CN114409661B - Indole alkaloid compound and preparation method and application thereof - Google Patents
Indole alkaloid compound and preparation method and application thereof Download PDFInfo
- Publication number
- CN114409661B CN114409661B CN202210098568.6A CN202210098568A CN114409661B CN 114409661 B CN114409661 B CN 114409661B CN 202210098568 A CN202210098568 A CN 202210098568A CN 114409661 B CN114409661 B CN 114409661B
- Authority
- CN
- China
- Prior art keywords
- compound
- eluent
- methanol
- tobacco
- silica gel
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
- C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
- C07D487/06—Peri-condensed systems
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N43/00—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
- A01N43/90—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having two or more relevant hetero rings, condensed among themselves or with a common carbocyclic ring system
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
- C12P17/182—Heterocyclic compounds containing nitrogen atoms as the only ring heteroatoms in the condensed system
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Botany (AREA)
- Agronomy & Crop Science (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Pest Control & Pesticides (AREA)
- Biomedical Technology (AREA)
- Mycology (AREA)
- Plant Pathology (AREA)
- Environmental Sciences (AREA)
- Dentistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses an indole alkaloid compound, which is characterized by having the following structure:
the molecular formula of the indole alkaloid compound is as follows: c 17 H 16 N 2 O 3 The compound is named as aspergillus versicolor alkaloid-H. The invention also discloses a preparation method of the indole alkaloid compound and application of the indole alkaloid compound in preparation of a tobacco black shank resistant biological pesticide preparation.
Description
Technical Field
The invention belongs to the technical field of natural product chemistry, and particularly relates to an indole alkaloid compound and a preparation method and application thereof.
Background
The tobacco black shank is one of the most devastating diseases in tobacco production, and is also called tobacco epidemic disease, and the tobacco growers are called black stalk crazy, black root, aconite disease and the like. Tobacco blight occurs in different degrees in each main tobacco producing area in China, wherein Anhui, shandong and Henan provinces are historically serious disease areas; tobacco blight in southern tobacco regions such as Yunnan, guizhou, sichuan, hunan, guangdong, guangxi, fujian and the like is also common. At present, the prevention and control of the black shank are mainly realized by methods such as crop rotation cultivation, variety gene improvement, biological pesticide and the like; where control with biopesticides is the most common and most easily achieved method. Therefore, the search for more efficient biopesticide lead compounds has important significance for preventing and treating the tobacco black shank.
The microbial pesticide is a new industry of pesticide industry in the 21 st century, represents the direction of plant protection, has the greatest advantages of overcoming the pollution of chemical pesticides to ecological environment and reducing pesticide residues in agricultural and sideline products, greatly increases the quality and price of the agricultural and sideline products in the process of demonstrating and popularizing the application of the microbial pesticide, and favorably promotes the economic growth in rural areas and the income increase of farmers, and has immeasurable social benefit. In addition, the secondary metabolites produced by microorganisms are chemically diverse and biologically active, covering a range of organic compounds from simple acridans (molecular weight 72) to the very complex colubricidin (molecular weight 2154). These structurally diverse secondary metabolites are important sources of pharmaceuticals and biopesticides.
The tobacco is rich in symbiotic microorganisms, and the microorganisms play an important role in key links such as tobacco planting, tobacco processing and the like. Such as: in the tobacco planting process, microorganisms play a very important role in the aspects of soil component improvement, decomposition of harmful components in soil, disease resistance of tobacco plants and the like; in the tobacco leaf processing process, the function of the tobacco source microorganism determines that the tobacco source microorganism can change the chemical composition of tobacco to a certain extent, and further change the smoking quality of the tobacco. In addition, the compounds separated and identified from the tobacco endogenous fungi have different pharmacological effects, such as antibiosis, antioxidation, antitumor, tobacco mosaic virus resistance and the like. Therefore, the research of strengthening the tobacco endophytic fungi metabolite has important scientific significance for finding new skeleton type metabolites with remarkable activity. The invention aims to provide a novel indole alkaloid compound separated from a tobacco endogenous Aspergillus versicolor (Aspergillus versicolor) fungus fermentation product, and the compound has obvious activity of resisting tobacco black shank and is expected to provide more efficient candidate compounds for a tobacco black shank resisting biological pesticide.
Disclosure of Invention
The invention separates and identifies the culture solution of the aspergillus versicolor strain from tobacco to obtain a novel indole alkaloid compound with activity of resisting tobacco black shank, and the compound has not been reported yet.
All percentages used in the present invention are mass percentages unless otherwise indicated.
In a first aspect, the present invention provides an indole alkaloid compound, wherein the compound has a molecular formula:
C 17 H 16 N 2 O 3 which has the following structure:
this compound was a brown gum, designated: aspergillus versicolor alkaloid-H, english name: aspergilline-H.
