing, mixes sample (i.e. T2D group) as 2-patients with type Ⅰ DM case group.(44.40 ± 9.60, age range 34-58, man: 4, female: serum sample 1), fully mixes, as Normal group (NGT group), as the experiment sample of Solexa/Illumina high-flux sequence primary dcreening operation to choose 5 routine normal glucose tolerances (NGT) in addition.
(2) use Illumina Truseq Small RNA Preparation kit test kit reference reagent box to illustrate that Illumina ' s TruSeq Small RNA Sample Preparation Guide extracts the total serum IgE of T2D group and NGT group respectively, build tiny RNA storehouse.
(3) the tiny RNA storehouse that builds of cDNA(A and step (2)) purified after on Illumina ' s Cluster Station, generate DNA bunch be namely available on the machine (Illumina GAIIx) check order.
(4) according to Solexa sequencing result (entrust and checked order by LC company), the copy number of our selections in 2-patients with type Ⅰ DM (T2D) is the candidate miRNA of preliminary examination in miRNA the present invention of copy number 4 times in normal glucose tolerance (NGT) control group, and the copy number of these miRNA in 2-patients with type Ⅰ DM people is all greater than 50 copies.By screening, we have selected: hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-146a-5p, hsa-miR-186-5p, hsa-miR-191-5p, hsa-miR-192-5p, hsa-miR-199a-5p, hsa-miR-23a-3p, hsa-miR-96-5p, hsa-miR-486-5p totally 10 miRNA as alternative miRNA.
Remarks illustrate: these miRNA may parts known relevant to diabetes, but the detection, particularly serum of clear and definite and diabetes are as the dependency of diagnostic sample.
Table 2,2-patients with type Ⅰ DM (T2D) and normal glucose tolerance (NGT) serum Solexa sequencing result
The real time fluorescence quantifying PCR method checking of embodiment 3,2-patients with type Ⅰ DM serum candidate miRNA.
(1) screening of sample: by the arrangement to sample data, the present inventor have selected 24 routine 2-patients with type Ⅰ DM (T2D) (51.13 ± 9.21 from the clinical serum sample collected, age range 28-64, man: 16,8), 20 routine pre-diabeteses (IGT/FGT) (52.40 ± 11.00 female:, age range 31-65, man: 12, female: 8) and 20 routine normal glucose tolerances (NGT) (46.65 ± 16.18, age range 26-75, man: 8, female: 12) as the experiment sample that the real time fluorescence quantifying PCR method of serum candidate miRNA is verified.
Remarks illustrate: each sample standard deviation is determined as follows separately.
(2) extraction of serum total serum IgE:
1., after serum being taken out from-80 DEG C of refrigerators, be positioned over and slowly thaw on ice.In course of defrosting, to be turned upside down mixing every 5min, accelerate thawing speed, and the homogeneity on the contents temperature of sample thawing part can be ensured, prevent white precipitate and separate out.Extract test kit (TRK-1001) with the biological RNA in connection river and extract total serum IgE respectively from the serum of tested sample (comprising pre-diabetes and 2-patients with type Ⅰ DM) and check sample (normal glucose tolerance NGT), concrete steps are as follows:
2. get the serum (that is, the serum after thawing) that 200 μ L handle well, add 600 μ L lysates and 6 μ L beta-mercaptoethanols, mixing.
3. 800 μ L95%(volume % are added) ethanol, mixing.
4. install on collection tube by pillar, add the lysate (that is, step gains 3.) of 650 μ L containing ethanol on pillar, the centrifugal 1min of room temperature 14000 × g, discards downstream liquid, repeats this step until the lysate containing ethanol all passes through pillar.
5. discard downstream liquid, then add 400 μ L95% ethanol on pillar, the centrifugal 1min of 14000 × g, discards downstream liquid.Repeat this step twice again.
6. the centrifugal 2min of 14000 × g.
