CN110563740A

CN110563740A - Alpha-pyrone compound, preparation method, strain and application

Info

Publication number: CN110563740A
Application number: CN201910715236.6A
Authority: CN
Inventors: 章华伟; 潘瑞; 华熠; 陈建伟; 魏斌; 王鸿
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2019-08-05
Filing date: 2019-08-05
Publication date: 2019-12-13
Anticipated expiration: 2039-08-05
Also published as: CN110563740B

Abstract

the invention discloses an alpha-pyrone compound, a preparation method, a strain and application thereof, and provides a method for co-culturing two strains of fungi on a rice culture medium; the alpha-pyrone compound (I) produced in large amount by fermentation has the yield of 4 percent, has certain activity in the aspect of anti-tumor, and can be structurally modified at the later stage to prepare the derivative to greatly improve the anti-tumor activity of the derivative, so that the anti-tumor medicament is prepared; the inhibition rate of the compound I on A549 human lung cancer cell strains is 23.54%. The alpha-pyrone compound is produced by microbial fermentation, and has the advantages of simple operation process, short period, low cost and no pollution to the environment.

Description

alpha-pyrone compound, preparation method, strain and application

(I) technical field

The invention relates to an alpha-pyrone compound, a preparation method, a strain and application.

(II) background of the invention

The discovery of new active pharmaceutical lead compounds has been a focus of attention by medicinal chemists. In the case that the search for potential drugs from animal and plant resources is far from satisfying the therapeutic needs of human beings for diseases, microorganisms (mainly fungi and bacteria) become an important choice for searching for new active natural products due to their characteristics of fast reproduction, easy culture and the like.

Studies have shown that endophytes are an important component of functional products that are abundant in microorganisms. The coastal areas are used as transition zones of oceans and land, the living environment of the plants is very special, and the plants have one surface common to the oceans and the land plants and one unique surface different from the oceans and the land plants, such as swampiness, salinization and the like. Therefore, the endophytic fungi of the coastal plants, which are taken as one of the marine fungi, have more different survival and metabolic mechanisms and are easier to generate the medicinal lead compound with novel structure and higher activity.

At present, the preparation method of the alpha-pyrone compound mainly comprises two types of chemical synthesis and biological conversion, wherein the chemical synthesis has the advantages of strong purpose, convenient production, controllable production conditions, small investment and quick response, and has the defects of environmental pollution and high cost for three-waste treatment. The biosynthesis mainly synthesizes specific medicines through the metabolism of organisms, is the expansion of modern fermentation engineering and genetic engineering, has less environmental pollution and is suitable for large-scale production of medicines. In short, it is a process of synthesizing a drug from a prodrug using a microorganism. Biosynthesis is a future trend of modern pharmaceutical development, and the alpha-pyrone compound provided by the patent is produced by microbial fermentation.

Disclosure of the invention

The invention aims to provide an alpha-pyrone compound, a preparation method, a strain and application, and solves the problem of large-scale production of the alpha-pyrone compound.

The technical scheme adopted by the invention is as follows:

In a first aspect, the present invention provides an α -pyrone compound represented by formula (I), having a chemical structure as follows:

In a second aspect, the present invention provides a preparation method of the α -pyrone compound represented by formula (I), where the method includes: (1) fermentation culture: respectively inoculating Aspergillus fumigatus (Aspergillus fumigatus) D and Fusarium oxysporum (Fusarium oxysporum) ZZP-R1 to two sides of a rice culture medium, reserving the culture medium with a width of 2-3cm in the middle, not inoculating strains, standing and culturing at a constant temperature of 28 ℃ for 40-50 days, uniformly stirring and mixing fermentation mixtures of the two bacteria under aseptic operation, and standing and culturing at the temperature of 28 ℃ for 5 days to obtain fermentation products; the final concentration of the rice culture medium comprises: 400-500g/L rice, and distilled water as solvent; (2) and (3) separating and purifying the alpha-pyrone compound: extracting the fermentation product prepared in the step (1) with ethyl acetate of the same volume under the assistance of ultrasound, filtering, and concentrating an organic layer (preferably, vacuum concentration at 40 ℃) until no liquid flows out to obtain a concentrate; dissolving the concentrate obtained in the step I with methanol to obtain a suspension, extracting with n-hexane with the volume twice that of the suspension (preferably 3 times) to obtain an n-hexane extraction layer and a methanol layer, and extracting the methanol layer with dichloromethane with the volume twice that of the methanol layer (preferably 3 times) to obtain a dichloromethane extraction layer; concentrating the dichloromethane extraction layer until no liquid flows out (preferably vacuum concentrating at 45 deg.C) to obtain extract; dissolving the extract in the step (II) by using n-hexane (preferably, the volume of the n-hexane is 5ml/g based on the weight of the extract), then loading the dissolved extract on a silica gel chromatographic column, taking dichloromethane and methanol with the volume ratio of 99:1 or 98:2 as eluent, respectively collecting the effluent liquid of which the peak appears in 15min or 12.5min, and removing the mobile phase in vacuum (preferably, the low temperature of 50 ℃) to obtain the alpha-pyrone compound shown in the formula (I).

the liquid phase apparatus shown: UV-VIS, detector: shimadzu SPD-16; high-efficiency liquid-phase infusion pump: shimadzu LC-16P; chromatographic conditions are as follows: c₁₈The chromatographic column is 250 multiplied by 9.4mm, the flow rate is 3.0mL/min, the column temperature is 30 ℃, and the detection wavelength is 210 nm; the mobile phase comprises 40:60 double distilled water to acetonitrile and 35:65 double distilled water to methanol in volume ratio.