The second aspect of the present invention provides a method for preparing an indole alkaloid compound according to the first aspect, specifically comprising the following steps:
A. and (3) strain separation and identification:
isolation of Aspergillus versicolor (Aspergillus versicolor): putting tobacco roots and stems sterilized by 75% ethanol into a sterile mortar for grinding, transferring the ground tobacco roots and stems into a sterile plastic tube, centrifuging the tube for 2 to 10min at 1000 to 3000rpm, sucking 1 to 100 microliters of supernatant, coating the supernatant on a BL (BL) plate, inversely placing the plate in an incubator, performing dark culture at 25 to 30 ℃ for 2 to 10 days, repeatedly selecting a single colony for purification culture until a single endophytic fungus colony is obtained, numbering and preserving strains, determining the single colony as Aspergillus versicolor (Aspergillus versicolor) through an ITS sequencing (Genbank Accession number MT549144, GCGGGCTGCCTCCGGGCGCCCAACCTCCCACCCGTGAATACCTAACA CTGTTGCTTCGGCGGGGAACCCCCTCGGGGGCGAGCCGCCGGGGACT ACTGAACTTCATGCCTGAGAGTGATGCAGTCTGAGTCTGAATATAAAA TCAGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAA GAACGCAGCGAACTGCGATAAGTAATGTGAATTGCAGAATTCAGTGA ATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGG CATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCCCGGCTTGTGTGTT GGGTCGTCGTCCCCCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCA CCGTGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGACTAG GGCCGGCCGGGCGCCAGCCGACGTCTCCAACCATTTTTCTTCAGGTTG ACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA GCGGAGGAA), and taking a single colony and a microscopic form picture as shown in the attached figure 1;
B. aspergillus versicolor strain culture
And C, inoculating the aspergillus versicolor strain separated in the step A on a potato glucose agar culture medium at room temperature, culturing for 7-10 days at 25-30 ℃, then inoculating into 50-500 mL triangular bottles, wherein each triangular bottle contains 10-100 mL of potato glucose culture medium, and placing at 25-30 ℃ for shake culture for 5-10 days to obtain a liquid fermentation strain. The aspergillus versicolor strain YATS1111 is preserved in China general microbiological culture collection center on 6-8.2020, with the preservation number of CGMCC No.19910; and (4) storage address: xilu No.1 Hospital No. 3, beijing, chaoyang, north.
C. Amplifying fermentation of strain
And C, performing large-scale fermentation on the liquid fermentation seeds obtained by the culture in the step B, wherein the large-scale fermentation is performed in 100-1000 Von Basher bottles of 100-500 mL, and each bottle contains 400-600 g of rice and 60-400 mL of nutrient solution. The nutrient solution comprises the following components: 5% of glucose, 0.15% of peptone, 0.1% of calcium nitrate tetrahydrate, 0.6% of potassium nitrate, 0.2% of ammonium dihydrogen phosphate, 0.4% of magnesium sulfate heptahydrate, 1% of compound amino acid and the balance of water, wherein the pH value of the nutrient solution is 6.8; and (3) inoculating 1.0-5.0 mL of liquid fermentation seeds obtained by the culture in the step (B) into each bottle after autoclaving, and culturing for 15-45 days at 25-30 ℃ to obtain the aspergillus versicolor fermentation product.
D. Extracting the extractum:
c, ultrasonically extracting the aspergillus versicolor fermented product obtained by fermentation in the step C for 2-5 times by using 90-99 wt% ethanol, extracting for 30-50 min each time, combining the extracting solutions, filtering and concentrating to a small volume, then adding a mixed solution of ethyl acetate and 3wt% tartaric acid solution (the volume ratio of the ethyl acetate to the tartaric acid solution = 1:1-1:2) into the concentrated solution, fully stirring uniformly, standing for layering, separating out a water phase, and using Na for the water phase 2 CO 3 Adjusting pH to 9.0, extracting with ethyl acetate, concentrating under reduced pressure to obtain extract, and separating by column chromatography.
E. Silica gel column chromatography:
d, filling the extract obtained in the step D into a column by using a 200-300-mesh silica gel dry method, and performing silica gel column chromatography; performing gradient elution by chloroform-methanol solutions with the volume ratio of 10, 9:1,8:2,7:3,6:4 and 5:5 respectively, combining parts with the same polarity, collecting eluates of each part, and concentrating; wherein the mass ratio of the silica gel to the extract is 2-5; collecting eluent obtained when the eluent is eluted by a chloroform-methanol solution with the volume ratio of 9:1, and the eluent is called as first eluent; concentrating the first eluent, separating with silica gel chromatographic column, gradient eluting with a series of chloroform-acetone solutions of 9:1,8:2,7:3,6:4 and 5:5 in sequence, and collecting the eluent obtained by eluting with chloroform-acetone solution of 8:2, which is called as the second eluent.
F. High performance liquid chromatography separation
And E, concentrating the second eluent finally obtained in the step E, replacing the solvent with methanol, introducing into a high performance liquid chromatography for separation and purification, wherein the high performance liquid chromatography is to adopt a Zorbax PhepHT GF chromatographic column with the size of 21.2mm multiplied by 250mm and 5 mu m, the flow rate is 20mL/min, the mobile phase is 55wt% of methanol aqueous solution, the detection wavelength of an ultraviolet detector is 402nm, 200 mu L of sample injection is carried out each time, the corresponding eluent when the chromatographic peak retention time is 26.4min after sample injection each time is collected and is called as a third eluent, and the solvent of the third eluent is removed to obtain the indole alkaloid compound crude product.