7. by posts transfer to 1.5mL collection tube, add 50 μ L RNA Elution solution on pillar, the centrifugal 2min of 200 × g; Room temperature, the centrifugal 1min of 14000 × g; Pillar is turned a direction, room temperature, the centrifugal 1min of 14000 × g.
8. remove purification column, retain centrifugal after sample, in-80 DEG C of preservations, for subsequent use.
(3) detection primer and probe sequence
1) miRNA loop-stem structure reverse transcription primer:
hsa-let-7i GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACAGC
hsa-miR-122 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAAACA
hsa-miR-146a GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCCA
hsa-miR-186 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCCCA
hsa-miR-191 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGCTG
hsa-miR-192 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCTGT
hsa-miR-199a GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGAACAG
hsa-miR-23a GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGAAAT
hsa-miR-96 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCAAA
mml-miR-486 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTCGGG
RNU6B GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAAT
2) PCR forward primer is respectively:
hsa-let-7i GCGGGTGAGGTAGTAGTTTGTG
hsa-miR-122 GCGATGGAGTGTGACAATGGT
hsa-miR-146a CGGCGGCTGAGAACTGAAT
hsa-miR-186 GGCGGCAAAGAATTCTCCTT
hsa-miR-191 TTAGCAACGGAATCCCAAAAG
hsa-miR-192 TCGGCTGCTGACCTATGAAT
hsa-miR-199a CGCGGCCCAGTGTTCAG
hsa-miR-23a GACGCCATCACATTGCCAG
hsa-miR-96 GGCATTTGGCACTAGCACAT
mml-miR-486 CGCCGTCCTGTACTGAGCA
RNU6B CAAATTCGTGAAGCGTTCCATA
3) the universal PC R reverse primer of miRNA:
hsa-let-7i CAGTGCAGGGTCCGAGGTAT
hsa-miR-122 CAGTGCAGGGTCCGAGGTAT
hsa-miR-146a CAGTGCAGGGTCCGAGGTAT
hsa-miR-186 CAGTGCAGGGTCCGAGGTAT
hsa-miR-191 CAGTGCAGGGTCCGAGGTAT
hsa-miR-192 CAGTGCAGGGTCCGAGGTAT
hsa-miR-199a CAGTGCAGGGTCCGAGGTATT
hsa-miR-23a CAGTGCAGGGTCCGAGGTAT
hsa-miR-96 CGCAGGGTCCGAGGTATTC
mml-miR-486 CGCAGGGTCCGAGGTATTC
RNU6B AGTGCAGGGTCCGAGGTATTC
(4) detection method of miRNA expression amount in serum
Adopting qRT-PCR(SYBR Green I dye method) method detects miRNA expression amount in serum.
1. from-80 DEG C of refrigerators, take out the serum miRNA sample extracted, dissolve on ice.Take out normal temperature placement by being equipped with the primer box prepared simultaneously.
2. cDNA synthesis:
1) reverse transcription synthesis cDNA
Add successively in without the 0.2ml PCR pipe of RNase:
Serum total serum IgE 5.00 μ l
RT primer (2 μMs) 1.00 μ l
Cumulative volume 6.00 μ l
RT primer is miRNA loop-stem structure reverse transcription primer.
65 DEG C of sex change 10min, place 3min on ice, then add successively
Note: for every bar miRNA arranges the negative control without template.
Slightly centrifugally after mixing to react in PCR instrument; Reaction process:
42℃ 60min
70℃ 5min
4 DEG C of preservations
The present invention we respective specificity loop-stem structure reverse transcription primer is devised to often kind of miRNA, as above operate separately, single tube synthesis cDNA.
2) Realtime-PCR: RT product (cDNA) is carried out pcr amplification reaction reaction system following (each reaction 20 μ l, 3 repetitions established by each sample):
Note: Pmix is primer mixture, is forward primer and reverse primer Mix, and by the English Weihe River, prompt base (Shanghai) trade Co., Ltd synthesizes, and forward primer and the mixed concentration of reverse primer are respectively 10 μMs.First add water in centrifuge tube during dilution, be then added under liquid level by liquid primer, vibration mixes, more centrifugal, for subsequent use.
