CN108004319A - A kind of general cancer early screening kit based on blood plasma excretion body GRP78 mRNA - Google Patents
A kind of general cancer early screening kit based on blood plasma excretion body GRP78 mRNA Download PDFInfo
- Publication number
- CN108004319A CN108004319A CN201711170283.4A CN201711170283A CN108004319A CN 108004319 A CN108004319 A CN 108004319A CN 201711170283 A CN201711170283 A CN 201711170283A CN 108004319 A CN108004319 A CN 108004319A
- Authority
- CN
- China
- Prior art keywords
- cancer
- excretion body
- early screening
- cancer early
- grp78
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the cancer early screening kit of GRP78 mRNA in excretion body based on blood plasma a kind of, contains a pair of of excretion body GRP78 mRNA fluorescence quantification PCR primers, the nucleotide sequence such as SEQ ID NO of primer：Shown in 1~2.The present invention can be just with 5ml blood with regard to that can complete the early screening of kinds cancer, so that the early detection method of cancer is special good, sensitive, efficient, practical, it is noninvasive, reliability is high, it is easy to medical institutions' clinical expansions at different levels, the physical examination examination and early warning of tumor susceptibility patient are also especially suitable for, have great importance value.
Description
Technical field
The present invention relates to screening lung cancer technical field, and blood plasma excretion body GRP78 mRNA are based on more particularly, to one kind
Cancer early screening kit.
Background technology
Cancer, refers to the malignant tumour originating from epithelial tissue, is most common one kind in malignant tumour.With benign tumour
Compare, malignant growth speed is fast, and in infiltrative growth, bleeding, necrosis, ulcer etc. easily occurs, and often has DISTANT METASTASES IN, makes
Adult body becomes thin, is powerless, anaemia, loss of appetite, fever and serious organ function are damaged, and ultimately causes death.
Annual a large amount of patient's Cancer deaths, it is contemplated that the future 25 years whole world will have 300,000,000 people to suffer from tumour, wherein 100,000,000 people Yin Ben
Die of illness and die.Cancer is by as the first killer of the new century mankind, and as one of maximum public health problem in the whole world.At present I
The head of various regions hospital of state early carcinomas of diagnosing a disease only account for less than 10%, and more than 90% all loses the valuable opportunity of beat cancer, because
This, it is very urgent to improve cancer early detection rate！The World Health Organization (WH O) explicitly points out：Early detection is to improve cancer to control
The key for the treatment of rate.As long as early detection, 90% cancer can cure completely.Conscientiously carry out the early detection of cancer, examine in early days
The work of disconnected and early treatment, then the death rate of cancer can reduce about 1/3rd.
Lack at present it is a kind of can high sensitivity, using simplicity, no pain, it is cheap, be easy to receive screening method,
So that the early screening of cancer can not be popularized, more earlier stage cancer patients and cancer can not be found in numerous asymptomatic crowds
Disease people at highest risk.
Excretion body is the one kind found in the body fluid such as cell culture supernatant and blood plasma, serum, saliva, urine, by thin
Vesica class corpusculum of the born of the same parents to exocytosis.Their diameter about 30-150 nanometers (nm), has typical bimolecular lamellar lipid membrane
Structure, carries the multiple proteins of mother cell, lipid material, (including mRNA, IncRNA are even other small by DNA, RNA in it
Molecule RNA) etc..All cells can be by spuing, absorbing these vesicles into row information transmission.Cancer cell is also secreted greatly
Distinctive signal is contained in the excretion body of amount, the inside, for inducing angiogenesis, suppresses immune system, or the one of domestication human body
A little organs.Many evidences show that the molecular events of malignant tumour early stage are secretion excretion bodies, this than circulating tumor cell, follow
Ring Tumour DNA is much earlier.But in practical application work, the reagent of cancer early screening is not carried out using excretion body
Box occurs, and the definite and selection of special sign thing is one of critically important key factor in excretion body, there is no at present suitable outer
Secrete body marker and be used for cancer early detection.