The ultrasonic auxiliary conditions in the step (2) are as follows: ultrasonic treating at 40KHz for 15-20 min. The extraction is preferably carried out for 3 times, 4 layers of gauze are adopted for filtration after extraction, and organic layers are combined for concentration.

And step three, filling 200-mesh silica gel with the size of 5 times of the extract into the silica gel column of 50cm by 5 cm.

Before Aspergillus fumigatus (Aspergillus fumigatus) D and Fusarium oxysporum (Fusarium oxysporum) ZZP-R1 are inoculated to a rice culture medium, activating and seed expanding culture are carried out, and then seed liquid is inoculated to the rice culture medium respectively in an inoculation amount with the volume concentration of 5%, wherein the activating and seed expanding culture method comprises the following steps:

(1) Activation culture: inoculating the strain D and the strain ZZP-R1 to a PDA slant culture medium, and performing moisture-keeping culture in an incubator at 28 ℃ for 3-4 days to activate strains; the final concentration composition of the PDA slant culture medium is as follows: 20g/L of sucrose, 200g/L of potato, 15-18g/L of agar, distilled water as a solvent and natural pH value;

(2) Seed culture: selecting one strain of the circulant from the activated colonies, inoculating the strain to a PDB seed culture medium, and performing shake culture at 200rpm and 28 ℃ for 3 days to respectively obtain a strain D seed solution and a strain ZZP-R1 seed solution; the final concentration composition of the PDB seed culture medium is as follows: 200g/L of potato, 20g/L of cane sugar and distilled water as a solvent, and the pH value is natural.

In a third aspect, the invention provides an application of the alpha-pyrone compound shown in the formula (I) in preparation of tumor cell activity inhibitors, wherein tumor cells comprise a human lung cancer cell strain A549, a human liver cancer cell strain Bel-7402 and a human colon cancer cell strain HCT-8, preferably, the tumor inhibitors are A549 human lung cancer cell strain inhibitors, and the inhibition rate of the compound I on the A549 human lung cancer cell strain is 23.54%.

In a fourth aspect, the present invention further provides Aspergillus fumigatus (Aspergillus fumigatus) D for preparing the α -pyrone compound represented by formula (I), wherein the strain is deposited in the common microbiology center of the china committee for culture collection and management of microorganisms, the deposition date is 29.05.2019, the deposition number is CGMCC No.17762, the address is No. 3 of north chen west road No.1, tokyo, beijing, and the postal code is 100101.

In a fifth aspect, the present invention provides Fusarium oxysporum (Fusarium oxysporum) ZZP-R1 for preparing an α -pyrone compound represented by formula (I), wherein the strain is deposited in the common microbiology center of the china committee for culture collection of microorganisms at 29 days 05 and 2019, and the deposit number is CGMCC No.17763, and the address is No. 3 of north chen shilu No.1, and the zip code 100101 in the sunny region of beijing.

Compared with the prior art, the invention has the following beneficial effects:

(1) The invention screens two new strains and provides a method for co-culturing two strains of fungi on a rice culture medium;

(2) The fermentation method can prepare and produce the alpha-pyrone compound (I), has certain activity in the aspect of anti-tumor, and can carry out chemical structure modification in the later stage to prepare the derivative thereof so as to improve the anti-tumor activity of the derivative, thereby preparing the anti-tumor medicament; the inhibition rate of the compound I on A549 human lung cancer cell strains reaches 23.54 percent.

(3) The alpha-pyrone compound is produced by microbial solid state fermentation, and has the advantages of simple operation process, short period, low cost and no pollution to the environment.

(IV) description of the drawings

FIG. 1 is a photograph of the primary screening bacterial strain bacteriostasis experiment in step 2.1, wherein A is Escherichia coli, B is Staphylococcus aureus, and C is Candida albicans.

FIG. 2 shows the fermentation status of strains 58, 3-11, F, 5-19, D, BZ, 3-8, 4-12, B and 28 in the second screening step 2.3.

FIG. 3 shows the colony morphology of strain D.

FIG. 4 is a phylogenetic tree of strain D.

FIG. 5 shows the fermentation conditions of ZZP-R1, R2, L1, L6, L9, L10 and L16 in step 3.2.

FIG. 6 is the colony morphology of strain D.

FIG. 7 shows a phylogenetic tree of strain ZZP-R1.

FIG. 8 is a diagram showing a state of co-cultivation, wherein A is a diagram showing no agitation and B is a diagram showing agitation.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

Example 1: isolation, identification and preservation of Strain D and Strain ZZP-R1

1. culture medium

The final concentration composition of the PDB seed culture medium is as follows: potato 200g/L, glucose 20g/L, solvent distilled water, and natural pH.

PDA medium is prepared by adding 20g/L agar into PDB medium.

WA medium: 20g/L of agar, distilled water as a solvent and natural pH value.

LB liquid medium: 10g/L of tryptone, 5g/L of yeast extract, 10g/L of sodium chloride and distilled water as a solvent, and the pH value is 7.4.

the LB solid medium is prepared by adding 20g/L agar to LB medium.

Sand type liquid culture medium: 10g/L of tryptone, 40g/L of glucose and distilled water as a solvent, and the pH is natural.

The sand type solid culture medium is prepared by adding 20g/L agar into sand type liquid culture medium.

2. Screening and identification of Strain D

The strain D is obtained by separating littoral plant edgeworthia chrysantha leaves in Hangzhou gulf coastal areas, and the primary screening of the strain D is mainly carried out by screening the antibacterial activity of endophytic fungi thallus antagonistic pathogen indicator bacteria (bacteria and fungi) and fermentation liquor.