G. Purifying by gel column chromatography
And D, dissolving the indole alkaloid compound crude product obtained in the step F by using pure methanol again, and performing sephadex column chromatography separation by using methanol as a mobile phase to obtain the indole alkaloid compound pure product.
Preferably, in the step D, the concentration of the ethanol is preferably 95wt%.
Preferably, in the step E, before the extract is roughly separated by silica gel column chromatography, the extract is dissolved by methanol and then mixed with 80-120 mesh silica gel with the weight ratio of 1.5-2.5 times.
Preferably, in step F, after separation and purification by high performance liquid chromatography, the obtained compound is dissolved again in pure methanol, and then the obtained compound is separated and purified by gel column chromatography using pure methanol as a mobile phase.
H. Structural identification of compounds
The structure of the indole alkaloid compound prepared by the method is identified by the following method:
the appearance observation shows that: the compounds of the present invention are brown gums; the ultraviolet-visible absorption spectrum shows that the compound has maximum absorption at 215 nm, 262 nm, 356 nm and 402nm, and the existence of an aromatic ring structure in the compound is proved; infrared spectrum (potassium bromide tablet) shows that the compound has hydroxyl (3408 cm) -1 ) Amino group (3231 cm) -1 ) Carbonyl group (1698 cm) -1 ) Aromatic ring (1635, 1482, 1380 cm) -1 ) A characteristic functional group; the high resolution mass spectrum (HRESIMS) gives the peak of excimer ion 319.1063[ m ] +Na] + Determining the formula of the compound as C 17 H 16 N 2 O 3 。
Bonding of 1 H and 13 NMR data on C and HSQC show that the compound includes a 4,8 substituted benzo [ cd]Indole-2 (1H) -ketone structural fragment (C-2-C-4, C-8-C-15, H-9, H-11-H-13 and NH), one-C (CH) 3 ) 2 -N-CO-(C-5,C-7,C-16,C-17,H 3 -16, and H 3 -17), an N-hydroxyethyl structural fragment (C-18, C-19 2 -18、H 2 -19). To satisfy the unsaturation degree of 11, -C (CH) 3 ) 2 the-N-CO-structural fragment should also react with benzo [ cd ]]Indol-2 (1H) -one linkages to form dimethyl-1,5-dihydro-2H-pyrrol-2-one (C-4,C-5,C-7,C-8,C-16, C-17 3 -16 and H 3 -17) a ring. The inference can be further drawn from H-9 and C-4,C-7,C-8,H 3 -16 and H 3 Correlation of-17 with HMBC at C-8 was confirmed. From this it can be concluded that the compound is of the indole alkaloid CPA (cyclopiamide) type.
TABLE 1 preparation of the compounds 1 HNMR and 13 CNMR data (CDCl) 3 )
In addition to the N-hydroxyethyl moiety, the other carbon and hydrogen signals in the compounds of the invention are similar to the typical known CPA (cyclopiamide) type of indole alkaloids (see Phytochemistry,1990, 29, 639), which further confirms that the compounds are CPA type alkaloids containing an N-hydroxyethyl moiety. Furthermore, the compounds can be of the CPA typeThrough H-9 and C-4/C-7/C-11/C-15, H-11 and C-15, H-12 and C-10/C-14, H-13 and C-11/C-15, H 3 -16/H 3 Correlation of-17 with HMBC at C-7/C-8 was confirmed.
After the parent framework of the compound is determined, the remaining substituent positions can be determined by further analysis of its HMBC association. According to H 2 HMBC at-18 and C-5/C-7, it was confirmed that the N-hydroxyethyl structural fragment is at the N-6 position and C-18 and N-6 are linked, and thus the structure of the compound was confirmed. The compound is named as aspergillus versicolor alkaloid-H, and the English name is aspergilline-H.
Spectral data of compounds: UV (methanol), lambda max (log ε) 215 (4.18), 262 (3.82), 356 (3.36), 402 (3.08) nm; IR (Potassium bromide pressed tablet) v max 3408、3231、2958、2926、2858、1698、1635、 1482、1380、1157、1064、1026、792cm -1 ； 1 H and 13 C NMR data (CDCl) 3 500 and 125 MHz), table 1; ESIMS (Positive ion mode) m/z 319[ m ] +Na ]] + (ii) a HRESIMS (Positive ion mode) m/z 319.1063[ 2 ] M + Na] + (calculated 319.1059, C 17 H 16 N 2 NaO 3 )。
I. Test for inhibiting activity of phytophthora nicotianae (phytophthora parasitica var nigricans)
Adding 1000mL of water into oatmeal, heating the oatmeal in a boiling water bath for 1 hour, filtering the oatmeal by using gauze, adding water to complement 1000mL, then adding sugar and agar, heating the oatmeal to completely melt the agar, filtering the oatmeal in a triangular flask by using the gauze (adding absorbent cotton in the middle) while the oatmeal is hot, sterilizing the oatmeal for 20 minutes at 121 ℃, taking out the oatmeal to cool the oatmeal to about 45 ℃, adding ampicillin (5 mg/100 mL) on a sterile operating platform, uniformly mixing the ampicillin and the ampicillin, pouring the ampicillin into the flat dish, culturing the ampicillin in the flat dish for 48 hours at 28 ℃, and checking the ampicillin for later use after sterility is checked.