The content of the invention
The present invention provides a kind of blood plasma excretion body special sign thing available for cancer early screening, i.e. GRP7
8mRNA, can utilize blood with regard to that can complete the early screening of kinds cancer so that the early detection method of cancer is special good, quick
Sense, efficient, practicality, noninvasive, reliability is high, is easy to medical institutions' clinical expansions at different levels, is also especially suitable for tumor susceptibility patient
Physical examination examination and early warning, have great importance value.
First purpose of the present invention is to be used for cancer early screening to overcome the deficiencies of the prior art and provide a pair
Specificity fluorescent quantitative RT-PCR detection primer.
Second object of the present invention is to provide a kind of specificity fluorescent of the cancer early screening and quantifies RT-PCR
Application of the detection primer in cancer early screening kit is prepared.
Third object of the present invention is to provide a kind of cancer early screening examination based on blood plasma excretion body GRP78 mRNA
Agent box.
To achieve these goals, the present invention is achieved by the following technical programs：
A pair is used for the specificity fluorescent quantitative RT-PCR detection primer of cancer early screening, including excretion body GRP78
MRNA quantitative fluorescent PCRs sense primer and PCR anti-sense primers, the nucleotide sequence such as SEQ ID NO of primer：Shown in 1~2.
The specificity fluorescent quantitative RT-PCR detection primer of the cancer early stage sieve is preparing cancer early screening reagent
Application in box.
A kind of cancer early screening kit based on blood plasma excretion body GRP78 mRNA, containing being used for cancer including described
The specificity fluorescent quantitative RT-PCR detection primer of early screening, i.e. excretion body GRP78 mRNA quantitative fluorescent PCR sense primers
With PCR anti-sense primers, the nucleotide sequence such as SEQ ID NO of primer：Shown in 1~2.
Glucose regulatory protein 78 (glucose regulated protein 78kD, GRP78) is in endoplasmic reticulum
Important molecular chaperones, also known as HSPA5, belong to a member of heat shock protein 70 family.GRP78 participates in preventing endoplasm in endoplasmic reticulum
The newborn peptide aggregation of net, adjust endoplasmic reticulum calcium homeostasis, anti-endoplasmic reticulum associated cell apoptosis and start Non-adhesion inhibition index etc.
Cell life process.Under normal physiological conditions, since GRP78 is non-secreted protein, its content in peripheral blood and body fluid
It is extremely small, or even can not detect.But stimulate in pathology, such as stock's calcium in heat shock, exhaustion endoplasmic reticulum, increase in endoplasmic reticulum
Paraprotein accumulation, sugar is hungry, during virus infection, the particularly formation and development of nearly all tumour, waiting can have
Effect ground stimulates the expression of GRP78 mRNA and the synthesis of GRP78.
Preferably, the kit also includes：EDTA anticoagulant tubes, excretion body STb gene digestion reagent, excretion body total serum IgE carry
Take reagent, reverse transcription reaction reagent, quantitative fluorescent PCR reagent, negative controls and positive criteria product.
Preferably, the extracts reagent of excretion body total serum IgE is：TRIZOL.
Preferably, the digestion reagent of excretion body STb gene is：DNase I.
Preferably, negative controls are pGEM-7Zf (+) empty carrier.
Preferably, positive criteria product is pGEM-7Zf (+) plasmid vector containing insertion GRP78 specific nucleic acid sequences.
Preferably, GRP78 specific nucleic acid sequences such as SEQ ID NO：Shown in 3.
Preferably, the amount of positive criteria product is 105Copy/mL.
Copy number of the invention by detecting mRNA in peripheral blood excretion body, realizes the early screening of cancer.
Compared with prior art, the present invention has the advantages that：
Detection excretion body GRP78 mRNA can accomplish that the generation to related neoplasms carries out the early warning of early stage, and the present invention can be with
Just with 5ml blood with regard to the early screening of kinds cancer can be completed so that the early detection method of cancer it is special it is good, sensitive,
Efficiently, practical, noninvasive, reliability is high, is easy to medical institutions' clinical expansions at different levels, is also especially suitable for the body of tumor susceptibility patient
Examination and early warning are examined, there is important clinical value.