2.1 Collection of Strain D

fresh leaf blades of Edgeworthia chrysantha (Edgeworthia chrysantha., Thymelaeaceae, Edgeworthia plants, shrubs) are collected from the coastal region of the Bay of Hangzhou, the fresh leaf blades are immediately packaged by a fresh-keeping bag after being sampled, the fresh leaf blades are placed in a heat-preservation box and taken back to a laboratory, and the endophytic fungi are separated within 24 hours.

Firstly, washing dirt on the surface of fresh edgeworthia chrysantha with tap water, naturally drying, transferring to a super-clean workbench, washing with sterile water for 3 times, soaking with 75% ethanol for 1min, disinfecting with 1% sodium hypochlorite for 1min, and washing with sterile water for more than 3 times. 0.2mL of the washing solution of the last processed edgeworthia chrysantha leaf was aspirated, spread on PDA medium, and cultured in a 28 ℃ incubator for 3 days.

And cutting the disinfected leaf sample into small sections of about 1cm by using a sterilized scalpel, obliquely inserting the small sections into the surface of the WA culture medium at an angle of 45 degrees, placing 3 sections on each plate, and culturing at the constant temperature of 28 ℃ for 4-9 days. And after the hyphae grow out from the incision, picking the hyphae and transferring the hyphae to a PDA culture medium, carrying out streaking separation on endophytic fungi, and repeatedly streaking until a single colony grows out in the culture medium.

Finally, ten single endophytic fungi are separated and are respectively marked as strains 58, 3-11, F, 5-19, D, BZ, 3-8, 4-12, B and 28.

2.2 preliminary screening

And (3) primarily screening the bacterial strain obtained in the step (2.1) by adopting an antibacterial activity experiment, wherein the antibacterial activity experiment adopts an agar block method, and the presence or absence of a transparent antibacterial ring is used as an investigation index to perform an activity primary screening experiment on the endophytic fungi. The method comprises the steps of activating indicator bacteria (Escherichia coli ATCC 25922) and Staphylococcus aureus (Staphylococcus aureus ATCC25923), inoculating a small amount of bacteria to an LB culture medium in an aseptic environment, culturing at a constant temperature of 37 ℃ for 24 hours, inoculating indicator pathogenic fungi (Candida albicans ATCC 10231) to a PDA culture medium, and culturing at a constant temperature of 28 ℃ for 48 hours. After the indicator bacteria are activated, respectively inoculating into liquid culture medium (Escherichia coli and Staphylococcus aureus are inoculated into LB liquid culture medium, Candida albicans is inoculated into sand type liquid culture medium), culturing for 24 hr to obtain a certain concentration (about 5 × 10)⁴one/mL) of the bacterial suspension, namely the indicating bacterial liquid. And sucking 100 mu L of the indicator bacterium liquid on an LB solid or sand type solid culture medium, and uniformly coating the indicator bacterium liquid by using a sterile coating rod for later use.

inoculating the primary screened strain to a fresh PDA culture medium under the aseptic condition, and culturing for 5-8 days at the temperature of 27 ℃ in a constant-temperature incubator. After the bacterial colony is mature, preparing a bacterial cake on the bacterial colony by using a sterile puncher with the diameter of 6mm, picking the bacterial cake on a plate with indicator bacteria by using a sterile ring, culturing the bacteria at 37 ℃ for 12-24h, culturing the fungi at 28 ℃ for 12-24h, and observing and recording the existence of a bacteriostatic circle (figure 1). Each strain of 10 obtained fungi is subjected to 3 parallel tests on each indicator fungus, and the primary screening result shows that the 10 edgeworthia chrysantha source endophytic fungi plates have different capabilities of antagonizing 3 indicator fungi, wherein the antagonistic effect of the 28 bacteria on the 3 indicator fungi is optimal, transparent inhibition zones with the diameters of about 10mm, 8 mm and 12mm are formed respectively, the 5-19 bacteria and the 3-8 bacteria have inhibition effects on escherichia coli and staphylococcus aureus, the D bacteria and the B bacteria antagonize staphylococcus aureus to form transparent inhibition zones, the 4-12 bacteria have the most obvious antagonistic effect on candida albicans to form inhibition zones with the diameters of about 30mm, and the primary screening result provides basis for the selection of experimental endophytic fungi.

2.3 double sifting

Re-screening is to extract crude extract from the strain by fermentation and extraction technology, to further test the activity, and to determine the active strain by the hydrogen spectrum characteristic of the crude extract.

Activating 10 strain slant cultures obtained by separation in the step 2.2, inoculating the activated 10 strain slant cultures into 200mL PDB culture medium, setting the temperature of a shaking table to be 27 ℃, and culturing for 7-15d at the rotating speed of 145r/min to obtain 10 strain fungus fermentation liquor. As shown in FIG. 2, the fermentation broth of 13d cultured with the bacteria 58 is grayish green; 3-11, the growth speed is high, and the thalli begin to generate autolysis after 7 days; the growth of the bacterium F is slow; the bacteria 5-19 begin to grow, the bacteria liquid is milk white, the white bacteria gradually deepens after fermentation for 6 days and becomes pink, and the color continues deepening after fermentation for 10 days and becomes dark purple; the growth of the bacterium D is slow, the fermentation liquor is dark green after being cultured for 12-15 days, the fermentation time is prolonged, and the bacterium liquid is black; producing pigment in the culture process of the bacteria BZ; 3-8 bacteria grow rapidly, and the fermentation liquor is dark brown; the growth speed of the bacteria 4-12 is higher, and the fermentation liquor is yellow after 7 days; the growth speed of the bacteria B is slow, and the shape of the bacteria is similar to that of resin and is pink; during the culture process of the bacteria 28, the thalli are floccules and grow fast, and the color of the fermentation liquor is light yellow. And (3) filtering the fermented liquid by using four layers of gauze (removing hyphae), extracting the fermented liquid twice by using equal volume of ethyl acetate, taking an upper organic phase, concentrating the upper organic phase under reduced pressure until no liquid flows out, and drying the upper organic phase to constant weight to obtain the crude extract of the endophytic fungi.

