CN103122387B - Rapid circulating tumor cell (CTCs) fluorescence PCR (Polymerase Chain Reaction) hypersensitivity detection kit and application thereof - Google Patents

Abstract

The present invention provides the application of the reagent used in the detection method in the preparation of a kit for detecting specific markers of circulating tumor cell molecules, wherein the detection method comprises: processing the sample; performing nucleic acid extraction on the processed product; and , Fluorescent PCR detection of nucleic acid extracts. In addition, the present invention also provides reagents and kits in the above applications.

Description

Circulating tumor cells (CTCs) fluorescent PCR rapid ultrasensitive detection kit and its application

technical field

The invention belongs to the technical field of nucleic acid detection, in particular, the invention relates to the application of detecting circulating tumor cells (CTCs) in samples. In addition, the present invention also relates to reagents, kits, and the like that can be used in the above applications.

Background technique

According to statistics, about 90% of cancer patients die from secondary tumors, and primary tumor metastasis or release of circulating tumor cells (circulating tumor cells, CTCs) is usually the cause of secondary tumor formation. As early as 1869, the scientist Ashworth first proposed the concept of CTCs. CTCs are currently defined as tumor cells released from solid tumors or metastases into peripheral blood circulation spontaneously or due to diagnostic and therapeutic procedures. Tumor cells that enter the circulation and are not cleared form tiny tumor thrombi through migration, adhesion, and mutual aggregation, and develop into metastases under certain conditions. Therefore, the detection of CTCs in peripheral blood indicates the possibility of tumor metastasis. The detection of CTCs in peripheral blood has important clinical application value and is of great significance for early clinical screening and diagnosis, curative effect and prognosis. It has also been approved by the U.S. Food and Drug Administration (FDA) for predicting progression-free survival (PFS) and overall survival (OS) in metastatic breast, colorectal, or prostate cancer CTCs detection system.

For hundreds of millions of peripheral blood cells, the number of CTCs in peripheral blood is rare, and there is only one CTCs in every 10 ⁵ -10 ⁷ monocytes. The existing detection techniques for CTCs mainly include immunocytochemistry (immunocytochemistry, ICC), flow cytometry (flow cytometry, FCM) and reverse transcription polymerase chain reaction (reverse transcription polymerase chain reaction, RT-PCR). The disadvantage of immunocytochemistry is low sensitivity, poorly differentiated tumor cells do not express target antigens, lymphocyte cross-reactivity and other factors will affect the specificity of detection; flow cytometry is expensive, time-consuming, and low sensitivity; and The RT-PCR method is cumbersome, time-consuming, and prone to contamination, which brings great inconvenience to clinical testing, and may also cause false positives and false negatives due to contamination of epithelial cells during sampling, illegal transcription of markers, and differences in expression between individuals.

Although there are precedents for detection of CTCs by fluorescent PCR (for example, see: Jin Xiangfeng, et al. The expression and significance of CK19mRNA in peripheral blood of patients with non-small cell lung cancer. Qilu Medical Journal, Vol. 23, No. 3), but it is still subject to false positive and false negative (especially false-negative) results, and the interpretation of the results is not intuitive, and it is difficult to conduct semi-quantitative analysis, so the sensitivity is very low, so we have to use "concentration ≥ 1 copy number per microliter as a positive result, concentration < per microliter liter 1 copy number is negative" (that is, 1000copy/ml) to divide and judge. For the situation that many actual patients have only 1-100 copies per milliliter sample, it has little value for promotion and use, resulting in a large number of false negative results, making doctors Are at a loss.

For this reason, the inventor, through arduous and long-term efforts, found that the use of conventional RNA extraction kits is not effective for the final detection results, so it needs to be improved from the processing of samples (such as peripheral blood); also found to improve some primers and probes. The needle and its PCR amplification steps can make the interpretation results intuitive, and semi-quantitative analysis can be performed in a wider range; what is even more surprising is that the inventors have abandoned the current research misunderstanding of blindly pursuing quantitative or semi-quantitative analysis, and designed a Primer pairs and probes that do not interfere with each other greatly increase the sensitivity and reliability of qualitative analysis while retaining a certain ability of semi-quantitative analysis. Moreover, the method of the present invention is easy to be automated and scaled up, can reduce human error and pollution, save operation time and cost, and can be widely used in disease classification and prognosis assessment of patients with breast cancer, colon cancer, prostate cancer, lung cancer, and gastric cancer , to provide a basis for the selection of treatment options and the monitoring of treatment effects.