Brief description of the drawings
Fig. 1 is common PCR reaction electrophoretogram.
Fig. 2 is pGEM-7Zf (+) Vector map schematic diagram.
Fig. 3 is that (wherein 95~116bp is SEQ ID NO to cloned plasmids sequencer map：1；400~382bp is SEQ ID
NO：2).
Fig. 4 is blood plasma excretion body GRP78 gene cDNA quantitative fluorescent PCR standard curves.
Fig. 5 is outer for hepatocellular carcinoma, colorectal cancer, stomach cancer, non-small cell lung cancer and adult neural's glioma and normal person's detection
The copy number for secreting body GRP78 mRNA compares.
Fig. 6 is breast cancer compared with the copy number that female normal people detects excretion body GRP78 mRNA.
Fig. 7 is the copy that prostate cancer and male adult glioma detect excretion body GRP78 mRNA with normal person
Number compares.
Embodiment
The present invention is made with reference to Figure of description and specific embodiment and further being elaborated, the embodiment
It is served only for explaining the present invention, is not intended to limit the scope of the present invention.Test method used in following embodiments is such as without spy
Different explanation, is conventional method；Used material, reagent etc., unless otherwise specified, for the reagent commercially obtained
And material.
Embodiment 1
The cancer early screening kit of GRP78 mRNA in a kind of excretion body based on blood plasma, including excretion body GRP78
MRNA quantitative fluorescent PCRs sense primer and PCR anti-sense primers are as such as SEQ ID NO：Shown in 1~2, EDTA anticoagulant tubes, DNase
I, TRIZOL, PrimeScriptTM1st Strand cDNA Synthesis Kit,Premix Ex TaqTM, it is cloudy
Property reference substance and positive criteria product, wherein negative controls are pGEM-7Zf (+) empty carrier, and positive criteria product is contains insertion
PGEM-7Zf (+) plasmid vector of GRP78 specific nucleic acid sequences.
1st, the preparation process of positive criteria product, includes the following steps：
(1) PCR reacts
Because mRNA abundance is higher in human peripheral leucocytes, with the GRP78 (NCBI of mRNA in human peripheral leucocytes
Reference Sequence:NM_005347.4) it is template, and reverse transcription is into cDNA, PCR forward primers：Such as SEQ ID
NO：Shown in 4：AAGCTCTCCCTGGTGGCCGC, reverse primer：Such as SEQ ID NO：Shown in 5：
TCCTGCTGCACAGACGGGTCA, synthesizes by Shanghai Sangon Biotech Company.Reaction system 10 μ l, 1mmol/L containing 5 × buffer solution
5 μ l of dNTPs mixtures, upstream and downstream primer (2mmol/L) each 15 μ l of 2 μ l, 50mmol/L MgCl, Taq enzyme 1 μ l, template cDNA
2 μ l, add water to 50 μ l, amplification condition is 94 DEG C of 5min, 94 DEG C 45 seconds, 59 DEG C 60 seconds, 72 DEG C 60 seconds, 30 circulations.Product electricity
Swimming figure is as shown in Figure 1.This PCR product can also be directly obtained by artificial synthesized.
(2) plasmid construction
Use TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 glue reclaim reagents
Box, by specification carry out.After BamHI and HindIII double digestions, product length 415bp, clone into equally through BamHI and
PGEM-7Zf (+) carrier (being purchased from Promega companies, its plasmid map is as shown in Figure 2) of HindIII double digestions.It is transformed into DH5
α Escherichia coli, and positive colony sequencing is identified, through the sequencing of Shanghai life work biology Co., Ltd, the result is shown in Fig. 3.Sequencing result
It is completely the same with insetion sequence, preserve positive strain and be used for preparing positive criteria product every time.
(3) copy number is calculated
Previous step is obtained positive strain to be activated, amplification cultivation, extract plasmid, it is detected with micro-spectrophotometer
To be converted into copy number/volume, reduction formula is concentration：(6.02×1023) × cDNA concentration (g/mL)/(cDNA bases number ×
660)=copy number/mL；The base number of plasmid is：2997bp, brings formula into together with insetion sequence 415bp, then obtains plasmid
Concentration and the relation of copy number are：(2.673×1017) × cDNA concentration (g/mL)=copy number/mL, 10 are diluted to by plasmid5
Copy/mL.
2nd, the method for carrying out early-stage cancer screening using the kit of the present invention, includes the following steps：
(1) periphery blood plasma sample preparation
5ml blood is extracted to EDTA anticoagulant tubes, gently mixes, following operation is carried out in 30min：4 DEG C, 3000rpm from
Heart 10min；Inhale about 1mL supernatants to go in the 1.5mL centrifuge tubes of cleaning, 12,000rpm, 4 DEG C, centrifuge 10min, it is careful to draw
Supernatant is into new centrifuge tube.
(2) preparation of blood plasma excretion body
4 DEG C of 12,000rpm ultracentrifugations 30min, careful supernatant discarding, then add medical saline cleaning, in 4 DEG C 12,
000rpm ultracentrifugation 1h, obtained precipitation are excretion body.
(3) digestion of excretion body DNA
In excretion body precipitation plus contain 2U DNase I, be resuspended in solution and be incubated 45min at 37 DEG C, it is external to remove excretion
DNA.
(4) extraction of excretion body total serum IgE
Product one step up adds TRIZOL 1.5ml, and room temperature places 5min, adds chloroform 0.3ml, tightens lid, shakes
Dynamic to mix 15s, room temperature places 2min, then 4 DEG C of 12,000rpm centrifugations 15min.Honest and upright and thrifty 1ml is taken, is transferred to 1.5ml centrifuge tubes
In, add isopropanol 0.5ml, add the 3M sodium acetates of 100 μ L, mix, at room temperature 10min, 4 DEG C, 12,000rpm centrifugations
15min, abandons supernatant, adds 75% ethanol of 1.2ml DEPC processing sterilizing water process, gently mixes, 4 DEG C, 8,000rpm centrifugations
5min, abandons supernatant, drying at room temperature 5min, DEPC processing sterilizing pure water 100 μ L dissolvings, -80 DEG C of preservations
(5) reverse transcription reaction
Excretion body total serum IgE 4 μ L, primer 2 μ L are added inside ice bath centrifuge tube, removes 5 μ L of RNase free water, is mixed, from
3~5s of the heart；70 DEG C of water-bath 5min, ice bath 30s make primer and template correctly match；5 × reaction solution, 4 μ is added into above-mentioned product
12 μ L of μ L, dNTP of L, RNase inhibitor, mix；37 DEG C of water-bath 5min, add 1 μ L AMV-RT reverse transcriptase, mix；37℃
Water-bath 1h；70 DEG C of 10min inactivate enzymatic activity, and reaction was completed, and product puts progress next step PCR experiment on ice, remaining -80 DEG C of guarantors
Deposit.