Antifungal Activity test: and (3) determining the bacteriostatic activity of the endophytic fungi crude extract by adopting a double-layer plate method. About 10mL of the melted WA medium WAs poured into a petri dish with a diameter of 9cm, and after it WAs cooled, five oxford cups were uniformly placed on the medium. And (3) fully and uniformly mixing the candida albicans suspension obtained in the step (2.1) and a PDA culture medium at the temperature of about 50 ℃ according to the volume ratio of 1:1000, and pouring the mixture into WA culture medium which is solidified and is provided with an oxford cup in equal quantity to prepare a bacteria-carrying double-layer plate. After it was cooled, the oxford cup was taken out with tweezers. Then 100. mu.L of each sample of crude DMSO-formulated extract was added to each well at concentrations of 10, 1.0, and 0.1mg/mL, respectively. Equal volume of DMSO as a negative control and equal volume of amphotericin B (300. mu.g/mL) as a positive control, 3 replicates per set of experiments were performed. Placing in a constant temperature incubator, and culturing at 30 ℃ for 48 h.

Antibacterial activity test: and (3) adopting a double-layer flat plate punching method, wherein the specific steps are as described above, but the bacterial liquid is changed into the escherichia coli and staphylococcus aureus bacterial suspension prepared in the step 2.1. Equal volume of DMSO was used as a negative control, equal volume of ampicillin sodium solution (solvent DMSO, 200. mu.g/mL for E.coli, 2mg/mL for S.aureus) was used as a positive control, and 3 replicates were run for each group. Culturing at 30 deg.C in a constant temperature incubator for 24 hr.

The observation results show that, as shown in Table 1, the fermentation liquor of the strain D has obvious inhibition effect on escherichia coli, staphylococcus aureus and candida albicans at 10mg/mL, and has inhibition effect on escherichia coli and staphylococcus aureus at 1 mg/mL. The diameter of the formed bacteriostatic circle is approximately 10-15mm, the bacteria 5-19 fermentation liquor 10mg/mL can obviously inhibit the growth of staphylococcus aureus and candida albicans, the bacteriostatic circles with the diameters of more than 20mm and 16-20mm are respectively formed, and the bacteria BZ fermentation liquor has stronger inhibitory effect on the growth of staphylococcus aureus at 10 mg/mL. The fermentation product of the strain D has obvious antagonistic action on the three indicator strains, so that a screening basis is further provided for an experimental target strain.

TABLE 1 bacteriostatic activity of fermentation broth of edgeworthia chrysantha-derived endophytic fungi

(the diameter of the bacteriostatic circle represents < - >, no bacteriostatic effect; +, <10 mm; +, 10-15 mm; + + + + +, 16-20 mm; + + + + + +, > 20mm.)

2.4 identification

2.4.1 Strain D colony characteristics

Inoculating the strain D into a PDA slant culture medium, activating at 28 ℃ for 3-4 days, picking the activated colony on a new PDA culture medium by using an inoculating loop, and culturing at constant temperature of 28 ℃. Sparse hyphae; the colony is dark green, has a thickness less than 1mm, is in a velvet shape after being cultured for 4-5 days, has a bulge in the center, and has radial wrinkles on part of the flat plates, as shown in the colony morphology of bacterium D shown in figure 3.

2.4.2 extraction of Total DNA of Strain D

Inoculating the strain D on a PDA (PDA) plate, culturing at 28 ℃ for 7 days, then growing a colony to cover the plate, scraping a proper amount of colony, extracting the total DNA of the fungus by using a CTAB (cetyl trimethyl ammonium bromide) method, wherein the operation steps are as follows (the kit is an Ezup column type fungus genome DNA extraction kit):

(1) drying the hyphae, grinding into powder by using liquid nitrogen, and adding into a 1.5mL centrifuge tube;

(2) Adding 200 mu L of Buffer digest, 2 mu L of beta-mercaptoethanol and 20 mu L of protease K;

(3) Shaking and mixing uniformly, and carrying out water bath at 56 ℃ for 1h until the cells are completely lysed;

(4) Adding 100 μ L Buffer PF, fully reversing and mixing, and standing in a refrigerator at-20 deg.C for 5 min;

(5) Centrifuging at room temperature at 1000rpm for 5min, and transferring the supernatant into a 1.5mL centrifuge tube;

(6) Adding 200 mu L of Buffer BD, fully reversing and uniformly mixing;

(7) Adding 200 μ L of anhydrous ethanol, fully reversing and mixing;

(8) Putting the adsorption column into a collecting pipe;

(9) Centrifuging at 1000rpm at room temperature for 1min, and pouring off waste liquid in the collecting pipe;

(10) The adsorption column is put back into the collection tube;

(11) adding 500 mu L of PW Solution, centrifuging at 10000rpm for 30s, and pouring off waste liquid in the collecting pipe;

(12) putting the adsorption column into a collecting pipe;

(13) Centrifuging at 12000rpm at room temperature for 2min to remove residual Wash Solution;

(14) Taking out the adsorption column and putting the adsorption column into a new centrifugal tube;

(15) Adding 50 μ L TE Buffer, standing for 3min, and centrifuging at 12000rpm for 2 min;

(16) The DNA solution was collected.