Contents of the invention

The purpose of the present invention is to provide the application of the reagent used in the new detection method in the preparation of a kit for detecting the molecular specific markers of circulating tumor cells. In addition, the present invention also provides reagents and kits that can be used in the above applications.

Specifically, in a first aspect, the present invention provides reagents used in the detection method in preparation for detection of circulating tumor (such as breast cancer, colon cancer, prostate cancer, lung cancer and/or gastric cancer, preferably breast cancer) cells Application in a kit of molecular specific markers, wherein the detection method comprises:

(1) Processing of samples (eg, peripheral blood);

(2) performing nucleic acid extraction on the processed product obtained in step (1); and,

(3) Perform fluorescent PCR detection on the nucleic acid extract obtained in step (2).

Although other methods can be used to detect the molecular specific markers of circulating tumor cells, preferably in the application of the first aspect of the present invention, the detection of the specific molecular markers of circulating tumor cells is also implemented by the detection method.

In this paper, in the kit, different reagents can be packaged in different containers, or several reagents that can be stored for a long time without chemical reactions can be selected and stored in the same container together. The container can be a container such as a bottle, a box, a syringe, etc. that can contain the above-mentioned reagents, such as conventionally used containers for PCR, enzyme or nucleic acid reagents. Since some reagents are easy to obtain, these reagents may not be included, for example, only a part of the reagents may be included in the kit. In addition, there may also be a label or an instruction in the detection kit to indicate the operation according to the detection method described in the first aspect of the present invention. Labels can be affixed to or printed directly onto said container, or a separate instruction sheet can be provided. According to needs, such as the needs for convenient transportation and storage, the kit can be further packaged into a larger package, and such products are also within the scope of the present invention. A preferred kit is the kit of the fourth aspect of the invention hereinbelow.

Herein, the detected "sample" or "sample" can be used interchangeably, and refers to an isolated sample that may potentially contain target nucleic acid, such as blood, blood products, urine or saliva. The detection method in the application of the present invention can be regarded as an independent aspect of the present invention. The detection method is a dual detection method, targeting two CTCs markers respectively, thereby helping to eliminate false positives in qualitative results. Whether a small or trace amount of CTCs detected can lead to secondary tumors requires an experienced doctor to judge based on the corresponding person's physique, medical history, clinical symptoms and other comprehensive conditions. Therefore, the detection method in the application of the present invention is preferably It is a non-diagnostic method, that is, a method that cannot directly obtain the diagnosis result of the disease or the state of health.

Preferably, in the application of the first aspect of the present invention, the fluorescent PCR detection method in step (3) includes: (3-1) mixing nucleic acid extract, reverse transcriptase, RNase inhibitor, DNA polymerase, dNTP, target nucleic acid primer pair and probe, wherein the probe is labeled with a fluorescent group and a quencher group, and the detection wavelengths of the fluorescent groups labeled by the two probes are different, wherein,

Target nucleic acid primer pairs include:

AACGAGCCAGCCTATCTTGAATC,

TTCTGACTTGATCTGTGACCGGAG,

CTGAATCCAATCTTTGCTCACC, and

ATGCTTGAAGGCCAATATGA,

Target nucleic acid probes include:

CCGACATCGCCGCTCCGTAACAT, and

CCTCTATTCAGATCCAGCGGATA

(3-2) Perform reverse transcription and PCR reactions, and detect fluorescence at different wavelengths in real time; and,

(3-3) According to the Ct value calculated from the fluorescence detection result, it is judged whether there is a marker target nucleic acid in the sample.