(6) quantitative fluorescent PCR
By 105The positive criteria product of copy/mL carries out 10 times of dilutions, and 6 concentration gradients are obtained, and is respectively：105Copy/
ML, 104Copy/mL, 103Copy/mL, 102Copy/mL, 101Copy/mL, 100Copy/mL.With this 6 various concentrations gradients
Standard GRP78 cDNA be template, carry out quantitative fluorescent PCR, using standard items copy number to numerical value as abscissa, to measure
CT (Cycle Threshold) value be ordinate, draw standard curve (Fig. 4).Quantitative PCR is carried out to unknown sample, according to
The CT values of unknown sample, you can the copy number of sample is obtained in standard curve.Reaction carries out 3 repetitions.Wherein：
GRP78 forward primers such as SEQ ID NO：Shown in 1：
5'-GCCGAGGAGGAGGACAAGAAGG-3',
GRP78 reverse primers such as SEQ ID NO：Shown in 2：
5'-TTGGAGGTGAGCTGGTTCT-3',
Product length base number is 306bp；
Quantitative fluorescent PCR reaction condition is：0.05 μM of GRP78 forward primer, 0.05 μM of GRP78 reverse primer, 10 μ L
SYBRPremix Ex Taq (2 ×), 50ng reverse transcription reaction product, ddH20 supplement residual volume so that 20 μ L of final volume；
Carried out in 7500 real-time PCRs of ABI, reaction condition is 95 DEG C of 2min；Then 95 DEG C denaturation 30s, 56 DEG C
Anneal 45s, and 72 DEG C of extension 60s, totally 30 circulations, 72 DEG C of 10min, reaction was completed.
7th, statistical analysis：Using SPSS22.0 statistics softwares, using the t methods of inspection of independent sample, by each tumor group
Compared with being carried out two-by-two with normal controls group respectively, and shown with van-type figure.
Embodiment 2
1st, according to the method for embodiment 1 detect health adult and primary carcinoma of liver, colorectal cancer, stomach cancer, non-small cell lung cancer,
The peripheral blood sample of glioma, breast cancer and patients with prostate cancer, specific sample information see the table below shown in 1.Offer standard
CDNA concentration is
Table 1
2nd, testing result is as shown in table 2：
Table 2
Note：SD=12.70 copies/mL of health adult's group
The copy number average value of GRP78 mRNA is respectively in excretion body, and health adult organizes 28.22 copies/mL (scopes 0
~116), wherein women group 28.91 copies/mL (scope 10~45), and male organizes 27.90 copies/mL (scope 0~116)；Liver
Cell cancer group 285.63 copies/mL (scope 57~582), and colorectal cancer group 117.82 copies/mL (scope 27~347), stomach cancer group
107.88 copies/mL (scope 40~575), non-small cell lung cancer group 303.65 copy/mL (scope 44~887), neuroglia
Knurl group 64.02 copies/mL (scope 33~134) (Fig. 5)；Breast cancer group 68.20 copies/mL (scope 21~154) (Fig. 6)；Before
Row adenocarcinoma groups 72.18 copy/mL (scope 18~196) (Fig. 7).
What hepatocellular carcinoma group, colorectal cancer group, stomach cancer group, non-small cell lung cancer and adult's glioma group were organized with normal person respectively
Excretion body GRP78 mRNA averages compare, and t is examined and is statistically significant (P<0.0001)；Breast cancer group and female normal
Control group excretion body GRP78 mRNA compare, and t is examined and is statistically significant (P<0.0001)；Prostate cancer group and male
Normal group excretion body GRP78 mRNA compare, and t is examined and is also statistically significant (P<0.0001).Therefore, excretion
The copy number of body GRP78 mRNA can be as general cancer diagnosis and warning index.
Exceptional value (outlier) refer in one group of measured value with average valueMore than twice standard deviation of deviation
The measured value of (standard deviation, SD).According to《Sampling procedures for inspection by attributes》(GB2828) and《Normal sample is abnormal
The judgement and processing of value》(GB4883) regulation, we are with average valueCritical value as clinical practice.This research
In, average value=28.22, SD=12.70 of healthy control group, so GRP78 copy numbers in peripheral blood excretion body of the present invention
Lower limits of normal is that 28.22-2 × 12.70=2.82 copy/mL, and the upper limit is 28.22+2 × 12.70=53.62 copies/mL,
That is 2.82~53.62 copies/mL as it is regardless of sex when clinic normal reference value.Wherein, for evaluating breast cancer women just
Normal reference value is 8.37~49.45 copies/mL, and male's normal reference value 0~56.52 for evaluating prostate cancer is copied
Shellfish/mL.If detected value is more than above-mentioned normal reference value, subject is probably that the probability of above-mentioned several cancers is higher, is prompted
Subject further carries out other relevant cancer index checkings to clarify a diagnosis.