2.4.3PCR primer amplification

Designing primer sequence according to fungus 18S rDNA conserved region, and selecting general primers NS1 and NS6 for amplification. The primer sequences are shown below:

NS1：GTAGTCATATGCTTGTCTC

NS6：GCATCACAGACCTGTTATTGCCTC

TABLE 218 rDNA PCR amplification systems and conditions

Sequencing samples are arranged on the sample plate according to the numbering sequence, the samples are added according to the sequence shown in a table, the samples are centrifuged at 850rpm under the room temperature condition, and the samples are evenly shaken after being covered with a cover. And centrifuging, denaturing, icing and centrifuging the sample, and performing PCR sequence amplification in an instrument. The PCR amplification procedure is shown in Table 3.

TABLE 3PCR protocol

2.4.4 construction of phylogenetic Tree

The 18S rDNA sequence (shown in SEQ ID NO. 1) of the strain D is submitted to GenBank (http:// ncbi. nm. nih. gov/BLAST), BLAST sequence alignment is carried out to determine the attribution of the strain, then sequence alignment analysis is carried out, the fungus 18S rDNA sequence with higher similarity is selected for downloading, MEGA 6.0 software Clustal X method is used for systematic analysis, the adjacent approach (Neighbor-Joining) is adopted, the Boottrap value is set to be 1000, and a phylogenetic tree is constructed for the strain D, and the result is shown in the figure (4). Finally, the bacteria are identified into species by combining the analysis results of morphology and molecular biology.

The PCR product shows that the length of the strain D18S rDNA sequence is 1339bp, the sequence is submitted to NCBI Gen-Bank (the sequence number of the GenBank is No. KR019681), and BLAST comparison is carried out on the sequence and a sequence in a database, and the result shows that the homology of the 18S rDNA sequence of the strain D and the corresponding sequence of Aspergillus fumigatus is 99%. To determine the relatedness of strain D, the DNA sequences of Aspergillus and representative strains of the genera neighbored in GenBank were selected, aligned by the Clustal X method, and strain D was used to construct a phylogenetic tree using the MEGA6 adjacency method, which was analyzed (FIG. 4) to show that strain D was clustered with Aspergillus fumigatus (Accession No. HM590663.1) with a 100 support rate. Meanwhile, the strain D is classified into Aspergillus fumigatus (Aspergillus fumigatus) by combining the morphological characteristics of the strain, named as Aspergillus fumigatus (Aspergillus fumigatus) D, and is preserved in the China general microbiological culture Collection center, wherein the preservation date is 29.05.2019, the preservation number is CGMCC No.17762, the address is No. 3 of Navy Silu 1 of the sunward area in Beijing, and the postal code is 100101.

3. Screening and identifying strain ZZP-R1

3.1 Collection of the Strain ZZP-R1

Fresh leaves of plant Stachys japonica (Abrus mollis, Dicotyledoneae, Labiatae, Elaeagnus) are collected from the coastal region of Zhoushan Putuo island in Hangzhou, China, and immediately packaged by a fresh-keeping bag after sampling, and the leaves are put into a heat-preservation box and brought back to a laboratory for separation of endophytic fungi within 24 hours.

The separation process is the same as the step 2.1, and 7 single endophytic fungi are finally separated, and the numbers of the fungi are ZZP-R1, R2, L1, L6, L9, L10 and L16.

3.2 screening

Culturing the 7 separated endophytic fungi slant cultures on a PDA culture medium at 28 ℃ for 5 days for activation, then inoculating the activated culture to 200mL PDB culture medium, setting the temperature of a shaking table to be 27 ℃ and culturing the culture for 15 days at the rotating speed of 145r/min to obtain 7 strains of fungi fermentation liquor. As shown in FIG. 6, the strain L1 grows slowly, the colony is initially white, the villi is thick, and then the color gradually changes from red to black from the middle; the growth speed of the strain L6 is high, and the fermentation liquor is yellow after 7 days; the growth speed of the strain L9 is higher, and the fermentation liquor is light yellow after 7 days; the strain L10 grows rapidly, and the fermentation liquor is dark red; the thalli of the strain L16 is floccule in the culture process, the growth is fast, and the color of the fermentation liquor is light yellow; the strain R1 can grow rapidly on PDA culture medium, the colony is fleshy, flocculent, white and dense, and spindle-shaped conidia; the bacteria R2 starts to grow, the bacteria liquid is milky white, the white bacteria gradually deepens to be light yellow after fermentation for 6 days, after the fermentation is finished, four layers of gauze are used for filtering (hypha is discarded), the fermentation liquid is extracted twice by equal volume of ethyl acetate, the upper layer of organic phase is taken, and the organic phase is decompressed, concentrated and dried to constant weight.

The results of the bacteriostasis experiments are shown in the table 4, and the crude extract of the fermentation liquor of the seven Stephania delavayi Diels endophytic fungi only has the inhibiting effect on staphylococcus aureus under the condition that the maximum concentration is 10 mg/mL. Wherein ZZP-L1 and ZZP-R1 have the strongest inhibition effect on staphylococcus aureus and have the same antibacterial activity with a positive medicament under 1 mg/mL; ZZP-L6, L9, L10 and R2 have the same antibacterial activity as the positive drugs only at the highest concentration of 10 mg/mL.