Circular filter paper with the diameter of 5mm is taken and placed in a culture dish, the culture dish is placed at the temperature of 121 ℃ for autoclaving for 30min, the circular filter paper is respectively immersed in 20 mu M of the compound prepared in the example 1, 75% ethanol water solution and sterilized distilled water after being dried, and 0.2mL of fresh bacterial liquid of phytophthora nicotianae is respectively absorbed on oatmeal agar medium plates by using a sterile suction pipe on a sterile operation table. Coating with triangular glass coating rod, lightly sticking the filter paper sheets onto corresponding flat plates with tweezers, culturing at 28 deg.C, observing experimental results, and measuring the size of antibacterial zone. Meanwhile, agricultural chloramphenicol was used as a positive control.
The test result shows that: the diameter of the bacteriostatic circle of the obtained indole alkaloid compound is 15.2 +/-1.4 mm, and the diameter of the bacteriostatic circle of the positive control agricultural chloramphenicol is 12.8 +/-1.0 mm. The compound has the effect of inhibiting phytophthora nicotianae remarkably superior to that of positive control agricultural chloramphenicol, and has outstanding activity of inhibiting black shank. J. Detection of effect of preventing and treating tobacco black shank
Transplanting tobacco seedlings into flowerpots with the diameter of 10cm and the height of 10cm, wherein the culture medium is as follows: sterilized soil, peat and perlite culture (2. After transplanting and seedling slowing, 10g of bacterial grains are added into roots, tobacco seedlings are placed in a phytotron for cultivation, the temperature is 30 ℃ in the daytime and 28 ℃ in the dark at night, and the illumination is as follows: dark (12h), relative humidity 95%, causes tobacco seedlings to develop. Before the onset of the blackleg, tobacco seedlings were treated by root irrigation with 20 μ M of the compound of the present invention, 10mL of each plant was irrigated for 2 times. Each of 10 treated plants was repeated 3 times for 14 days, and then the disease incidence was investigated to calculate the disease index.
As a result: the indole alkaloid compound has the effect of controlling the tobacco black shank of (73.1 +/-3.4)%, and has obvious effect of controlling the tobacco black shank.
The invention has the following beneficial effects:
1. the compound is obtained by separating from a fermentation product of a tobacco endophytic aspergillus versicolor strain, and the compound is easy to obtain raw materials because the endophytic fungi are easy to realize batch fermentation production; the extraction method of the compound is simple, the compound is easy to separate and obtain, and the industrial preparation is easy to realize.
2. The indole alkaloid compound obtained by the invention has good activity of resisting black shank, can be used as a lead compound for resisting tobacco black shank for researching and developing biological pesticides for resisting tobacco black shank and preventing tobacco mosaic virus, and has good application prospect in preparing medicaments for resisting tobacco mosaic virus. The invention provides a new research direction for the development of natural products of plant sources with the plant disease control efficacy.
3. The indole alkaloid compound has a simple molecular structure, is easy to realize artificial synthesis, and can be realized through artificial synthesis in subsequent industrialization.
4. The preparation method adopts a preparation method combining conventional column chromatography and high performance liquid chromatography, the preparation operation process of the compound is simple, the purity of the obtained compound is high, and the quality and purity of the compound in subsequent industrial production can be guaranteed.
Drawings
FIG. 1 is a schematic drawing of Aspergillus versicolor; a is colony morphology; b is microscopic morphology.
FIG. 2 is a nuclear magnetic resonance carbon spectrum of the indole alkaloid compounds.
FIG. 3 is a nuclear magnetic resonance hydrogen spectrum of the indole alkaloid compounds.
FIG. 4 shows the major HMBC and of the indole alkaloid compounds 1 H- 1 HCOSY is related.
Detailed Description
The present invention is further illustrated by the following examples, but is not limited to these examples. The experimental methods in which specific conditions are not specified in examples are generally commercially available under the conventional conditions and the conditions described in the manual, or under the general-purpose equipment, materials, reagents and the like used under the conditions recommended by the manufacturer, unless otherwise specified. The starting materials required in the following examples are all commercially available.