Further, using above-mentioned normal person's reference range, with normal person's upper limit value, (breast cancer refers to women reference value
The upper limit, prostate cancer refer to male's reference value upper limit), to the sensitiveness of 7 kinds of screening for cancer, specificity, positive predictive value and examine
Disconnected coincidence rate is counted.As a result such as table 3 below：
Table 3
The result shows that the specificity of seven kinds of cancers of detection reaches more than 98%.Sensitiveness is then with hepatocellular carcinoma
(100%) and non-small cell lung cancer (98.33%) is highest；Colorectal cancer (88.00%), stomach cancer (84.00%), prostate cancer
(78.00%) and glioma (74.00%) secondly；Breast cancer is worst (still up to 68%).Their positive predictive value reaches
To more than 97%, false positive rate is very low (being below 1.5%).Negative predictive value is less desirable except breast cancer 66.67%, other
Tumour reaches more than 85%；Hepatocellular carcinoma and non-small cell lung cancer are respectively less than 2% in false negative rate, and breast cancer is higher
(32.00%).Diagnostic accordance rate is poor (remaining above 80%) except breast cancer, and other tumours are 90% or more.Breast cancer
Sensitiveness is although low, but its specificity highest (100%), false positive rate are minimum (0%), so, blood plasma excretion body GRP78
MRNA can also be preferable Testing index for breast cancer.These explanations, blood plasma excretion body GRP78 mRNA can be used as upper
The examination of 7 kinds of tumours and the good index of auxiliary diagnosis are stated, also especially there is early warning in crowd's physical examination.
Since above-mentioned tumour is respectively provided with higher heterogeneity, it is specific immune or gene level that 100% is had no at present
Label.The present invention uses in the blood plasma of periphery GRP78 mRNA as cancer early warning and the label of auxiliary diagnosis, although
Without 100% specificity, but be able to can be improved as effective clinically one of efficiency index of auxiliary diagnosis
State the early diagnostic rate of cancer in 7 and reduce misdiagnosis rate, there is important clinical meaning and medical Development volue.
Sequence table
<110>Guangdong medical university
<120>A kind of general cancer early screening kit based on blood plasma excretion body GRP78 mRNA
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213>People (Homo sapiens)
<400> 1
gccgaggagg aggacaagaa gg 22
<210> 2
<211> 19
<212> DNA
<213>People (Homo sapiens)
<400> 2
ttggaggtga gctggttct 19
<210> 3
<211> 426
<212> DNA
<213>People (Homo sapiens)
<400> 3
aagctctccc tggtggccgc gatgctgctg ctgctcagcg cggcgcgggc cgaggaggag 60
gacaagaagg aggacgtggg cacggtggtc ggcatcgacc tggggaccac ctactcctgg 120
taagtggggt tgcggatgca gggggacggg gcgtggccgc ctggcctggc gtgagaagtg 180
cggtgctgat gtccctctgt cgggtttttc tgccagcgtc ggcgtgttca agaacggccg 240
cgtggagatc atcgccaacg atcagggcaa ccgcatcacg ccgtcctatg tcgccttcac 300
tcctgaaggg gaacgtctga ttggcgatgc cgccaagaac cagctcacct ccaaccccga 360
gaacacggtc tttgacgcca agcggctcat cggccgcacg tggaatgacc cgtctgtgca 420
gcagga 426
<210> 4
<211> 20
<212> DNA
<213>People (Homo sapiens)
<400> 4
aagctctccc tggtggccgc 20
<210> 5
<211> 21
<212> DNA
<213>People (Homo sapiens)
<400> 5
tcctgctgca cagacgggtc a 21
Claims (10)
1. a pair is used for the specificity fluorescent quantitative RT-PCR detection primer of cancer early screening, it is characterised in that including excretion
Body GRP78 mRNA quantitative fluorescent PCRs sense primers and PCR anti-sense primers, the nucleotide sequence such as SEQ ID NO of primer：1~
Shown in 2.