By 96 orifice plate pad pastings after adding, use roller compacting, cover screening film, upper machine ABI PRISM7900HT type quantitative real time PCR Instrument runs.Fluorescent quantitation flow process is as follows:
(5) data analysis and process
During the relative expression quantity of quantitative fluorescent PCR detection by quantitative miRNA, take RNU6B as reference gene, target gene is normalized, guaranteed the amount of comparison object gene in the sample of equal amount.CT value represents the number of times that object miRNA molecule reaches the PCR circulation needed for experimental design threshold value, when CT value is greater than 35, thinks and does not contain this miRNA in sample.The change formula RQ=2 of expression amount multiple
-△ △ CT, wherein △ △ CT=(CT
miRNA-CT
rNU6B) DM-(CT
miRNA-CT
rNU6B) Mean
nGT.RQ represents relative expression quantity (relative quantation), CT
miRNAand CT
rNU6Brepresent the CT value of target miRNA that fluorescent quantitation detects and reference gene RNU6B respectively, DM represents 2-patients with type Ⅰ DM or pre-diabetic's serum, and NGT represents normal glucose tolerance control group serum, Mean
nGTrepresent the mean value in all Normal groups.Upper data, namely CT value all can be detected by fluorescent quantitative detector and obtain after normalized.Set up quantitatively and repeat experiment and negative control experiment, each sample of quantitative experiment repeats 3 times, does not add template cDNA in negative control, and replaces with water, whether there is PCR pollution and the pollution of higher primer dimer for checking.The statistical analysis of fluorescent quantitation data adopts SPSS19.0 statistical analysis software.The relative expression quantity of 2-patients with type Ⅰ DM, miRNA between pre-diabetes and normal glucose tolerance control group carries out independent sample T inspection respectively by one-dimensional variance analysis, calculates and obtains corresponding P value.
According to qRT-PCR result, we pick 3 differential expression is obvious and identical with order-checking primary dcreening operation result in diabetes B, pre-diabetes and normal glucose tolerance control group microRNAs:hsa-miR-23a, hsa-let-7i, hsa-miR-486 from aforesaid 10 candidate microRNAs, and expression analysis result as shown in Figure 2.As can be seen from the figure, relative to normal glucose tolerance (NGT) control group, in serum, the expression level of hsa-miR-23a obviously lowers (P=2.87E-05) in 2-patients with type Ⅰ DM (T2D) case, and pre-diabetes (IFG/IGT) also obviously lowers (P=3.75E-02); Hsa-miR-23a expression level also exists notable difference (P=1.06E-02) (A) at 2-patients with type Ⅰ DM (T2D) and pre-diabetes (IFG/IGT).So hsa-miR-23a may be the biological marker of the early diagnosis of 2-patients with type Ⅰ DM and risk assessment.In addition, the expression level of hsa-let-7i and hsa-miR-486 also all obviously lowers (P is respectively 5.68E-03 and 3.95E-02) (B in 2-patients with type Ⅰ DM (T2D) case, C), also certain values may be had as 2-patients with type Ⅰ DM diagnosis marker.
Remarks illustrate: generally speaking, when P value≤0.05, think that result has significant difference statistically, as P value <0.01, think that result has pole significant difference statistically.
As marker, cluster analysis is carried out to data Mev4.9 using above-mentioned 3 microRNAs, the results are shown in Figure 3.As can be seen from the figure, with hsa-miR-23a, hsa-let-7i and hsa-miR-486 as markers, 2-patients with type Ⅰ DM (T2D), pre-diabetes (IFG/IGT) and normal glucose tolerance (NGT) can obviously can be separated with control group cluster.
(6) ROC analysis and diagnosis value assessment
In order to assess hsa-miR-23a, the diagnosis capability of hsa-let-7i and hsa-miR-486 in 2-patients with type Ⅰ DM (T2D) and pre-diabetes (IFG/IGT) detect, the present inventor is to 2-patients with type Ⅰ DM (T2D), the qRT-PCR result of pre-diabetes (IFG/IGT) and normal glucose tolerance (NGT) control group has carried out risk score, reference interval with 5% or 95% of every bar microRNA expression amount is for value-at-risk, by drawing ROC curve and area AUC under calculated curve, evaluate every bar miRNA at diagnosis 2-patients with type Ⅰ DM and the Sensitivity and Specificity of pre-diabetes.The ROC analytical results that hsa-miR-23a, hsa-let-7i and hsa-miR-486 diagnose for 2-patients with type Ⅰ DM as shown in Figure 4, (A) area under curve of hsa-miR-23a is 0.835(95%CI:0.717-0.954), sensitivity 66.7%, specificity 90.0%; (B) area under curve of hsa-let-7i is 0.771(95%CI:0.629-0.913), sensitivity 66.7%, specificity 85.0%; (C) area under curve of hsa-miR-486 is 0.698(95%CI:0.540-0.856), sensitivity 79.2%, specificity 60.0%.(D) combined analysis hsa-miR-23a, hsa-let-7i and hsa-miR-486, its area under curve is 0.844(95%CI:0.727-0.960), sensitivity 62.5%, specificity 90.0%.
As shown in Figure 5, the area under curve of hsa-miR-23a is 0.690(95%CI:0.525-0.855 to the ROC analytical results that hsa-miR-23a diagnoses for 2 pre-diabeteses), sensitivity 60.0%, specificity 75.0%.The above analysis result, illustrate that these three microRNAs have to 2-patients with type Ⅰ DM and pre-diabetes diagnosis the biomarker application that good diagnostic value, particularly hsa-miR-23a can be used as 2-patients with type Ⅰ DM and pre-diabetes early diagnosis and risk assessment.
Finally, it is also to be noted that what enumerate above is only several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, many distortion can also be had.All distortion that those of ordinary skill in the art can directly derive from content disclosed by the invention or associate, all should think protection scope of the present invention.
Claims (2)
1. serum miRNA composition, is characterized in that: be made up of following serum miRNA:hsa-miR-23a, hsa-let-7i and hsa-miR-486;
The miRNA sequence of hsa-miR-23a is: AUCACAUUGCCAGGGAUUUCC;
The miRNA sequence of hsa-let-7i is: UGAGGUAGUAGUUUGUGCUGUU;
The miRNA sequence of hsa-miR-486 is: UCCUGUACUGAGCUGCCCCGAGC.
2. the fluorescent quantitation detected for 2-patients with type Ⅰ DM detects Primer composition, it is characterized in that the detection primer of this Primer composition for miRNA each in serum miRNA composition described in claim 1;
The sequence of the RT primer of each miRNA, FW primer and RV primer is as follows:
Described fluorescent quantitation detects primer and is made up of the detection primer of these three kinds of miRNA of hsa-miR-23a, hsa-let-7i and hsa-miR-486.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310508125.0A CN103555724B (en) | 2013-10-24 | 2013-10-24 | The Serum miRNA biomarker of diabetes B and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310508125.0A CN103555724B (en) | 2013-10-24 | 2013-10-24 | The Serum miRNA biomarker of diabetes B and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103555724A CN103555724A (en) | 2014-02-05 |
| CN103555724B true CN103555724B (en) | 2015-08-05 |
Family
ID=50010076
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310508125.0A Expired - Fee Related CN103555724B (en) | 2013-10-24 | 2013-10-24 | The Serum miRNA biomarker of diabetes B and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103555724B (en) |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105214101A (en) * | 2015-10-13 | 2016-01-06 | 哈尔滨医科大学 | A kind ofly be used for the treatment of non-coding RNA of the slow and diabetes-related complication of diabetes wound healing and uses thereof |