TABLE 4 bacteriostasis evaluation results of fermentation broth crude extracts of seven plant endophytic fungi from Stephania delavayi Franch

Zone of inhibition diameter indicates: -, no bacteriostatic effect; , +, <10 mm; 10-15 mm; 15-20 mm; not less than 20mm +++, and

3.4 identification

3.4.1 colony characteristics

the strain ZZP-R1 is inoculated on PDA slant culture medium, activated for 3-4 days at 28 ℃, and the activated colony is picked up by an inoculating loop and cultured on a new PDA culture medium at the constant temperature of 28 ℃. Quick growth, fleshy, protuberant and flocculent colony, white hypha, dense quality and spindle-shaped conidium. The colony morphology is as shown in the figure

3.4.2 extraction of ZZP-R1 total DNA

The experimental procedure was as in 2.4.2.

3.4.3PCR primer amplification

The experimental procedure was as in 2.4.3.

3.4.4 construction of phylogenetic Tree

The 18S rDNA sequence (shown in SEQ ID NO. 2) of the strain is subjected to BLAST sequence alignment through NCBI database (http:// NCBI. nm. nih. gov/BLAST), attribution is determined, a sequence with higher similarity is selected, a MEGA 6.0 software Clustal X method is used for systematic analysis, a phylogenetic tree is constructed by adopting a Neighbor-Joining method, and GenBank sequence numbers are submitted to NCBI GenBank to obtain the GenBank sequence numbers.

The length of the 18S rDNA sequence of the strain ZZP-R1 is 1613bp, the sequence is submitted to NCBI GenBank database (the GenBank sequence number is No. MF376147), and BLAST comparison is carried out, and the result shows that the homology of the 18S rDNA sequence of the strain ZZP-R1 and the corresponding sequence of Fusarium oxysporum is 99%. The sequences of the strains of Fusarium and the genera adjacent to the Fusarium in the GenBank database were selected, and a phylogenetic tree was constructed by the above method, and the result showed that the strain ZZP-R1 was clustered with Fusarium oxysporum (F.oxysporum) (Accession No. JF807402.1) at a supporting rate of 99% (FIG. 8). The strain ZZP-R1 is identified as Fusarium oxysporum (F. oxysporum) by combining the plate shape and the microscopic observation result of the strain ZZP-R1, is named as Fusarium oxysporum (Fusarium oxysporum) ZZP-R1, is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, has the preservation date of 29 days 05 and 29 months in 2019, has the preservation number of CGMCC No.17763, and has the address of No. 3 of Ministry of Xilu 1 of Chaxingzhong of the Korean district in Beijing, and has the zip code of 100101.

Example 2: preparation of Strain D and fermentation culture solution of Strain ZZP-R1

(1) activation culture: the strain D and the strain ZZP-R1 are respectively inoculated into a PDA slant culture medium (same as the example 1), and the strain is activated after being preserved and cultured for 3 to 4 days in an incubator at 28 ℃.

(2) Seed culture: one loop strain was selected from the activated colonies and inoculated into PDB seed medium (same as example 1), and shake-cultured at 200rpm and 28 ℃ for 3 days to obtain strain D seed solution and strain ZZP-R1 seed solution, respectively.

(3) Fermentation culture: respectively inoculating the strain D seed solution and the strain ZZP-R1 seed solution in the step (2) to two sides of a rice culture medium in an inoculation amount of 5% in volume concentration, leaving a culture medium with a width of 3cm in the middle without inoculating bacteria, standing and culturing at the constant temperature of 28 ℃ for 45 days, allowing the two bacteria to permeate into the bottom rice culture medium (A in figure 8), uniformly stirring and mixing the fermentation mixture of the two bacteria under aseptic operation, and continuously standing and culturing at the temperature of 28 ℃ for about 4-5 days until the culture medium is completely permeated by the bacteria to obtain a fermentation product (B in figure 8). The final concentration of the rice culture medium in each 1000mL Erlenmeyer flask consisted of: 160g of rice, 400mL of distilled water and 30min of high-pressure steam sterilization at 121 ℃.

Example 3: extraction, separation and identification of alpha-pyrone compound (I)

1. extraction and separation of alpha-pyrone compound (I)

The fermentation product prepared in example 2 was extracted 3 times with equal volume of ethyl acetate with the assistance of ultrasound, 40KHz ultrasound for 15min each time, filtered through four layers of gauze to obtain organic layers, combined and vacuum concentrated at 40 ℃ until no liquid flowed out, to obtain 90g of concentrate. Dissolving 90g of concentrate with 100ml of methanol to obtain a suspension, extracting with n-hexane twice the volume of the suspension for 3 times to obtain an n-hexane extraction layer and a methanol layer, extracting the methanol layer with dichloromethane twice the volume of the suspension for 3 times to obtain a dichloromethane extraction layer, and performing vacuum concentration at a low temperature of 45 ℃ until no liquid flows out to obtain 20g of extract; dissolving 20g of the extract with 100ml of n-hexane, loading the extract on a silica gel chromatographic column (the specification of the silica gel column is 50cm x 5cm, and 200-mesh silica gel with 5 times of extract is filled), taking dichloromethane and methanol with the volume ratio of 99:1 as eluent, carrying out reverse phase high performance liquid chromatography detection, collecting the effluent liquid with the peak output at 15min, or taking dichloromethane and methanol with the volume ratio of 98:2 as eluent, carrying out reverse phase high performance liquid chromatography detection, collecting the effluent liquid with the peak output at 12.5min, and removing the mobile phase at 50 ℃ under low temperature and vacuum to obtain the alpha-pyrone compound shown in the formula (I), wherein the mass of the alpha-pyrone compound is about 3.6 g.

2. structural characterization of Compound (I)

The obtained compound I was subjected to mass spectrometry and nuclear magnetic resonance spectroscopy.

(1) The mass spectrum data is: ESI-MS M/z 331.2[ M + Na ]]⁺,m/z 309.2[M+H]⁺(ii) a Determination of the formula C₁₇H₂₄O₅(ii) a The nuclear magnetic data is attributed in table 3.

Table 3: of the Compound I¹H-NMR and ¹³C-NMR Nuclear magnetic data and attribution

In summary, the structural formula of the target product is shown as formula (I):

The compound was named: (7S, 8R) -4, 8-dihydroxy-3, 8-dimethyl-7- ((S, E) -4-methylhexan-2-en-2-yl) -7, 8-dihydro-2H, 5H-pyrano [4,3-b ] pyran-2-one, known by the English name neovasinin.

example 4: evaluation of antitumor Activity of Compound I

The activity evaluation of the compound I adopts an SRB method (sulforhodamine B colorimetric method), and the tested tumor cells comprise a human lung cancer cell strain A549, a human hepatoma cell strain Bel-7402 and a human colon cancer cell strain HCT-8 which are all from the cell center of the basic research institute of Chinese medical academy of sciences.

The specific method comprises the following steps:

1. Selecting tumor cells in logarithmic growth phase, trypsinizing, and adjusting cell concentration to 2 × 10 with 10% fetal calf serum RPMI 1640 culture medium⁴each cell/mL, making a cell suspension.

2. The cells were seeded in 96-well plates at 37 ℃ in 190. mu.L cell suspension per well, 5% CO₂Cultured for 24h, and divided into drug wells, control wells and blank wells.

3. The drug wells were filled with 10. mu.l of Compound I sample solution (prepared in normal saline, Compound I added to a final concentration of 5. mu.g/mL), the control wells were filled with 5-FU (5-fluorouracil) at a final concentration of 5. mu.g/mL, the blank wells were filled with an equal volume of normal saline, 37 ℃, 5% CO₂And (5) culturing for 3 d.

4. The medium was discarded and 100. mu.L of 4 ℃ pre-cooled 50% TCA was gently added to each well to immobilize the cells, which were allowed to stand for 5min before being moved to 4 ℃ and left for 1 h.

5. Pouring out the stationary liquid, washing with distilled water for 5 times to remove TCA, air drying for 1h, adding 80 μ L of 0.4% SRB solution into each hole, and dyeing at room temperature for 30 min;

Discarding the dye solution, washing with 1% acetic acid for 5 times to sufficiently remove the unbound SRB, and air-drying; 150uL of 10mM Trisbase (pH 10.5) was added to each well to dissolve, and the solution was shaken on a micro shaker for 5 min. Measuring OD 510nm value by using an M5 enzyme-labeling instrument, and calculating the growth inhibition rate of the tumor cells, wherein the calculation formula is as follows: tumor cell growth inhibition (%) - (OD)_control-OD_medicine)/(OD_Control-OD_{Blank space}) X 100%. The results of the experiment are shown in table 2.

6. The preparation method of the required reagent comprises the following steps:

0.4% SRB solution: 0.8g of SRB (sulforhodamine B) was weighed out and dissolved in 200mL of 1% acetic acid (solvent: dd H)₂O), and storing at room temperature.

50% TCA solution: 50g of TCA (trichloroacetic acid) is weighed, added with water to a constant volume of 100mL, and stored at 4 ℃.

10mM Tris-base solution: 0.6057g Tris-base was weighed, added with water to a constant volume of 500mL, and stored at pH 10.5 and 4 ℃.

Table 2: inhibition of 3 cancer cells by Compound I

The evaluation result of the in vitro antitumor cell activity shows that the compound I has a certain growth inhibition effect on three tumor cells, and shows that the compound I has a certain application prospect in the preparation of antitumor drugs.

Sequence listing

<110> Zhejiang industrial university

<120> alpha-pyrone compound, preparation method, strain and application

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1024

<212> DNA

<213> Aspergillus fumigatus (Aspergillus fumigatus)

<400> 1

gctcttggtg atcataataa cttaacgaat cgcatggcct tgcgccggcg atggttcatt 60

caaatttctg ccctatcaac tttcgatggt aggatagtgg cctaccatgg tggcaacggg 120

taacggggaa ttagggttcg attccggaga gggagcctga gaaacggcta ccacatccaa 180

ggaaggcagc aggcgcgcaa attacccaat cccgacacgg ggaggtagtg acaataaata 240

ctgatacggg gctcttttgg gtctcgtaat tggaatgagt acaatctaaa tcccttaacg 300

aggaacaatt ggagggcaag tctggtgcca gcagccgcgg taattccagc tccaatagcg 360

tatattaaag ttgttgcagt taaaaagctc gtagttgaac cttgggtctg gctggccggt 420

ccgcctcacc gcgagtactg gtccggctgg acctttcctt ctggggaacc tcatggcctt 480

cactggctgt ggggggaacc aggactttta ctgtgaaaaa attagagtgt tcaaagcagg 540

cctttgctcg aatacattag catggaataa tagaatagga cgtgcggttc tattttgttg 600

gtttctagga ccgccgtaat gattaatagg gatagtcggg ggcgtcagta ttcagctgtc 660

agaggtgaaa ttcttggatt tgctgaagac taactactgc gaaagcattc gccaaggatg 720

ttttcattaa tcagggaacg aaagttaggg gatcgaagac gatcagatac cgtcgtagtc 780

ttaaccataa actatgccga ctagggatcg ggcggtgttt ctatgatgac ccgctcggca 840

ccttacgaga aatcaaagtt tttgggttct ggggggagta tggtcgcaag gctgaaactt 900

aaagaaattg acggaagggc accacaaggc gtggagcctg cggcttaatt tgactcaaca 960

cggggaaact caccaggtcc agacaaaata aggattgaca gattgagagc tctttcttga 1020

tctt 1024

<210> 2

<211> 543

<212> DNA

<213> Fusarium oxysporum (Fusarium oxysporum)

<400> 2

aaaagtcgta acaaggtctc cgttggtgaa ccagcggagg gatcattacc gagtttacaa 60

ctcccaaacc cctgtgaaca taccacttgt tgcctcggcg gatcagcccg ctcccggtaa 120

aacgggacgg cccgccagag gacccctaaa ctctgtttct atatgtaact tctgagtaaa 180

accataaata aatcaaaact ttcaacaacg gatctcttgg ttctggcatc gatgaagaac 240

gcagcaaaat gcgataagta atgtgaattg cagaattcag tgaatcatcg aatctttgaa 300

cgcacattgc gcccgccagt attctggcgg gcatgcctgt tcgagcgtca tttcaaccct 360

caagcacagc ttggtgttgg gactcgcgtt aattcgcgtt cctcaaattg attggcggtc 420

acgtcgagct tccatagcgt agtagtaaaa ccctcgttac tggtaatcgt cgcggccacg 480

ccgttaaacc ccaacttctg aatgttgacc tcggatcagg taggaatacc cgctgaactt 540

aag 543

Claims

1. an alpha-pyrone compound shown as a formula (I),

2. A process for preparing an α -pyrone compound of formula (I) according to claim 1, wherein the process comprises: (1) fermentation culture: respectively inoculating Aspergillus fumigatus (Aspergillus fumigatus) D and Fusarium oxysporum (Fusarium oxysporum) ZZP-R1 to two sides of a rice culture medium, reserving the culture medium with a width of 2-3cm in the middle, not inoculating strains, standing and culturing at a constant temperature of 28 ℃ for 40-50 days, uniformly stirring and mixing fermentation mixtures of the two bacteria under aseptic operation, and standing and culturing at the temperature of 28 ℃ for 5 days to obtain fermentation products; the final concentration of the rice culture medium comprises: 400-500g/L rice, and distilled water as solvent; the preservation number of the Aspergillus fumigatus (Aspergillus fumigatus) D is CGMCC No. 17762; the preservation number of the Fusarium oxysporum (Fusarium oxysporum) ZZP-R1 is CGMCC No. 17763; (2) and (3) separating and purifying the alpha-pyrone compound: extracting the fermentation product prepared in the step (1) with ethyl acetate with the same volume under the assistance of ultrasound, filtering, and concentrating an organic layer until no liquid flows out to obtain a concentrate; dissolving the concentrate in the step I by using methanol to obtain a suspension, extracting by using n-hexane with the volume twice that of the suspension to obtain an n-hexane extraction layer and a methanol layer, and extracting the methanol layer by using dichloromethane with the volume twice that of the methanol layer to obtain a dichloromethane extraction layer; concentrating the dichloromethane extraction layer until no liquid flows out to obtain an extract; and thirdly, dissolving the extract in the second step by using normal hexane, then loading the extract on a silica gel chromatographic column, taking dichloromethane and methanol with the volume ratio of 99:1 or 98:2 as eluent, respectively collecting effluent liquid with peak output in 15min or 12.5min, and removing a mobile phase in vacuum to obtain the alpha-pyrone compound shown in the formula (I).

3. the method of claim 2, wherein the ultrasound-assisted conditions of step (2) are: ultrasonic treating at 40KHz for 15-20 min.

4. The method according to claim 2, wherein the silica gel column in step (c) is 50cm by 5cm, and is filled with 200 mesh silica gel in an amount of 5 times the amount of the extract.

5. The method according to claim 2, wherein the Aspergillus fumigatus D and Fusarium oxysporum ZZP-R1 are inoculated into a rice culture medium, followed by activation and seed expansion, and then the seed solution is inoculated into the rice culture medium at an inoculum size of 5% by volume, respectively, by the following steps:

6. use of the alpha-pyrone compound of formula (I) according to claim 1 in the preparation of an inhibitor of tumor cell activity.

7. The use of claim 6, wherein the tumor cell comprises a human lung cancer cell line A549, a human hepatoma cell line Bel-7402 or a human colon cancer cell line HCT-8.

8. an Aspergillus fumigatus (Aspergillus fumigatus) D for preparing the alpha-pyrone compound represented by formula (I) of claim 1, wherein the strain is deposited in the general microbiological center of the china committee for culture collection of microorganisms at 29.05.2019, and the deposition number is CGMCC No.17762, and the address is No. 3, zip code 100101, of north china institute for sunny district, north china.

9. fusarium oxysporum (Fusarium oxysporum) ZZP-R1, which is deposited in China general microbiological culture Collection center (CGMCC) with the date of 29.05.2019 and the accession number of CGMCC No.17763, assigned to Kyowa sunward, Xilu No.1, P.Y., zip code 100101, is used for preparing the alpha-pyrone compound represented by the formula (I) in claim 1.