2. the specificity fluorescent quantitative RT-PCR detection primer of the cancer early screening described in claim 1 is preparing cancer early stage
Application in kit for screening.
3. a kind of cancer early screening kit based on blood plasma excretion body GRP78 mRNA, it is characterised in that wanted containing having the right
Seek the specificity fluorescent quantitative RT-PCR detection primer described in 1.
4. inspection cancer early screening kit according to claim 3, it is characterised in that the kit also includes：
EDTA anticoagulant tubes, excretion body STb gene digestion reagent, excretion body total RNA extraction reagent, reverse transcription reaction reagent, quantitative fluorescent PCR
Reagent, negative controls and positive criteria product.
5. cancer early screening kit according to claim 3, it is characterised in that the extracts reagent of excretion body total serum IgE
For：TRIZOL.
6. cancer early screening kit according to claim 3, it is characterised in that the digestion reagent of excretion body STb gene
For：DNase I.
7. cancer early screening kit according to claim 3, it is characterised in that negative controls pGEM-7Zf
(+) empty carrier.
8. cancer early screening kit according to claim 3, it is characterised in that positive criteria product is to contain insertion
PGEM-7Zf (+) plasmid vector of GRP78 specific nucleic acid sequences.
9. cancer early screening kit according to claim 8, it is characterised in that GRP78 specific nucleic acid sequences are such as
SEQ ID NO：Shown in 3.
10. cancer early screening kit according to claim 8, it is characterised in that the amount of positive criteria product is 105Copy
Shellfish/mL.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711170283.4A CN108004319A (en) | 2017-11-20 | 2017-11-20 | A kind of general cancer early screening kit based on blood plasma excretion body GRP78 mRNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711170283.4A CN108004319A (en) | 2017-11-20 | 2017-11-20 | A kind of general cancer early screening kit based on blood plasma excretion body GRP78 mRNA |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108004319A true CN108004319A (en) | 2018-05-08 |
Family
ID=62053172
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711170283.4A Pending CN108004319A (en) | 2017-11-20 | 2017-11-20 | A kind of general cancer early screening kit based on blood plasma excretion body GRP78 mRNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108004319A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111455037A (en) * | 2020-04-02 | 2020-07-28 | 广东医科大学 | Coronary heart disease molecular diagnosis marker based on plasma exosome cyclic RNA and application thereof |
| CN111996249A (en) * | 2019-05-27 | 2020-11-27 | 苏州普瑞迈德医学检验所有限公司 | Cancer diagnosis and disease course monitoring method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101575641A (en) * | 2009-05-31 | 2009-11-11 | 中山大学 | Method for detecting fluorescence quantitative PCR genotypes of predisposing genes of hepatic cell carcinoma and kit thereof |
| CN104630351A (en) * | 2015-01-20 | 2015-05-20 | 湖州市第一人民医院 | RT-PCR primers for detecting transcriptional level of GRP78 mRNA in serum as well as kit and method for evaluating concurrent intestinal cancer susceptibility of hyperglycemia population |
-
2017
- 2017-11-20 CN CN201711170283.4A patent/CN108004319A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101575641A (en) * | 2009-05-31 | 2009-11-11 | 中山大学 | Method for detecting fluorescence quantitative PCR genotypes of predisposing genes of hepatic cell carcinoma and kit thereof |
| CN104630351A (en) * | 2015-01-20 | 2015-05-20 | 湖州市第一人民医院 | RT-PCR primers for detecting transcriptional level of GRP78 mRNA in serum as well as kit and method for evaluating concurrent intestinal cancer susceptibility of hyperglycemia population |
Non-Patent Citations (6)
| Title |
|---|
| B. SANDFELD-PAULSEN等: "Exosomal proteins as prognostic biomarkers in non-small cell lung cancer", 《MOLECULAR ONCOLOGY》 * |