The raw materials used in the invention are not affected by the type of the culture medium, and the invention is further explained by the culture medium of the aspergillus versicolor strain separated and identified from the tobacco from Yunnan as follows:
example 1
And (3) performing large-scale fermentation on the liquid fermentation seeds obtained by culture in 500 Von Basher bottles with 500mL, wherein each bottle contains 180g of rice and 180mL of nutrient solution, inoculating 2.5mL of liquid fermentation seeds obtained by culture in each bottle, and culturing at 25-30 ℃ for 30 days to obtain the aspergillus versicolor fermented product. Ultrasonically extracting the fermentation product with 95% ethanol for 3 times, each time for 30min; mixing the extractive solutions, adding into mixture of ethyl acetate and 3wt% tartaric acid solution (ethyl acetate: tartaric acid solution)=1:1-1:2, volume ratio), stirring thoroughly, standing the mixed solution for demixing, separating out water phase, and adding Na into the water phase 2 CO 3 Adjusting the pH value of the water layer to 9.0 by using the solution, and extracting the solution again by using ethyl acetate; separating ethyl acetate phase, and concentrating under reduced pressure to obtain extract 605g. Mixing the extract with 1.0kg of 80-120 mesh silica gel, performing silica gel column chromatography by using a 200-mesh silica gel packing column of 3.0kg, performing gradient elution by using chloroform-methanol of which the volume ratio is 20; and dissolving the obtained crude product by using pure methanol again, taking the pure methanol as a mobile phase, and separating by using Sephadex LH-20 gel column chromatography to obtain a pure product of the novel compound.
Example 2
And (3) performing large-scale fermentation on the liquid fermentation seeds obtained by culture in 250 von Bashel bottles of 1.0L, wherein each bottle contains 360g of rice and 360mL of nutrient solution, inoculating 5.0mL to each bottle to obtain the liquid fermentation seeds obtained by culture, and culturing at 25-30 ℃ for 30 days to obtain the aspergillus versicolor fermentation product. Ultrasonically extracting the fermentation product with 95% ethanol for 3 times, each time for 30min; mixing extractive solutions, adding into mixture of ethyl acetate and 3wt% tartaric acid solution (ethyl acetate: tartaric acid solution =1:1-1:2, volume ratio), stirring, standing for layering, separating to obtain water phase, and adding Na 2 CO 3 The solution adjusted the pH of the aqueous layer to 9.0 and re-extracted with ethyl acetate; separating out ethyl acetate phase, and concentrating under reduced pressure to obtain extract 632g. The extract is mixed with 1.0kg 200 mesh silica gel, and loaded on column with 3.2kg 200 mesh silica gelColumn chromatography, eluting with chloroform-methanol gradient with volume ratio of 20, 1, 8; dissolving the obtained crude product with pure methanol again, taking the pure methanol as a mobile phase, and carrying out Sephadex LH-20 gel column chromatography separation to obtain the pure product of the new compound.
Example 3
The structure of the indole alkaloid compound prepared in example 1 was identified by the following method:
the appearance observation shows that: the compounds of the invention are red brown gels; the ultraviolet-visible absorption spectrum shows that the compound has maximum absorption at 215 nm, 262 nm, 356 nm and 402nm, and the existence of an aromatic ring structure in the compound is proved; infrared spectrum (potassium bromide tablet) shows that the compound has hydroxyl (3408 cm) -1 ) Amino group (3231 cm) -1 ) Carbonyl group (1698 cm) -1 ) Aromatic ring (1635, 1482, 1380 cm) -1 ) A characteristic functional group; high resolution mass spectrum (HRESIMS) gives excimer peak 319.1063[ 2 ], [ M + ] Na] + Determining the formula of the compound as C 17 H 16 N 2 O 3 。
Bonding of 1 H and 13 NMR data on C and HSQC show that the compound includes a 4,8 substituted benzo [ cd]Indole-2 (1H) -ketone structural fragment (C-2-C-4, C-8-C-15, H-9, H-11-H-13 and NH), one-C (CH) 3 ) 2 -N-CO-(C-5,C-7,C-16,C-17,H 3 -16, and H 3 -17) an N-hydroxyethyl structural fragment (C-18, C-19 2 -18、H 2 -19). To satisfy the unsaturation degree of the compound 11, -C(CH 3 ) 2 the-N-CO-structural fragment should also react with benzo [ cd ]]Indol-2 (1H) -one linkages to form dimethyl-1,5-dihydro-2H-pyrrol-2-one (C-4,C-5,C-7,C-8,C-16, C-17, H 3 -16 and H 3 -17) a ring. The inference can be further drawn from H-9 and C-4,C-7,C-8,H 3 -16 and H 3 Correlation of-17 with HMBC at C-8 was confirmed. From this it can be concluded that the compound is a CPA type indole alkaloid.
In addition to the N-hydroxyethyl moiety, the other carbon and hydrogen signals in the compounds of the invention are similar to the typical known CPA (cyclopiamide) type of indole alkaloids (see Phytochemistry,1990, 29, 639), which further confirms that the compounds are CPA type alkaloids containing an N-hydroxyethyl moiety. In addition, the compound is CPA type, and can be further processed by H-9 and C-4/C-7/C-11/C-15, H-11 and C-15, H-12 and C-10/C-14, H-13 and C-11/C-15, H-13 3 -16/H 3 Correlation of-17 with HMBC at C-7/C-8 was confirmed.
After the parent framework of the compound is determined, the remaining substituent positions can be determined by further analysis of their HMBC associations. According to H 2 HMBC correlation of-18 and C-5/C-7 confirmed that the N-hydroxyethyl fragment patch was substituted at the N-6 position and the C-18 and N-6 orientation were ligated, at which point the structure of the compound was confirmed. The compound is named as aspergillus versicolor alkaloid-H, and the English name is aspergilline-H.