Herein, "single PCR reaction vessel" means that the reverse transcription and real-time PCR methods are technically carried out in the same vessel, and there is no need to change the vessel. That is, in the real-time PCR method of the first aspect of the present invention, the synthesis of cDNA, the steps of PCR amplification and real-time fluorescence detection can be completed in the same container, and the whole process does not need to change the container, which is easy to operate, saves time, and reduces error. The operator only needs to add samples and reaction reagents to the container, and the whole process is automatically completed by a commercially available common real-time fluorescent PCR instrument.

Typically, each probe is labeled with a fluorophore at the 5' end and a quencher group at the 3' end of the nucleotide sequence. Preferably, each probe is labeled with a different fluorophore. Preferred fluorophores and their quenchers are commercially available, such as and other conventional products, whose detection wavelengths are different from each other, you can also entrust the company to synthesize probes labeled with fluorescent labels, the purity needs to reach HPLC standards, and do not contain impurities. The concentration in the reaction vessel is greater than 5 pmol/ml, preferably 6-12 pmol/ml, more preferably 7-10 pmol/ml, most preferably 8 pmol/ml. In a specific embodiment of the present invention, the fluorescently labeled probes with different detection wavelengths that are used are all synthesized by Shanghai Sangon Bioengineering Technology Service Co., Ltd., and the preferred fluorescent groups are FAM, VIC, NED, TexasRed and any two combinations of CY5. Therefore, it can be further preferred that in the fluorescent PCR detection method in step (3), various probes are labeled with different fluorophores, preferably the fluorophores are selected from FAM, VIC, NED, Texas Red and CY5.

In the present invention, in order to balance the amplification conditions of different primer pairs and expand the semi-quantitative range as much as possible, the optimal conditions are as follows: each cycle condition of PCR reaction is 94°C for 10 seconds and 60°C for 30 seconds. In a specific embodiment of the present invention, reverse transcription is required before the PCR reaction, that is, 30 minutes at 42° C., and denaturation at 94° C. for 10 minutes is preferred, followed by 45 cycles of the above conditions.

Nucleic acid extraction can use conventional boiling method, phenol-chloroform extraction method, TRIzol method, column method, etc., preferably using the optimized magnetic bead extraction method of the present invention, that is, the nucleic acid extraction method in step (2) is preferably the magnetic bead method to extract RNA Methods. Such a method, combined with the following sample processing method, can effectively improve the influence of poor processing/extraction existing in the prior art. Preferred nucleic acid extraction methods include:

Add nucleic acid extraction solution (preferably nucleic acid extraction solution containing guanidine isothiocyanate, sodium ethylenediaminetetraacetate, Tween-20, sodium perchlorate, ethanol and pH buffer solution (e.g., Tris-HCl)) to the processed product, and incubate After adding magnetic beads (eg, Magnetic beads), after mixing evenly, magnetically separate, discard the supernatant, and then wash (preferably wash twice, more preferably wherein the washing liquid used in the first wash contains sodium perchlorate and ethanol, and more preferably wherein the second wash The washing solution used comprises ethanol), and eluted (preferably the eluent used for elution comprises a pH buffer (eg, Tris-HCl).

Although nucleic acid extraction and/or fluorescent PCR detection can be directly performed on the sample, the inventors found that pre-treatment before nucleic acid extraction can effectively improve the final detection result. The application of claim 1, wherein the method of processing in step (1) comprises,

After removing the plasma from the peripheral blood, lyse it with a cell lysate (such as ammonium chloride erythrocyte lysate), add anti-CD45 immunomagnetic beads, mix evenly, incubate, magnetically separate, discard the supernatant, and then wash (preferably use a pH buffer ( eg, PBS) wash).

The invention also provides reagents and preferred reagents in use of the first aspect of the invention. For example, in the second aspect, the present invention provides the reagent in the application of the first aspect of the present invention, which is the reagent used in step (3) in the application, characterized in that it includes a target nucleic acid primer pair and a probe, Wherein the probe is marked with a fluorescent group and a quencher group, and the detection wavelengths of the fluorescent groups marked by the two probes are different, wherein,

Target nucleic acid primer pairs include:

AACGAGCCAGCCTATCTTGAATC,

TTCTGACTTGATCTGTGACCGGAG,

CTGAATCCAATCTTTGCTCACC, and

ATGCTTGAAGGCCAATATGA,

Target nucleic acid probes include:

CCGACATCGCCGCTCCGTAACAT, and

CCTCTATTCAGATCCAGCGGATA.

Preferably, the reagents of the second aspect of the present invention also include reverse transcriptase, RNase inhibitor, DNA polymerase and dNTP (including dATP, dCTP, dGTP and dTTP). In this way, a complete fluorescent PCR kit can be constructed.

It is also preferred that in the reagent of the second aspect of the present invention, the various probes are labeled with different fluorophores, preferably the fluorophores are selected from the group consisting of FAM, VIC, NED, Texas Red and CY5.

As another example, in the third aspect, the present invention provides the reagent in the application of the first aspect of the present invention, which is the reagent used in steps (1) and (2) in the application, characterized in that it includes cell lysate (e.g. ammonium chloride erythrocyte lysate), anti-CD45 immunomagnetic beads and washing solution (preferably the washing solution is a pH buffer solution (e.g., PBS)), and nucleic acid extraction solution (preferably the nucleic acid extraction solution contains guanidine isothiocyanate, EDTA, Tween-20, sodium perchlorate, ethanol, and pH buffer (e.g., Tris-HCl)), magnetic beads (e.g., D-Beads magnetic beads), washing solution (preferably two washing solutions, more preferably one of the washing solutions contains sodium perchlorate and ethanol, and more preferably the other washing solution contains ethanol) and eluent (preferably The eluent contains a pH buffer (eg, Tris-HCl)). In this way, a peripheral blood treatment and nucleic acid extraction kit can be constructed. The present inventors found that processing peripheral blood and extracting nucleic acid is beneficial to the detection results of fluorescent PCR.

In a fourth aspect, the present invention provides a kit for detecting cell molecule-specific markers of circulating tumors (such as breast cancer, colon cancer, prostate cancer, lung cancer and/or gastric cancer, preferably breast cancer), which comprises the present invention An agent of the second aspect of the invention and/or an agent of the third aspect of the invention. Preferably, no internal control nucleic acid is contained therein.

Preferably the kit of the fourth aspect of the invention comprises the reagents of the second aspect of the invention.

It is also preferred that the kit of the fourth aspect of the invention comprises the reagents of the third aspect of the invention.

It is also preferred that the kit of the fourth aspect of the invention comprises the reagents of the second aspect of the invention and the reagents of the third aspect of the invention.

In the fifth aspect, the present invention provides a primer and probe mixture for fluorescent PCR that does not interfere with each other, which is a mixture of primers or probes, and the primers or probes are selected from

AACGAGCCAGCCTATCTTGAATC,

TTCTGACTTGATCTGTGACCGGAG,

CTGAATCCAATCTTTGCTCACC,

ATGCTTGAAGGCCAATATGA,

CCGACATCGCCGCTCCGTAACAT, and

CCTCTATTCAGATCCAGCGGATA.

This mixture can be used in the application of the first aspect of the present invention, and can also be used in the reagent constituting the second aspect of the present invention and/or the kit of the fourth aspect of the present invention.

The beneficial effects of the present invention are: a fast and ultra-sensitive detection of CTCs is established, which can be used to detect whether there are CTCs in the peripheral blood of patients with breast cancer, colon cancer, prostate cancer, lung cancer, and gastric cancer, wherein the accuracy is high and false positives are greatly reduced. Possibility of positive and false negative, especially almost eliminated false negative results, suitable for practical promotion; high sensitivity, the minimum detection limit can detect 1 copy of tumor cells in 7.5mL blood, which is several times higher than the existing technology Moreover, it is convenient and fast to operate, easy to automate and scale up, shortens the detection time, reduces the error introduced by manual operation, and does not need to add internal control primers and probes, saving detection costs.

Description of drawings

Fig. 1 is to adopt the kit of the present invention to detect CK19 gene positive standard product (positive standard product is the plasmid DNA that contains CK19 gene detection site, can follow Jin Xiangfeng's thesis (non-small cell lung cancer patient peripheral blood CK19mRNA expression and significance. Qilu Medical Journal, Vol. 23, No. 3) to construct the fluorescence quantitative PCR amplification curve (the picture is a combined drawing of amplification detection with different copy numbers), in the figure, from left to right, they are 10 ⁵ copies /ml, 10 ⁴ copy/ml, 10 ³ copy/ml, 10 ² copy/ml CK19 gene standard fluorescent quantitative PCR amplification curve.

Figure 2 shows the results of fluorescence quantitative PCR amplification detection of samples from 8 female patients diagnosed as breast cancer clinically and pathologically (the picture is a combined plot of amplification detection of different samples, and the same color indicates the amplification curves of two probes from the same patient) .

The above-mentioned figures are all the original amplification pictures of the ABI7500 fluorescent real-time quantitative PCR amplification instrument.

Detailed ways

Hereinafter, the invention will be described through specific examples. If there is no special indication, it can be obtained according to "Molecular Colon Experiment Guide" (Third Edition) (Cold Spring Harborlaboratory Press), "Cell Experiment Guide" (Science Press, Beijing, China, 2001) familiar to those skilled in the art. 2004), "RNA Experimental Technology Manual" (Science Press, Beijing, China, 2004), "Immunoassay Technology" (Science Press, Beijing, China, 1991) and other experimental manuals and the references cited herein column method to implement. Among them, the used (labeled) probes and primers can be synthesized by entrusting Shanghai Sangon Bioengineering Technology Service Co., Ltd.

The processing of embodiment 1 peripheral blood sample

The experimental material of this example is to collect the peripheral blood of breast cancer patients admitted to a certain hospital and confirmed by pathology. At 7 o'clock in the morning, on an empty stomach, fresh blood is collected through the cubital vein, stored in an anticoagulant tube, shaken well, and stored at room temperature for ≤4hr .

1. Add an equal volume of PBS (pH 7.0) to the whole blood sample in the anticoagulant tube, centrifuge at 3000 rpm for 5 minutes at room temperature, and remove the upper layer of plasma;

2. Add an equal volume of ammonium chloride erythrocyte lysate (purchased from Beyuntian) to the reserved liquid, centrifuge at 20 rpm for 8 min at room temperature and mix well, then centrifuge at 3000 rpm for 5 min at room temperature, and discard the supernatant;

3. Add 1/10 volume of anti-CD45 immunomagnetic beads (available from Ningbo Liangrui Antibody Biotechnology Co., Ltd.), and mix well at room temperature for 20 minutes on a shaker at a speed of 110 rpm;

4. Use a magnetic separation rack to separate the magnetic beads (discard the supernatant), wash the magnetic beads with PBS (pH 7.0), and combine the washings to obtain a peripheral blood sample processing solution.

The extraction of embodiment 2 nucleic acids

The extraction of nucleic acid adopts conventional magnetic bead extraction method, and the steps are as follows: add nucleic acid extraction solution to the peripheral blood sample treatment solution obtained in Example 1 at a volume ratio of 1:100 (formulation and final concentration are: guanidine isothiocyanate 1.2M , sodium edetate (pH8.0) 10mM, Tween-202% (W/W), sodium perchlorate 1M, ethanol 40% (V/V), Tris-HCl (pH8.0) 10mM) , incubate at 42°C for 10min, then add in a volume ratio of 10:1 Magnetic bead suspension (50mg/mL, available from Beijing Aibigen Biotechnology Co., Ltd.), shake and mix evenly, remove the supernatant after magnetic separation, and then add an appropriate amount of washing solution A (the formula and final concentration are: perchloric acid Sodium 1M, ethanol 25% (V/V)), discard the washing solution A after washing, then add an appropriate amount of washing solution B (formulation and final concentration: ethanol 70% (V/V)), discard the washing solution after washing B. Finally, add the eluent (recipe and final concentration: Tris-HCl (pH8.0) 10mM) and incubate at 42°C for 10 minutes. The resulting supernatant is the nucleic acid extraction solution, which is diluted for detection in the following steps.

Embodiment 3 fluorescence real-time quantitative PCR amplification

1. Primer and probe sequences

Commissioned the synthesis of the following primer pairs and probes, a total of 6 nucleic acid sequences:

The primer pairs are:

AACGAGCCAGCCTATCTTGAATC

TTCTGACTTGATCTGTGACCGGAG

CTGAATCCAATCTTTGCTCACC

ATGCTTGAAGGCCAATATGA

where the probe is

CCGACATCGCCGCTCCGTAACAT

CCTCTATTCAGATCCAGCGGATA

2. Fluorescent labeling

The 5' ends of the above probes were labeled with fluorescent markers FAM and CY5, respectively, and the corresponding quenching groups were marked at the 3' ends.

3. PCR reaction conditions

Reverse transcription and PCR amplification were carried out in the same reaction system, the total volume of the system was 60uL, and the final concentrations of each component were: 40uL of the nucleic acid extract obtained in Example 2 or CK19 gene positive standards of different dilutions, The content of each primer in the above 2 pairs of primers is 15pmol/ml, the content of each of the above 2 kinds of probes is 8pmol/ml, the concentration of dNTP is 0.2mmol/ml, and 10×PCR buffer (available from TaKaRa company, pH8.3, containing Mg ²⁺ ) is 6uL, Taq DNA polymerase is 5U, M-MLV reverse transcriptase is 20U, Rnasin is 5U, and the balance is deionized water.

The steps of reverse transcription and PCR reaction are: 42°C for 30 min, 94°C for 10 min, (94°C for 10 s, 60°C for 30 s) for 45 cycles, and finally use the ABI7500 real-time fluorescent PCR instrument to collect fluorescence at the detection wavelength of FAM and CY5.

4. Result Interpretation Criteria

The baseline and threshold are automatically set by default for the ABI7500 fluorescence instrument. If the Ct value of each fluorescence (FAM and/or CY5) is ≤45, then CTCs are present in the sample, and it is judged as positive; if the Ct value calculated by the fluorescence detection result is >45, then CTCs do not exist in the sample, and it is judged as negative. Moreover, as long as the amplification of one primer pair is detected as positive by the corresponding probe, it is judged as positive qualitatively, regardless of whether semi-quantitative analysis can be performed.

5. Results

The amplification results of CK19 gene positive standard substances (as a control) of different dilutions are shown in Figure 1, which shows that standard samples with different copy numbers are detected by the method of the present invention, not only can reflect accurate results, but also the reliability of the results The readability is very good, the logarithmic linear relationship is good in the concentration range from 10 ² to 10 ⁵ , and semi-quantitative analysis can be performed on samples with a content of 100 copy/ml and above. The range suitable for semi-quantitative analysis is better than the existing ones technology.

The detection spectrum of the actual patient is shown in Figure 2. Not only can all of them show the correct and deterministic results of amplification, but also there is no mutual interference between the two primer pairs and probes. Among them, CK19 with a high copy number can be used for comparison with the control. Semi-quantitative results were obtained by comparison.

To sum up, the kit described in the present invention is not only fast and highly sensitive, but also the interpretation of the results is very clear and intuitive, especially for repeated detection of samples from a large number of different actual patients, the (qualitative) results are all accurate, indicating that the present invention is reliable high stability and no internal control is required.

sequence listing

<110> Suzhou Huayimei Biotechnology Co., Ltd.

<120> Fluorescent PCR Rapid Ultrasensitive Detection Kit for Circulating Tumor Cells (CTCs) and Its Application

<130>CN

<160>6

<170>PatentIn version3.5

<210>1

<211>23

<212>DNA

<213> Artificial sequence

<400>1

aacgagccag cctatcttga atc 23

<210>2

<211>24

<212>DNA

<213> Artificial sequence

<400>2

ttctgacttg atctgtgacc ggag 24

<210>3

<211>22

<212>DNA

<213> Artificial sequence

<400>3

ctgaatccaa tctttgctca cc 22

<210>4

<211>20

<212>DNA

<213> Artificial sequence

<400>4

atgcttgaag gccaatatga 20

<210>5

<211>23

<212>DNA

<213> Artificial sequence

<400>5

ccgacatcgc cgctccgtaa cat 23

<210>6

<211>23

<212>DNA

<213> Artificial sequence

<400>6

cctctattca gatccagcgg ata 23

Claims (19)

1. The application of the reagent used in the detection method in the preparation of a kit for detecting circulating tumor cell molecular specific markers, wherein the detection method comprises: (1) Process the sample; (2) performing nucleic acid extraction on the processed product obtained in step (1); and, (3) Carry out fluorescent PCR detection to the nucleic acid extract that step (2) obtains, and the method for the fluorescent PCR detection in this step (3) comprises: (3-1) Mix nucleic acid extract, reverse transcriptase, RNase inhibitor, DNA polymerase, dNTP, target nucleic acid primer pair, and probe in a single PCR reaction tube, wherein the probe is labeled with a fluorescent group and quenching groups, and the detection wavelengths of the fluorescent groups labeled by the two probes are different, wherein, Target nucleic acid primer pairs include: AACGAGCCAGCCTATCTTGAATC TTCTGACTTGATCTGTGACCGGAG CTGAATCCAATCTTTGCTCACC, and ATGCTTGAAGGCCAATATGA Target nucleic acid probes include: CCGACATCGCCGCTCCGTAACAT, and CCTCTATTCAGATCCAGCGGATA; in, Various probes are labeled with different fluorophores; The conditions of each cycle of the PCR reaction are 94°C for 10s and 60°C for 30s; and, The concentration of each target nucleic acid probe in a single PCR reaction container is 8pmol/ml; (3-2) performing reverse transcription and PCR reactions, and detecting fluorescence at different wavelengths in real time; and, (3-3) Judging whether there is a marker target nucleic acid in the sample based on the Ct value calculated from the fluorescence detection result. 2. The use as claimed in claim 1, wherein the tumor is breast cancer, colon cancer, prostate cancer, lung cancer and/or gastric cancer. 3. The use as claimed in claim 1, wherein the tumor is breast cancer. 4. The use of claim 1, wherein the sample is peripheral blood. 5. the described application of claim 1, wherein fluorophore is selected from FAM, VIC, NED, Texas Red and CY5. 6. the described application of claim 1, wherein the method for the nucleic acid extraction in the step (2) is the method for extracting RNA by magnetic bead method. 7. the described application of claim 6, wherein the method for nucleic acid extraction comprises, Add nucleic acid extraction solution to the processed product, add magnetic beads after incubation, mix evenly, magnetically separate, discard the supernatant, then wash and elute. 8. The application of claim 7, wherein the nucleic acid extract comprises guanidine isothiocyanate, sodium edetate, Tween-20, sodium perchlorate, ethanol and pH buffer. 9. The use according to claim 8, wherein the pH buffer is Tris-HCl. 10. The application of claim 7, wherein the magnetic beads are magnetic beads. 11. The use as claimed in claim 7, wherein the washing is twice. 12. The application according to claim 11, wherein the washing liquid used in the first washing comprises sodium perchlorate and ethanol. 13. The use according to claim 11, wherein the washing liquid used in the second washing comprises ethanol. 14. The use according to claim 7, wherein the eluent used for elution comprises a pH buffer. 15. The use of claim 14, wherein the pH buffer is Tris-HCl. 16. The application of claim 1, wherein the method of processing in step (1) comprises, After removing the plasma from peripheral blood, lyse it with cell lysate, add anti-CD45 immunomagnetic beads, mix evenly, keep warm, magnetically separate, discard the supernatant, and then wash. 17. The application of claim 16, wherein the cell lysate is ammonium chloride erythrocyte lysate. 18. The use of claim 16, wherein the washing is with a pH buffer. 19. The use of claim 18, wherein the pH buffer is PBS.