| D. XIAO等: "Identifying mRNA, MicroRNA and Protein Profiles of Melanoma Exosomes", 《PLOS ONE》 * |
| M. GUAN等: "MDA-9 and GRP78 as potential diagnostic biomarkers for early detection of melanoma metastasis", 《TUMOR BIOL》 * |
| NCBI: "Homo sapiens heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5) gene,complete cds DQ385847.1", 《GENBANK》 * |
| NCBI: "Homo sapiens heat shock protein family A (Hsp70) member 5 (HSPA5), mRNA NM_005347.4", 《GENBANK》 * |
| Z. LI等: "Acetylation modification regulates GRP78 secretion in colon cancer cells", 《SCIENTIFIC REPORTS》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111996249A (en) * | 2019-05-27 | 2020-11-27 | 苏州普瑞迈德医学检验所有限公司 | Cancer diagnosis and disease course monitoring method |
| CN111455037A (en) * | 2020-04-02 | 2020-07-28 | 广东医科大学 | Coronary heart disease molecular diagnosis marker based on plasma exosome cyclic RNA and application thereof |
| CN111455037B (en) * | 2020-04-02 | 2022-05-27 | 广东医科大学 | Coronary heart disease molecular diagnosis marker based on plasma exosome cyclic RNA and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109439749A (en) | Excretion body miRNA marker and diagnostic kit for diagnosis of colorectal carcinoma | |
| CN109609633A (en) | One kind serum miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN106834470A (en) | Purposes of the miRNA in cancer diagnosing kit is prepared | |
| CN110423819A (en) | A kind of participation Human colorectal carcinoma proliferation and drug resistant lncRNA and its application | |
| CN109055557A (en) | One kind serum miRNA marker relevant to cancer of pancreas auxiliary diagnosis and its application | |
| CN108004319A (en) | A kind of general cancer early screening kit based on blood plasma excretion body GRP78 mRNA | |
| CN105256036A (en) | Kit for detecting lncARSR in serum and application of kit in detection of kidney cancer sunitinib drug resistance | |
| CN110408703A (en) | Colorectal cancer miRNA marker and its application | |
| CN109609634A (en) | One kind circulation miRNA marker relevant to carcinoma of endometrium auxiliary diagnosis and its application | |
| CN107475386B (en) | Long-chain non-coding RNA marker for diagnosis and treatment osteosarcoma | |
| CN108866187A (en) | One kind long-chain non-coding RNA marker relevant to lung cancer auxiliary diagnosis and its application | |
| CN109371022A (en) | A kind of circular rna hsa_circKPNA2_002 and its specificity amplification primer and application | |
| CN109593852B (en) | Serum miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN106987633A (en) | A kind of primer and kit for detecting colorectal cancer serum secretion type lncRNAs | |
| CN110317878A (en) | A kind of long-chain non-coding RNA and its application for bladder cancer diagnosis and treatment monitoring | |
| CN110257514A (en) | A kind of new cancer of the esophagus blood miRNA marker and its application | |
| CN109593851A (en) | One kind blood plasma miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN109402123A (en) | A kind of circular rna hsa-circ-0073004 and its specificity amplification primer and application | |
| CN109371027A (en) | A kind of circular rna hsa-circ-0002938 and its specificity amplification primer and application | |
| CN107043770A (en) | The related PBLC miRNA of one group of tuberculosis and its application | |
| CN109536612B (en) | Plasma miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN114875146A (en) | Molecular marker for detecting tRF type gastric cancer in plasma and application of molecular marker in preparation of gastric cancer auxiliary diagnosis kit | |
| CN107287310A (en) | A kind of colorectal cancer auxiliary diagnosis and/or Index for diagnosis kit and application based on SPEXIN | |
| CN107904310A (en) | Urine microRNA biomarkers, kit and its application for diagnosis of colorectal carcinoma | |
| CN107012207A (en) | LRP5 is used as clinical diagnosis and the application of suppression digestive system tumor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180508 |