Example 4
The compound prepared in example 2 was taken as a red brown gum. The procedure of the measurement was the same as in example 3, and it was confirmed that the compound prepared in example 2 was an indole alkaloid compound, aspergillus versicolor alkaloid-H.
Example 5
Any indole alkaloid compound prepared in examples 1-2 is subjected to an activity test against phytophthora nicotianae (phytophthora parasitica), and the test conditions are as follows:
adding 1000mL of water into oatmeal, heating the oatmeal in a boiling water bath for 1 hour, filtering the oatmeal by using gauze, adding 1000mL into the oatmeal, adding sugar and agar, heating the oatmeal to completely melt the agar, filtering the oatmeal in a triangular flask by using the gauze (absorbent cotton is added in the middle of the oatmeal) while the oatmeal is hot, sterilizing the oatmeal for 20 minutes at the temperature of 121 ℃ and 15 pounds, taking out the oatmeal to cool the oatmeal to about 45 ℃, adding ampicillin (5 mg/100 mL) into a sterile operating platform, uniformly mixing the ampicillin and the ampicillin, pouring the ampicillin into the flat dish, culturing the ampicillin in the flat dish for 48 hours at the temperature of 28 ℃, and checking the ampicillin for later use after sterility is checked.
A circular filter paper having a diameter of 5mm was placed in a petri dish, autoclaved at 15 pounds for 30min, and then dried and immersed in 20. Mu.M of the compound prepared in example 1, a 75% ethanol aqueous solution and sterilized distilled water, respectively. Respectively sucking 0.2mL of fresh bacterial liquid of phytophthora nicotianae on oatmeal agar medium plates by using a sterile suction pipe on a sterile operating table. Coating evenly with a triangular glass coating rod, lightly sticking filter paper pieces on corresponding flat plates respectively by using tweezers, culturing at 28 ℃, observing experimental results, and determining the size of an inhibition zone. Meanwhile, agricultural chloramphenicol was used as a positive control.
The test result shows that: the diameter of the inhibition zone of the indole alkaloid compound is 15.2 +/-1.4 mm, and the diameter of the inhibition zone of the positive control agricultural chloramphenicol is 12.8 +/-1.0 mm. The compound has the effect of inhibiting phytophthora nicotianae remarkably superior to that of positive control agricultural chloramphenicol, and has outstanding activity of inhibiting black shank.
Example 6
Any of the indole alkaloid compounds prepared in examples 1-2 was tested for anti-blackleg disease as follows:
transplanting tobacco seedlings into flowerpots with the diameter of 10cm and the height of 10cm, wherein the culture medium is as follows: sterilized soil, peat and perlite culture (2. After transplanting and seedling slowing, 10g of bacterial grains are added into roots, tobacco seedlings are placed in a phytotron for cultivation, the temperature is 30 ℃ in the daytime and 28 ℃ in the dark at night, and the illumination is as follows: dark (12h. Before the onset of the blackleg, tobacco seedlings were treated by root irrigation with 20 μ M of the compound of the present invention, 10mL of each plant was irrigated for 2 times. Each treatment of 10 plants was repeated 3 times for 14 days, and then the disease index was calculated by examining the disease.
As a result: the compound has the control effect on the tobacco black shank of (73.1 +/-3.4)%, and has an obvious control effect on the tobacco black shank.
The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.
Claims (5)
1. An indole alkaloid compound, characterized in that it has the following structure:
the molecular formula of the indole alkaloid compound is as follows: c 17 H 16 N 2 O 3 The compound is named as aspergillus versicolor alkaloid-H.
2. The process for preparing indole alkaloids compound according to claim 1, comprising the following steps:
(1) Extracting the extractum: carrying out solid fermentation on aspergillus versicolor YATS1111 separated from tobacco, carrying out ultrasonic extraction on a fermentation product of the aspergillus versicolor YATS1111 by using 90-99 wt% of ethanol, filtering and concentrating, adding mixed solution of ethyl acetate and 3wt% of tartaric acid solution in a volume ratio of 1:1-1:2, uniformly mixing, standing and layering, and separating a water phase; reuse of the aqueous phase with Na 2 CO 3 Adjusting pH to 9.0, extracting with ethyl acetate, and concentrating ethyl acetate phase under reduced pressure to obtain extract; the aspergillus versicolor strain YATS1111 is preserved in the common microorganism center of China Committee for culture Collection of microorganisms with the preservation number of CGMCC No.19910;
(2) Silica gel column chromatography: filling the extract obtained in the step (1) into a column by using a 200-300-mesh silica gel dry method; the mass ratio of the silica gel to the extract is 2-5; performing gradient elution by chloroform-methanol solutions with the volume ratio of 10, 9:1,8:2,7:3,6:4 and 5:5 respectively, combining parts with the same polarity, collecting eluates of each part, and concentrating; collecting an eluent obtained by eluting with a chloroform-methanol solution with the volume ratio of 9:1, and referring to the eluent as a first eluent; concentrating the eluent, continuously separating by using a silica gel chromatographic column again, performing gradient elution by using chloroform-acetone solutions of 9:1,8:2,7:3,6:4 and 5:5 in sequence according to volume ratio, and collecting eluent obtained when the eluent is eluted by using a chloroform-acetone solution of 8:2, wherein the eluent is called as second eluent;
(3) High performance liquid chromatography separation: concentrating the second eluent obtained in the step (2), replacing the solvent with methanol, introducing into a high performance liquid chromatography for separation and purification, wherein the high performance liquid chromatography is to adopt a ZorbaxPrepHT GF chromatographic column with the volume of 21.2mm multiplied by 250mm and the diameter of 5 mu m, the flow rate is 20mL/min, the mobile phase is 55wt% methanol water solution, and the detection wavelength of an ultraviolet detector is 402nm; injecting 200 mu L of sample each time, collecting corresponding eluent when the retention time of chromatographic peak is 26.4min after each sample injection, and obtaining the crude product of the indole alkaloid compound after removing solvent from the third eluent;
(4) Dissolving the crude alkaloid compound in the step (3) with pure methanol again, and performing sephadex column chromatography separation by using methanol as a mobile phase to obtain a pure alkaloid compound;
the solid fermentation of the aspergillus versicolor YATS1111 in the step (1) comprises the following steps: inoculating the separated aspergillus versicolor strain on a potato glucose agar culture medium at room temperature, culturing for 7-10 days at 25-30 ℃, then inoculating in a 50-500 mL triangular flask, and placing at 25-30 ℃ for shake culture for 5-10 days to obtain a liquid fermentation strain; each triangular flask contains 10-100 mL of potato glucose culture medium;
carrying out large-scale fermentation on the liquid fermentation seeds in 100-1000 von Baker bottles of 100-500 mL, wherein each bottle contains 400-600 g of rice and 60-400 mL of nutrient solution; the nutrient solution comprises the following components: 5% of glucose, 0.15% of peptone, 0.1% of calcium nitrate tetrahydrate, 0.6% of potassium nitrate, 0.2% of ammonium dihydrogen phosphate, 0.4% of magnesium sulfate heptahydrate, 1% of compound amino acid and the balance of water; the pH value of the nutrient solution is 6.8.
3. The method according to claim 2, wherein the concentration of ethanol in the step (1) is 95wt%.
4. The preparation method according to claim 2, wherein in the step (2), the extract is dissolved in methanol and mixed with 80-120 mesh silica gel in a weight ratio of 1.5-2.5 times before coarse separation by silica gel column chromatography.
5. The application of the indole alkaloid compounds according to claim 1 in preparing a biological pesticide preparation for resisting tobacco black shank.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210098568.6A CN114409661B (en) | 2022-01-27 | 2022-01-27 | Indole alkaloid compound and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210098568.6A CN114409661B (en) | 2022-01-27 | 2022-01-27 | Indole alkaloid compound and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114409661A CN114409661A (en) | 2022-04-29 |
| CN114409661B true CN114409661B (en) | 2023-02-28 |
Family
ID=81278385
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210098568.6A Active CN114409661B (en) | 2022-01-27 | 2022-01-27 | Indole alkaloid compound and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114409661B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115286561B (en) * | 2022-08-01 | 2023-06-16 | 云南中烟工业有限责任公司 | Indole alkaloid compound in gene editing tobacco, and preparation method and application thereof |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104370917A (en) * | 2014-05-14 | 2015-02-25 | 福州大学 | Indole terpene speradine H derived from aspergillus oryzae and application |
| CN104387396A (en) * | 2014-05-14 | 2015-03-04 | 福州大学 | Indole terpene speradine E derived from aspergillus oryzae and application |
| CN107496420A (en) * | 2017-08-25 | 2017-12-22 | 中国科学院微生物研究所 | The purposes of cyclopiazonic acid Alkaloid compound |
| CN110452170A (en) * | 2019-08-29 | 2019-11-15 | 云南中烟工业有限责任公司 | A kind of isoquinoline alkaloids bases compound and its preparation method and application |
| CN110483396A (en) * | 2019-08-29 | 2019-11-22 | 云南中烟工业有限责任公司 | A kind of isopentene group isoquinoline alkaloids bases compound and its preparation method and application |
| CN110483535A (en) * | 2019-08-29 | 2019-11-22 | 云南中烟工业有限责任公司 | A kind of isoquinolin tricyclic alkaloid compound and its preparation method and application |
| CN111072616A (en) * | 2019-12-11 | 2020-04-28 | 云南中烟工业有限责任公司 | Compound for resisting tobacco black shank and preparation method and application thereof |
| CN113200989A (en) * | 2021-05-18 | 2021-08-03 | 云南民族大学 | Preparation method and application of chromone alkaloid compound |
| CN113214152A (en) * | 2021-05-18 | 2021-08-06 | 云南民族大学 | Active compound for resisting tobacco black shank in thalictrum delavayi Franch, preparation method and application thereof |
| CN114751911A (en) * | 2022-05-10 | 2022-07-15 | 云南中烟工业有限责任公司 | Indole alkaloid compound, and preparation method and application thereof |
-
2022
- 2022-01-27 CN CN202210098568.6A patent/CN114409661B/en active Active
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104370917A (en) * | 2014-05-14 | 2015-02-25 | 福州大学 | Indole terpene speradine H derived from aspergillus oryzae and application |
| CN104387396A (en) * | 2014-05-14 | 2015-03-04 | 福州大学 | Indole terpene speradine E derived from aspergillus oryzae and application |
| CN107496420A (en) * | 2017-08-25 | 2017-12-22 | 中国科学院微生物研究所 | The purposes of cyclopiazonic acid Alkaloid compound |
| CN110452170A (en) * | 2019-08-29 | 2019-11-15 | 云南中烟工业有限责任公司 | A kind of isoquinoline alkaloids bases compound and its preparation method and application |
| CN110483396A (en) * | 2019-08-29 | 2019-11-22 | 云南中烟工业有限责任公司 | A kind of isopentene group isoquinoline alkaloids bases compound and its preparation method and application |
| CN110483535A (en) * | 2019-08-29 | 2019-11-22 | 云南中烟工业有限责任公司 | A kind of isoquinolin tricyclic alkaloid compound and its preparation method and application |
| CN111072616A (en) * | 2019-12-11 | 2020-04-28 | 云南中烟工业有限责任公司 | Compound for resisting tobacco black shank and preparation method and application thereof |
| CN113200989A (en) * | 2021-05-18 | 2021-08-03 | 云南民族大学 | Preparation method and application of chromone alkaloid compound |
| CN113214152A (en) * | 2021-05-18 | 2021-08-06 | 云南民族大学 | Active compound for resisting tobacco black shank in thalictrum delavayi Franch, preparation method and application thereof |
| CN114751911A (en) * | 2022-05-10 | 2022-07-15 | 云南中烟工业有限责任公司 | Indole alkaloid compound, and preparation method and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| Aspergillines A-E, Highly Oxygenated Hexacyclic Indole-Tetrahydrofuran-Tetramic Acid Derivatives from Aspergillus versicolor;Min Zhou et al.;《Org. Lett.》;20141231;第1-4页 * |
| Asperorydines N-P, three new cyclopiazonic acid alkaloids from the marine-derived fungus Aspergillus flavus SCSIO F025;Yao Xiang et al.;《Fitoterapia》;20211231;第1-6页 * |
| Cyclopiazonic acid type indole alkaloids from Nicotiana tabacum-derived fungus Aspergillus versicolor and their anti-tobacco mosaic virus activities;Guang-Yu Yang et al.;《Phytochemistry》;20220228;第1-7页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114409661A (en) | 2022-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109957515B (en) | Phomopsis strain and application thereof in biotransformation of tripterine | |
| CN114409660B (en) | CPA type indole alkaloid compound and preparation method and application thereof | |
| CN114456102A (en) | Indole alkaloid compound and preparation method and application thereof | |
| CN114409661B (en) | Indole alkaloid compound and preparation method and application thereof | |
| CN113200989B (en) | Preparation method and application of chromone alkaloid compound | |
| CN108353906A (en) | The application of indole -3-formaldehyde and its derivative in preventing the plant disease caused by plant pathogenic fungi | |
| CN113214152B (en) | Active compound for resisting tobacco black shank in thalictrum delavayi Franch, preparation method and application thereof | |
| CN110590723B (en) | Sterol compound in tobacco as well as preparation method and application thereof | |
| CN110257260B (en) | Atractylodes macrocephala endophytic fungus and application thereof | |
| CN112226470A (en) | Active substance for preventing and treating orobanche coerulescens, and extraction method and application thereof | |
| CN101293886B (en) | Preparing method and application of white banksia rose endogenetic epiphyte product of snail optical black shell bacterium ketone A | |
| CN113277999B (en) | Phthalide compound and preparation method and application thereof | |
| CN114149445B (en) | Preparation method of xanthone compound and application of xanthone compound in resisting drug-resistant bacteria | |
| CN110343618B (en) | Helminthosporol type sesquiterpenoids, and preparation method and application thereof | |
| CN110272345B (en) | 5-15 ring sesterterpene compounds derived from plant pathogenic fungi and preparation method and application thereof | |
| CN109180593B (en) | Phenolic oxazine alkaloid secondary metabolite and application thereof | |
| CN112961783A (en) | Plant endophytic fungus and application thereof in preparation of spironolactone derivative | |
| CN109503613B (en) | Gryllus chinensis bipolaris staurosporine I and preparation method and application thereof, and Gryllus chinensis bipolaris staurosporine J and preparation method and application thereof | |
| CN108441427B (en) | Arthriospora fungi and pyridone alkaloid compound produced by same | |
| CN115557960B (en) | Isopentenyl indole alkaloid compound and preparation method and application thereof | |
| CN110563740A (en) | Alpha-pyrone compound, preparation method, strain and application | |
| CN109265397B (en) | Rapid separation method and application of secondary metabolites of eucalyptus globulus endophytic fungi | |
| CN114920723B (en) | Chromene compound with antioxidant activity and preparation method and application thereof | |
| CN115583953B (en) | Quinazolinone alkaloid compound, and preparation method and application thereof | |
| CN111320597B (en) | Anti-plant virus pyriminomycin and preparation process and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |