CN103555724A

CN103555724A - Serum miRNA biomarker of type 2 diabetes mellitus and application thereof

Info

Publication number: CN103555724A
Application number: CN201310508125.0A
Authority: CN
Inventors: 陈海敏; 斯洪强; 李璇; 杨章萍; 丁倩芸; 丁先锋; 盛清
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: HANGZHOU CENTER FOR DISEASE CONTROL AND PREVENTION; Zhejiang Sci Tech University ZSTU
Priority date: 2013-10-24
Filing date: 2013-10-24
Publication date: 2014-02-05
Anticipated expiration: 2033-10-24
Also published as: CN103555724B

Abstract

The invention discloses a serum miRNA composition, which is at least one of the following serum miRNAs: hsa-miR-23a, hsa-let-7i, and hsa-miR-486. The invention also simultaneously provides a fluorescent quantitative detection primer composition for detection of type 2 diabetes mellitus. The composition comprises an RT primer, an FW primer and an RV primer of each miRNA in hsa-miR-23a, hsa-let-7i, and hsa-miR-486. By adopting the serum miRNA marker for early diagnosis of type 2 diabetes mellitus and cancer risk evaluation provided by the invention, a serum miRNA biomarker can be used for diagnosing whether a subject has the type 2 diabetes mellitus or early diagnosis of the type 2 diabetes mellitus and cancer risk evaluation.

Description

Serum miRNA biomarker and the application thereof of diabetes B

Technical field

The invention belongs to biotechnology and medical field, relate to a kind of for diabetes B detection and the biomarker based on serum miRNA of early diagnosis and the detection method of expression amount thereof.

Background technology

Diabetes are a kind of important endocrine metabolism chronic diseases, and diabetic subject's number is global rapid growth, have become the third-largest Non Communicable Diseases (NCD) of the harm humans health after cardiovascular disorder, tumour.According to the suggestion of WHO, diabetes can be divided into type 1 diabetes, diabetes B, specificity diabetes and gestational diabetes.

Diabetes B is also adult's morbidity type diabetes, how after 35～40 years old, to fall ill, and accounts for diabetic subject more than 90%.At present, the index for 2-type diabetes diagnosis and classification comprises: fasting plasma glucose (FPG), oral glucose tolerance test 2 hours blood glucoses (OGTT2h), Glycohemoglobin HbA1c and comprise diuresis, polydipsia and without the typical diabetic symptom of the weight loss of other inducements.But these methods are mainly used in suffering from the diagnosis and classification of diabetes, cannot carry out early diagnosis and suffer from risk assessment.About the clinical criteria of 2-type diabetes, China adopts WHO(1999 at present) diabetes diagnosis standard (table 1).

The classification of table 1 carbohydrate metabolism

IFG or IGT are referred to as IGR (IGR, i.e. pre-diabetes).

MiRNA is the noncoding RNA of a class, miRNA is the important regulating and controlling factor of genetic expression, in the generation evolution of biological growth, growth and differentiation and various diseases, playing the part of different roles, miRNA plays very important effect in carbohydrate metabolism and lipid metabolism regulation and control.MiRNA suppresses translation or said target mrna is degraded by being combined on the specificity site of 3 ＇-non-coding region of said target mrna.Circulation miRNA has good application prospect as the molecular marker of the diagnosis and prognosis of cancer, cardiovascular disorder etc.

The growths of miRNA and Regular Insulin generation, insulin secretion, insulin activity and pancreas islet etc. are all closely related, in the pathogenic process of diabetes, may play very important effect.Although obtained a lot of progress about the relation research between miRNA and pathogenesis of diabetes mellitus, great majority are miRNA expression and functional studies in diabetes animal model and illing tissue, the research of relevant diabetics's serum miRNA is also fewer, needs further deeply.

2-type diabetes especially Susceptible population monitoring and to suffer from risk assessment be to take early intervention measure and the effectively powerful guarantee of containment Present Global diabetes outburst trend.Although at present the dependent diagnostic standard of 2-type diabetes is had to OGTT2h and HbA1c, but at present clinically to the early diagnosis of 2-type diabetes with suffer from risk assessment and still lack effective means, need sensitivity and specific Non-Invasive serological index, the especially non-invasive index based on miRNA.

Summary of the invention

The technical problem to be solved in the present invention is to provide a class for 2-type early diagnosis of diabetls mellitus and the serum miRNA mark of suffering from risk assessment, utilizes this serum miRNA biomarker to can be used for diagnosing experimenter whether suffer from 2-type diabetes or 2-type early diagnosis of diabetls mellitus and suffer from risk assessment.

In order to solve the problems of the technologies described above, the invention provides a kind of serum miRNA composition, for following serum miRNA:hsa-miR-23a, hsa-let-7i, at least one in hsa-miR-486 (being any one or the combination of any two kinds or the combination of 3 kinds):

The miRNA sequence of hsa-miR-23a is: AUCACAUUGCCAGGGAUUUCC;

The miRNA sequence of hsa-let-7i is: UGAGGUAGUAGUUUGUGCUGUU;

The miRNA sequence of hsa-miR-486 is: UCCUGUACUGAGCUGCCCCGAGC.

Improvement as miRNA composition of the present invention: serum miRNA composition comprises: hsa-miR-23a,, by hsa-miR-23a, hsa-let-7i and hsa-miR-486 form for hsa-let-7i and hsa-miR-486().

The present invention also provides a kind of fluorescent quantitation detecting for 2-type diabetes to detect primer sets compound simultaneously, and this primer sets compound comprises described in claim 1 the detection primer of each miRNA in serum miRNA composition;

The sequence of the RT primer of each miRNA, FW primer (forward primer) and RV primer (reverse primer) is as follows:

As the fluorescent quantitation detecting for 2-type diabetes of the present invention, detect the improvement of primer sets compound: fluorescent quantitation detects primer and comprises: hsa-miR-23a, the detection primer of hsa-let-7i and tri-kinds of miRNA of hsa-miR-486.

The present invention also provides above-mentioned serum miRNA composition in preparation 2-type diabetes and the diagnostic reagent of pre-diabetes or the application in instrument simultaneously.

The present invention also provides above-mentioned serum miRNA to detect primer in preparation 2-type diabetes and the diagnostic reagent of pre-diabetes or the application in instrument simultaneously.

The present invention also provides detection method and the application thereof of miRNA expression amount.The invention provides the reverse transcription-fluorescent quantitative PCR technique based on stem ring (SYBR Green dye method) that detects serum miRNA biomarker.

The determination method of 2-type diabetes serum miRNA involved in the present invention, comprises the steps:

(1) serum sample collection and clinical grouping: from hospital, gather serum sample, simultaneity factor is collected complete demography and Clinical Laboratory data.

(2) with the biological RNA in connection river, extract test kit (TRK-1001) and extract total RNA from tested sample serum, by Solexa/Illumina high-flux sequence, filter out candidate miRNA;

(3) adopt real time fluorescence quantifying PCR method (SYBR Green dye method) screening to can be used as detecting the miRNA of mark.

The detection method that the present invention uses can be selected from: one or more in RT-PCR method, Solexa sequencing technologies, Real-time PCR method.

The present invention has further disclosed serum as important biomarker, in 2-type diabetes diagnosis, act on, particularly illustrated has-miR-23a in 2-type early diagnosis of diabetls mellitus and the value of suffering from risk assessment, for the research of diabetes serum miRNA from now on provides theoretical foundation, and for the molecular diagnosis of diabetes provides new thought, there is certain theory significance and potential practical value.

Accompanying drawing explanation

Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.

Fig. 1 is the main schema of miRNA biomarker screening of the present invention;

The A of Fig. 2, B, C show that hsa-miR-23a, hsa-let-7i, hsa-miR-486 express and have notable difference comparison diagram in 2-type diabetes (T2D), pre-diabetes (IGT/FGT) patient and normal glucose tolerance (NGT) control group;

Fig. 3 shows hsa-miR-23a, hsa-let-7i, the result figure that hsa-miR-486 and hsa-miR-199a carry out cluster analysis to 2-type diabetes (T2D), pre-diabetes (IGT/FGT) patient and normal glucose tolerance (NGT) control group during as marker;

Fig. 4 shows hsa-miR-23a, hsa-let-7i, and hsa-miR-486, for the ROC analysis chart of 2-type diabetes (T2D) diagnosis;

Fig. 5 shows that has-miR-23a is for the ROC analysis chart of pre-diabetes (IGT/FGT) diagnosis.

Embodiment

The invention will be further elaborated by the following examples.

The collection of embodiment 1, clinical sample and the arrangement of clinical data.

The inventor obtains a large amount of serum sample that Zhejiang Prov. Hospital of Traditional Chinese Medicine provides between year March in November, 2011 to 2013, and simultaneity factor has been collected complete sample demography and Clinical Laboratory data.Adopting WHO(1999) diabetes diagnosis standard (in Table 1) is divided into three groups of normal glucose tolerance (NGT), pre-diabetes (IFG/IGT) and 2-type diabetes (T2D) by collection clinical sample.With reference to WHO(1999) the case criteria for classification (table 1) of diabetes diagnosis standard.

Embodiment 2,2-type diabetes serum specificity miRNA express spectra Solexa/Illumina high-flux sequence primary dcreening operation

(1) screening of order-checking sample: by the arrangement to sample data, the inventor has selected 5 routine 2-type diabetes (T2D) (50.60 ± 5.13 from the clinical serum sample of collecting, age span 42-55, man: 3, female: serum sample 2), fully mix, as the mixed sample (being T2D group) of 2-type diabetes cases group.Choose in addition 5 routine normal glucose tolerances (NGT) (44.40 ± 9.60, age span 34-58, man: 4, female: serum sample 1), fully mixes, as Normal group (NGT group), as the experiment sample of Solexa/Illumina high-flux sequence primary dcreening operation.

(2) use Illumina Truseq Small RNA Preparation kit test kit reference reagent box explanation Illumina ' s TruSeq Small RNA Sample Preparation Guide to extract respectively total RNA of T2D group and NGT group, build little RNA storehouse.

(3) cDNA(A is the little RNA storehouse that step (2) builds) purified after on Illumina ' s Cluster Station generation DNA bunch be available on the machine (Illumina GAIIx) check order.

(4) according to Solexa sequencing result (entrusting YouLC company to check order), the copy number that we are chosen in 2-type diabetes (T2D) is the candidate miRNA of preliminary examination in the miRNA the present invention of 4 times of copy numbers in normal glucose tolerance (NGT) control group, and the copy number of these miRNA in 2-type diabetics is all greater than 50 copies.By screening, we have selected: hsa-let-7i-5p, hsa-miR-122-5p, hsa-miR-146a-5p, hsa-miR-186-5p, hsa-miR-191-5p, hsa-miR-192-5p, hsa-miR-199a-5p, hsa-miR-23a-3p, hsa-miR-96-5p, hsa-miR-486-5p totally 10 miRNA as alternative miRNA.

Remarks explanation: these miRNA possibility parts are known relevant to diabetes, but the detection, particularly serum of clear and definite and diabetes are as the dependency of diagnostic sample.

Table 2,2-type diabetes (T2D) and normal glucose tolerance (NGT) serum Solexa sequencing result

The real time fluorescence quantifying PCR method checking of embodiment 3,2-type diabetes serum candidate miRNA.

(1) screening of sample: by the arrangement to sample data, the inventor has selected 24 routine 2-type diabetes (T2D) (51.13 ± 9.21 from the clinical serum sample of collecting, age span 28-64, man: 16,8), 20 routine pre-diabeteses (IGT/FGT) (52.40 ± 11.00 female:, age span 31-65, man: 12, female: 8) and 20 routine normal glucose tolerances (NGT) (46.65 ± 16.18, age span 26-75, man: 8, female: the experiment sample of 12) verifying as the real time fluorescence quantifying PCR method of serum candidate miRNA.

Remarks explanation: each sample standard deviation is determined as follows separately.

(2) extraction of the total RNA of serum:

1. by serum from-80 ℃ of refrigerators are taken out, be positioned on ice and slowly thaw.In course of defrosting, every 5min, turned upside down and mixed, accelerated thawing speed, and can be guaranteed that sample melts the homogeneity in composition temperature partly, prevents white precipitate and separates out.With the biological RNA in connection river, extract test kit (TRK-1001) and extract respectively total RNA from the serum of tested sample (comprising pre-diabetes and 2-type diabetes) and check sample (normal glucose tolerance NGT), concrete steps are as follows:

2. get the serum (that is, the serum after thawing) that 200 μ L handle well, add 600 μ L lysates and 6 μ L beta-mercaptoethanols, mix.

3. add 800 μ L95%(volume %) ethanol, mix.

4. pillar is installed on collection tube, to pillar, the centrifugal 1min of room temperature 14000 * g, discards downstream liquid containing the lysate (that is, step gains 3.) of ethanol to add 650 μ L, repeats this step until all pass through pillar containing the lysate of ethanol.

5. discard downstream liquid, then add 400 μ L95% ethanol to pillar, the centrifugal 1min of 14000 * g, discards downstream liquid.Repeat again this step twice.

6. the centrifugal 2min of 14000 * g.

7. posts transfer is arrived to 1.5mL collection tube, add 50 μ L RNA Elution solution to pillar, the centrifugal 2min of 200 * g; Room temperature, the centrifugal 1min of 14000 * g; Pillar is turned to a direction, room temperature, the centrifugal 1min of 14000 * g.

8. remove purification column, retain the sample after centrifugal, in-80 ℃ of preservations, standby.

(3) detect with primer and probe sequence

1) miRNA loop-stem structure reverse transcription primer:

hsa-let-7i GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACAGC

hsa-miR-122 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAAACA

hsa-miR-146a GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCCA

hsa-miR-186 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCCCA

hsa-miR-191 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGCTG

hsa-miR-192 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCTGT

hsa-miR-199a GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGAACAG

hsa-miR-23a GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGAAAT

hsa-miR-96 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCAAA

mml-miR-486 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTCGGG

RNU6B GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAAAT

2) PCR forward primer is respectively:

hsa-let-7i GCGGGTGAGGTAGTAGTTTGTG

hsa-miR-122 GCGATGGAGTGTGACAATGGT

hsa-miR-146a CGGCGGCTGAGAACTGAAT

hsa-miR-186 GGCGGCAAAGAATTCTCCTT

hsa-miR-191 TTAGCAACGGAATCCCAAAAG

hsa-miR-192 TCGGCTGCTGACCTATGAAT

hsa-miR-199a CGCGGCCCAGTGTTCAG

hsa-miR-23a GACGCCATCACATTGCCAG

hsa-miR-96 GGCATTTGGCACTAGCACAT

mml-miR-486 CGCCGTCCTGTACTGAGCA

RNU6B CAAATTCGTGAAGCGTTCCATA

3) the universal PC R reverse primer of miRNA:

hsa-let-7i CAGTGCAGGGTCCGAGGTAT

hsa-miR-122 CAGTGCAGGGTCCGAGGTAT

hsa-miR-146a CAGTGCAGGGTCCGAGGTAT

hsa-miR-186 CAGTGCAGGGTCCGAGGTAT

hsa-miR-191 CAGTGCAGGGTCCGAGGTAT

hsa-miR-192 CAGTGCAGGGTCCGAGGTAT

hsa-miR-199a CAGTGCAGGGTCCGAGGTATT

hsa-miR-23a CAGTGCAGGGTCCGAGGTAT

hsa-miR-96 CGCAGGGTCCGAGGTATTC

mml-miR-486 CGCAGGGTCCGAGGTATTC

RNU6B AGTGCAGGGTCCGAGGTATTC

(4) detection method of miRNA expression amount in serum

Employing qRT-PCR(SYBR Green I dye method) method detects miRNA expression amount in serum.

1. from-80 ℃ of refrigerators, take out the serum miRNA sample having extracted, dissolve on ice.By being housed, the primer box preparing takes out normal temperature placement simultaneously.

2. cDNA is synthetic:

1) the synthetic cDNA of reverse transcription

In the 0.2ml PCR pipe without RNase, add successively:

The total RNA 5.00 μ l of serum

RT primer (2 μ M) 1.00 μ l

Cumulative volume 6.00 μ l

RT primer is miRNA loop-stem structure reverse transcription primer.

65 ℃ of sex change 10min, place 3min on ice, then add successively

Note: for every miRNA arranges the negative control without template.

Slightly centrifugally after mixing in PCR instrument, react; Reaction process:

42℃ 60min

70℃ 5min

4 ℃ of preservations

We have designed specificity loop-stem structure reverse transcription primer separately to every kind of miRNA the present invention, as above operate separately, and single tube synthesizes cDNA.

2) Realtime-PCR: RT product (cDNA) is carried out to pcr amplification reaction reaction system following (each reacts 20 μ l, and each sample is established 3 repetitions):

Note: Pmix is primer mixture, is forward primer and reverse primer mixture, by the English Weihe River, prompt base (Shanghai) trade Co., Ltd is synthetic, and the mixed concentration of forward primer and reverse primer is respectively 10 μ M.During dilution, first in centrifuge tube, add water, then liquid primer is added under liquid level, vibration mixes, more centrifugal, standby.

After adding, by 96 orifice plate pad pastings, use roller compacting, cover screening film, upper machine ABI PRISM7900HT type quantitative real time PCR Instrument operation.Fluorescent quantitation flow process is as follows:

(5) data analysis and processing

During the relative expression quantity of quantitative fluorescent PCR detection by quantitative miRNA, take RNU6B as reference gene, target gene is normalized, guaranteed the amount of comparison object gene in the sample of equal amount.CT value has represented that object miRNA molecule reaches the number of times of the required PCR of experimental design threshold value circulation, when CT value is greater than 35, thinks in sample and does not contain this miRNA.The variation of expression amount multiple formula RQ=2 ^{-△ △ CT}, △ △ CT=(CT wherein _miRNA-CT _rNU6B) DM-(CT _miRNA-CT _rNU6B) Mean _nGT.RQ represents relative expression quantity (relative quantation), CT _miRNAand CT _rNU6Brepresent respectively target miRNA that fluorescent quantitation detects and the CT value of reference gene RNU6B, DM represents 2-type diabetes or pre-diabetes patients serum, and NGT represents normal glucose tolerance control group serum, Mean _nGTrepresent the mean value in all Normal groups.Upper data, CT value all can be detected and be obtained after normalized by fluorescent quantitative detector.Quantitatively, set up and repeat to test and negative control experiment, whether each sample of quantitative experiment repeats 3 times, does not add template cDNA in negative control, and replaces with water, for checking, exist PCR to pollute and higher primer dimer pollution.The statistical analysis of fluorescent quantitation data adopts SPSS19.0 statistical analysis software.The relative expression quantity of miRNA between 2-type diabetes, pre-diabetes and normal glucose tolerance control group carries out independent sample T check by one-dimensional variance analysis respectively, calculates and obtains corresponding P value.

According to qRT-PCR result, we from aforesaid 10 candidate microRNAs, selected 3 in diabetes B, pre-diabetes and normal glucose tolerance control group differential expression obviously and with identical microRNAs:hsa-miR-23a, hsa-let-7i, the hsa-miR-486 of order-checking primary dcreening operation result, expression analysis result is as shown in Figure 2.As can be seen from the figure, with respect to normal glucose tolerance (NGT) control group, in serum, the expression level of hsa-miR-23a is obviously lowered (P=2.87E-05) in 2-type diabetes (T2D) case, and pre-diabetes (IFG/IGT) is also obviously lowered (P=3.75E-02); In 2-type diabetes (T2D) and pre-diabetes (IFG/IGT), also there is notable difference (P=1.06E-02) (A) in hsa-miR-23a expression level.So hsa-miR-23a may be 2-type early diagnosis of diabetls mellitus and the biological marker of suffering from risk assessment.In addition, the expression level of hsa-let-7i and hsa-miR-486 is also all obviously lowered (P is respectively 5.68E-03 and 3.95E-02) (B, C) in 2-type diabetes (T2D) case, as 2-type diabetes diagnosis mark, also may have certain values.

Remarks explanation: generally speaking, when P value≤0.05, think that result has significant difference statistically, when P value <0.01, think that result has utmost point significant difference statistically.

Above-mentioned 3 microRNAs of usining carry out cluster analysis to data with Mev4.9 as marker, the results are shown in Figure 3.As can be seen from the figure, use hsa-miR-23a, hsa-let-7i and hsa-miR-486 as markers, 2-type diabetes (T2D), pre-diabetes (IFG/IGT) and normal glucose tolerance (NGT) can obviously can be separated with control group cluster.

(6) ROC analysis and diagnosis value assessment

In order to assess hsa-miR-23a, hsa-let-7i and the hsa-miR-486 diagnosis capability in 2-type diabetes (T2D) and pre-diabetes (IFG/IGT) detection, the inventor is to 2-type diabetes (T2D), the qRT-PCR result of pre-diabetes (IFG/IGT) and normal glucose tolerance (NGT) control group has been carried out risk score, 5% or 95% the reference interval of every microRNA expression amount of take is value-at-risk, by drawing area AUC under ROC curve calculated curve, evaluate susceptibility and the specificity at diagnosis 2-type diabetes and pre-diabetes of every miRNA.Hsa-miR-23a, hsa-let-7i and hsa-miR-486 are for the ROC analytical results of 2-type diabetes diagnosis as shown in Figure 4, (A) area under curve of hsa-miR-23a is 0.835(95%CI:0.717-0.954), sensitivity 66.7%, specificity 90.0%; (B) area under curve of hsa-let-7i is 0.771(95%CI:0.629-0.913), sensitivity 66.7%, specificity 85.0%; (C) area under curve of hsa-miR-486 is 0.698(95%CI:0.540-0.856), sensitivity 79.2%, specificity 60.0%.(D) combined analysis hsa-miR-23a, hsa-let-7i and hsa-miR-486, its area under curve is 0.844(95%CI:0.727-0.960), sensitivity 62.5%, specificity 90.0%.

As shown in Figure 5, the area under curve of hsa-miR-23a is 0.690(95%CI:0.525-0.855 to the ROC analytical results that hsa-miR-23a diagnoses for 2 pre-diabeteses), sensitivity 60.0%, specificity 75.0%.The above analysis result, illustrate that these three microRNAs have to 2-type diabetes and pre-diabetes diagnosis the biomarker application that good diagnostic value, particularly hsa-miR-23a can be used as 2-type diabetes and pre-diabetes early diagnosis and suffer from risk assessment.

Finally, it is also to be noted that, what more than enumerate is only several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, can also have many distortion.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention, all should think protection scope of the present invention.

Claims

1. serum miRNA composition, is characterized in that: be following serum miRNA:hsa-miR-23a, and hsa-let-7i, at least one in hsa-miR-486:

The miRNA sequence of hsa-miR-23a is: AUCACAUUGCCAGGGAUUUCC;

The miRNA sequence of hsa-let-7i is: UGAGGUAGUAGUUUGUGCUGUU;

The miRNA sequence of hsa-miR-486 is: UCCUGUACUGAGCUGCCCCGAGC.

2. miRNA composition according to claim 1, is characterized in that: described serum miRNA composition comprises: hsa-miR-23a, hsa-let-7i and hsa-miR-486.

3. the fluorescent quantitation detecting for 2-type diabetes detects primer sets compound, it is characterized in that this primer sets compound comprises described in claim 1 the detection primer of each miRNA in serum miRNA composition;

The sequence of the RT primer of each miRNA, FW primer and RV primer is as follows:

4. the fluorescent quantitation detecting for 2-type diabetes according to claim 3 detects primer sets compound, it is characterized in that: described fluorescent quantitation detects primer and comprises: hsa-miR-23a, the detection primer of hsa-let-7i and tri-kinds of miRNA of hsa-miR-486.

5. serum miRNA composition as claimed in claim 1 or 2 is in preparation 2-type diabetes and the diagnostic reagent of pre-diabetes or the application in instrument.

6. the serum miRNA as described in claim 3 or 4 detects primer in preparation 2-type diabetes and the diagnostic reagent of pre-diabetes or the application in instrument.