| CN106609301B (en) * | 2015-10-26 | 2019-10-25 | 北京大学人民医院 | A kind of kit of auxiliary diagnosis type 1 diabetes |
| CN106148537B (en) * | 2016-08-08 | 2019-05-24 | 南京市妇幼保健院 | One kind serum relevant to diabetes B or blood plasma miRNA marker and its application |
| CN106119385B (en) * | 2016-08-11 | 2019-03-05 | 河南大学 | A kind of miRNA molecule marker hsa-miR-149-3p of diagnosed type 2 diabetic and its application |
| CN108676871B (en) * | 2018-07-09 | 2020-03-06 | 中国人民解放军军事科学院军事医学研究院 | Diagnostic marker for type II diabetes |
| CN111073973A (en) * | 2019-12-10 | 2020-04-28 | 石河子大学 | MicroRNA sequence for early diagnosis of type 2 diabetes and application thereof |
| WO2023032452A1 (en) * | 2021-08-31 | 2023-03-09 | 国立大学法人大阪大学 | Test method for type-2 diabetes and colon cancer |
| CN113750110B (en) * | 2021-09-14 | 2023-04-07 | 山东大学齐鲁医院 | Application of mesenchymal stem cell exosome in preparation of medicines for preventing or treating type 1 diabetes and related diseases thereof |
| CN113981074A (en) * | 2021-12-10 | 2022-01-28 | 石河子大学 | MicroRNA related to type 2 diabetes and application thereof |
| CN114807343B (en) * | 2022-03-29 | 2023-10-31 | 南京医科大学 | Use of markers for detecting pancreatic beta cell dedifferentiation |
| CN114854848A (en) * | 2022-06-20 | 2022-08-05 | 南京医科大学 | Application of miRNA in preparation of echinococcosis risk assessment or early screening reagent |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102725632A (en) * | 2009-08-28 | 2012-10-10 | 奥斯瑞根公司 | MiRNA biomarkers of lung disease |
| CN103243161A (en) * | 2013-05-07 | 2013-08-14 | 中国医学科学院肿瘤医院 | Product for performing assisted prediction on postoperative survival time length of esophageal squamous carcinoma patient |
-
2013
- 2013-10-24 CN CN201310508125.0A patent/CN103555724B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102725632A (en) * | 2009-08-28 | 2012-10-10 | 奥斯瑞根公司 | MiRNA biomarkers of lung disease |
| CN103243161A (en) * | 2013-05-07 | 2013-08-14 | 中国医学科学院肿瘤医院 | Product for performing assisted prediction on postoperative survival time length of esophageal squamous carcinoma patient |
Non-Patent Citations (5)
| Title |
|---|
| Circulating miRNA profiles in patients with metabolic syndrome;DS Karolina et al.;《J Clin Endocrinol Metab》;20121002;第97卷(第12期);E2271-E2276 * |
| Lei Kong et al..Significance of serum microRNAs in pre-diabetes and newly diagnosed type 2 diabetes:a clinical study.《Acta Diabetol》.2010,第48卷61-69. * |
| miRNA在2型糖尿病中的研究进展;胡蕴;《医学研究生学报》;20110930;第24卷(第9期);1003-1006 * |
| Plasma microRNA profiling reveals loss of endothelial miR-126 and other microRNAs in type 2 diabetes;A Zampetaki et al.;《Circulation Research》;20100722;第107卷;810-817 * |
| Serum miR-23a, a potential biomarker for diagnosis of pre-diabetes and type 2 diabetes;Zhangping Yang et al.;《Acta Diabetol》;20140701;第51卷;823-831 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103555724A (en) | 2014-02-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103555724B (en) | The Serum miRNA biomarker of diabetes B and application thereof | |
| Erener et al. | Profiling of circulating microRNAs in children with recent onset of type 1 diabetes | |
| CN105420405A (en) | Bovine serum microRNA molecular marker of milk cow fatty liver disease and milk cow perinatal period-associated metabolic disease | |
| CN106148537A (en) | A kind of serum relevant to type 2 diabetes mellitus or blood plasma miRNA mark and application thereof | |
| EP3019627B1 (en) | Detection of brain cancer | |
| CN108531586B (en) | Circulating miRNA marker on X chromosome related to breast cancer auxiliary diagnosis and application thereof | |
| CN102399898A (en) | Single nucleotide polymorphism (SNP) marker related with clinically cryptogenic non-obstructive azoospermia aided diagnosis and application of SNP marker | |
| CN106119385A (en) | MiRNA molecule mark hsa miR 149 3p of a kind of diagnosed type 2 diabetic and application thereof | |
| CN107699617B (en) | A kind of early diagnosis septicopyemia causes acute kidney injury molecular marked compound miR-452, kit and application | |
| CN113215242B (en) | Molecular marker for type 2diabetes and application thereof | |
| CN104480106A (en) | Serum/plasma micro-RNA marker for detecting patients with mild cognitive impairment and application thereof | |
| CN106884052A (en) | A kind of curative effect of pulmonary tuberculosis kits for evaluation based on serum miRNA composition and application thereof | |
| CN106434872A (en) | MiRNA molecule marker hsa-miR-152-3p for diagnosing type 2 diabetes, and application thereof | |
| CN108949961A (en) | For detecting kit and its screening of adenovirus pneumonia | |
| US11124832B2 (en) | Serum miRNA marker for OPLL diagnosis and application thereof | |
| CN105671179B (en) | application of serum microRNA in liver cancer diagnosis and diagnosis kit | |
| CN103911440A (en) | SNP marker related to liver toxicity of platinum type chemotherapeutic medicines and applications thereof | |
| CN109593852B (en) | Serum miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN102021167B (en) | Serum miRNA composition for detecting occult hepatitis B and applications thereof | |
| CN106086226B (en) | Plasma miRNA marker related to IgA nephropathy auxiliary diagnosis and application thereof | |
| CN107937514A (en) | Applications of the circZFY in pulmonary tuberculosis biomarker | |
| CN110643701B (en) | Tiny RNA marker combination for gestational diabetes and application thereof | |
| CN101921863A (en) | MiRNA expression model for diagnosing hepatic diseases independently | |
| CN103290006B (en) | A clinically unexplained NOA-related mitochondrial DNA SNP marker and applications thereof | |
| CN105039536A (en) | Application of mo-miR-877 in preparing renal toxicity biomarker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| ASS | Succession or assignment of patent right |
Owner name: HANGZHOU CENTER FOR DISEASE CONTROL AND PREVENTION Effective date: 20140117 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| C53 | Correction of patent of invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Chen Haimin Inventor after: Yang Zhangping Inventor after: Ding Qianyun Inventor after: Ding Xianfeng Inventor after: Sheng Qing Inventor before: Chen Haimin Inventor before: Si Hongqiang Inventor before: Li Xuan Inventor before: Yang Zhangping Inventor before: Ding Qianyun Inventor before: Ding Xianfeng Inventor before: Sheng Qing |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: CHEN HAIMIN SI HONGQIANG LI XUAN YANG ZHANGPING DING QIANYUN DING XIANFENG SHENG QING TO: CHEN HAIMIN YANG ZHANGPING DING QIANYUN DING XIANFENG SHENG QING |
|
| TA01 | Transfer of patent application right |
Effective date of registration: 20140117 Address after: Hangzhou City, Zhejiang province 310018 Xiasha Higher Education Park No. 2 Street No. 5 Applicant after: Zhejiang Sci-Tech University Applicant after: Hangzhou Center for Disease Control and Prevention Address before: Hangzhou City, Zhejiang province 310018 Xiasha Higher Education Park No. 2 Street No. 5 Applicant before: Zhejiang Sci-Tech University |
|
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150805 Termination date: 20171024 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |