CN114933976B

CN114933976B - Monilinia mountain Monilis and application thereof

Info

Publication number: CN114933976B
Application number: CN202210686818.8A
Authority: CN
Inventors: 陶移文; 余细勇; 黄宇熙; 黄洪波; 丁博; 廖宇婷
Original assignee: Guangzhou Medical University
Current assignee: Guangzhou Medical University
Priority date: 2022-06-17
Filing date: 2022-06-17
Publication date: 2023-09-19
Anticipated expiration: 2042-06-17
Also published as: CN114933976A

Abstract

The invention belongs to the technical field of microorganisms, and discloses a mountain Monilinia and application thereof. The mountain Mongolian bacteria is named mountain Mongolian bacteria (Hypomontagnella monticulosa) YX702, is classified and named Hypomontagnella monticulosa, is preserved in China general microbiological culture Collection center (CGMCC No. 40063) of North Xielu No.1, no.3 in the North Chen West Lu of the Korean area of Beijing in 2022, and the main secondary metabolite of the mountain Mongolian bacteria is Nodulisporcid A, and can be used for preparing the Nodulisporcid A and derivatives thereof.

Description

Monilinia mountain Monilis and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to a mountain Monilinia and application thereof.

Background

Nodulisporcid A (Nodulisporic acid A) is a fungal secondary metabolite, and Kasetttrathat et al isolated from the marine fungus Nodulisporium sp.CRINI, which exhibits some antimalarial activity. Meanwhile, kasetttrathat et al disclose that esters of Nodulisporcid A (methyl Nodulisporcid A and benzyl Nodulisporcid A) have an antitumor effect, and that esters of Nodulisporcid A are synthesized from Nodulisporcid A as a raw material.

Monilinia fructicola (Hypomontagnella monticulosa) belongs to the kingdom fungi, ascomycota, hypomycota, family Hypomycoceae, genus Monilinia. Hypomontaganella was a new fungus isolated from the genus Tuber (Hypoxylon) in 2019. Monilinia fructicola in mountain areas is used as endophytic fungi and is distributed in tropical and subtropical areas. The metabolites of the strain are not researched much, and the metabolites reported in the literature to date are terpenes, furandione compounds and the like. The mountain Monilis capable of producing the metabolite Nodulisporcid A was not found for a while.

Disclosure of Invention

The first aspect of the invention aims to provide a Monilinia fructicola mountain.

The second aspect of the present invention is directed to a microbial agent.

The object of a third aspect of the present invention is to provide the use of the strain of the first aspect and/or the microbial inoculum of the second aspect.

The fourth aspect of the present invention is directed to a method for preparing nodulisporic acid a.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:

in a first aspect of the present invention, a strain of mountain Mongolian bacteria is provided, named mountain Mongolian bacteria (Hypomontagnella monticulosa) YX702, classified and named Hypomontagnella monticulosa, and preserved in China general microbiological culture collection center (CGMCC) of national institute No.3, north Chen West Lu No.1, the region of Korea of Beijing in 2022, 1 month 17, wherein the preservation number is CGMCC No.40063.

The ITS gene sequence of the mountain Mongolian bacteria is shown as SEQ ID NO.3, and the similarity with the gene sequence of the mountain Mongolian bacteria is 99.45%.

The mycelium of the Monilinia fructicola on the mountain land is creeping on the PDA culture medium, the mycelium is white velvet mycelium, the mycelium is unevenly distributed in the culture medium, and the PDA culture medium at the lower layer of the mycelium is yellow after the mycelium is cultured.

In a second aspect of the present invention, there is provided a microbial agent comprising: the Monilinia fructicola mountain of the first aspect of the present invention.

Preferably, the microbial inoculum is a solid microbial inoculum or a liquid microbial inoculum. Specifically, the strain can be obtained by preparing a culture solution or a strain obtained after culturing Monilinia fructicola in mountain regions.

Preferably, a person skilled in the art can add a strain preservative (such as glycerol) or other auxiliary materials into the culture solution or the thallus of the mountain Monilinia according to the need, and the microbial inoculum is prepared by adopting a conventional method.

In a third aspect, the invention provides the use of the Mongolian mountain bike and/or the microbial inoculum of the second aspect of the invention in the preparation of Nodulisporcid A.

Nodulisporcoic acid A has the chemical formula C ₁₆ H ₂₀ O ₆ 。

The chemical structural formula of nodulisporic acid a is as follows:

e configuration:

z configuration:

nodulisporcid A is known to those skilled in the art to have antimalarial efficacy.

Further, there is provided the use of the Monascus alpina of the first aspect and/or the microbial inoculum of the second aspect in the manufacture of an antimalarial medicament.

Preferably, the active ingredient of the antimalarial drug comprises nodulisporic acid a.

Further, there is provided the use of the Monilinia fructicola mountain and/or the microbial inoculum of the second aspect of the invention in a derivative of Nodulisporcid A.

Preferably, the derivatives of nodulisporic acid a include at least one of ester compounds of nodulisporic acid a and amide compounds of Nodulis poracid A.

Preferably, the ester compound of nodulisporic acid a comprises at least one of methyl ester of nodulisporic acid a, ethyl ester of Nodulispor acid A, n-propyl ester of nodulisporic acid a, n-butyl ester of nodulisporic acid a, benzyl ester of nodulisporic acid a, 2-phenethyl ester of nodulisporic acid a, 3-phenylpropyl ester of nodulisporic acid a, p-methoxybenzyl ester of nodulisporic acid a, 3-methoxybenzyl ester of nodulisporic acid a; further preferably, the ester compound of Nodu lisporacid A includes at least one of methyl ester of nodulisporic acid a, ethyl ester of nodulisporic acid a, n-propyl ester of Nodulis poracid A, benzyl ester of nodulisporic acid a, 2-phenethyl ester of nodulisporic acid a, 3-phenylpropyl ester of Nodulisporac id A, p-methoxybenzyl ester of nodulisporic acid a.

In the invention, the chemical formula of the methyl ester of Nodulisporcid A is C ₁₇ H ₂₂ O ₆ The chemical structural formula is as follows:

in the invention, the chemical formula of the ethyl ester of Nodulisporcid A is C ₁₈ H ₂₄ O ₆ The chemical structural formula is as follows:

in the invention, the chemical formula of the n-propyl ester of Nodulisporcid A is C ₁₉ H ₂₆ O ₆ The chemical structural formula is as follows:

in the invention, the chemical formula of the benzyl ester of Nodulisporcid A is C ₂₃ H ₂₆ O ₆ The chemical structural formula is as follows:

in the present invention, nodulisporac2-phenethyl ester of id A has the chemical formula C ₂₄ H ₂₈ O ₆ The chemical structural formula is as follows:

in the invention, the chemical formula of the 3-phenylpropyl ester of Nodulisporcid A is C ₂₅ H ₃₀ O ₆ The chemical structural formula is as follows:

in the invention, the chemical formula of p-methoxybenzyl ester of Nodulisporcid A is C ₂₄ H ₂₈ O ₇ The chemical structural formula is as follows:

it is well known to those skilled in the art that esters of nodulisporic acid a (methyl ester of nodulisporic acid a, ethyl ester of Nodul isporacid A, n-propyl ester of nodulisporic acid a, n-butyl ester of nodulisporic acid a, benzyl ester of Nodulisporaci d A, 2-phenethyl ester of nodulisporic acid a, 3-phenylpropyl ester of nodulisporic acid a, p-methoxybenzyl ester of nodulisporic acid a, 3-methoxybenzyl ester of nodulisporic acid a) have antitumor effect.

Further, there is provided the use of the Monascus alpina of the first aspect and/or the microbial inoculum of the second aspect in the manufacture of an antitumor medicament.

Preferably, the active ingredients of the antitumor drug comprise: ester compounds of nodulisporic acid a; further preferably, the active ingredients of the antitumor drug comprise: at least one of methyl ester of nodulisporic acid a, ethyl ester of nodulisporic acid a, n-propyl ester of nodulisporic acid a, n-butyl ester of nodulisporic acid a, benzyl ester of nodulisporic acid a, 2-phenethyl ester of Nodulis poracid A, 3-phenylpropyl ester of nodulisporic acid a, p-methoxybenzyl ester of nodulisporic acid a, 3-methoxybenzyl ester of N odulisporacid A; still further preferably, the active ingredient of the antitumor drug comprises: at least one of methyl ester of Nodulisporacid A, ethyl ester of Nodulisporacid A, n-propyl ester of Nodulisporacid A, benzyl ester of N odulisporacid A, 2-phenethyl ester of Nodulisporacid A, 3-phenylpropyl ester of Nodulisporacid A, and p-methoxybenzyl ester of Nod ulisporacid A.

Preferably, the tumor comprises at least one of breast cancer, lung cancer, bile duct cancer, oral epidermoid cancer, cervical cancer, liver cancer, leukemia.

In a fourth aspect of the invention, there is provided a method for producing nodulisporic acid a, using the mountain Monilisporic bacteria of the first aspect of the invention and/or the microbial inoculum of the second aspect of the invention to culture, to obtain nodulisporic acid a.

Preferably, the method comprises: inoculating the fungus solution of the Mongolian fungus in the mountain area and/or the fungus agent in the second aspect of the invention into a fermentation culture medium, and culturing for 5-50 days at 25-30 ℃ to obtain the microbial inoculum.

Preferably, the fermentation medium is at least one of GYP liquid medium, rice medium and liquid sand medium; further comprises at least one of GYP liquid culture medium and rice culture medium.

Preferably, the rice culture medium is a modified rice culture medium, the preparation raw materials of which comprise: rice, sea salt, yeast extract, and glucose.

Preferably, after the culturing, the method further comprises the step of extracting.

The beneficial effects of the invention are as follows:

the invention provides a mountain Mongolian bacteria named mountain Mongolian bacteria (Hypomontagnella monticulosa) YX702, which is classified and named Hypomontagnella monticulosa, and is preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.1 and 3 of North western road No.1 in the Korean region of Beijing in 2022 1 month 17, wherein the main secondary metabolite of the mountain Mongolian bacteria is Nodulisporcid A, the yield is high, the Nodulisporcid A and derivatives thereof (such as esters of the Nodulisporcid A) can be prepared, the Nodulisporcid A can be used for resisting malaria, and the esters of the Nodulisporcid A can be used for resisting tumors.

The invention also provides a preparation method of the Nodulisporcid A, which is obtained by culturing the mountain Mongolian bacteria, the method is simple and convenient, the yield of the Nodulisporcid A obtained by the preparation method is high, for example, the quality of the Nodulisporcid A obtained by fermenting 1L of modified rice culture medium can be finally extracted to be more than 4.8g.

Drawings

FIG. 1 is a colony morphology of Monilinia mountain (Hypomontagnella monticulosa) YX 702.

FIG. 2 is an evolutionary tree diagram of Monilinia mountain (Hypomontagnella monticulosa) YX 702.

FIG. 3 is a high performance liquid analysis chart of ethyl acetate extract obtained by culturing Monilinia mountain Monilis (Hypomontagnella monticulosa) YX702 in a modified rice culture medium.

FIG. 4 is a graph showing the absorption wavelength of the peak associated with the high performance liquid phase of ethyl acetate extract obtained by culturing Morganella mountain (Hypomontagnella monticulosa) YX702 in a modified rice culture medium.

FIG. 5 is a high performance liquid analysis chart of the main product Nodulisporcid A of Monilinia mountain (Hypomontagnella monticulosa) YX 702.

FIG. 6 is a high performance liquid absorption wavelength diagram of the main product Nodulisporcid A of Monilinia mountain (Hypomontagnella monticulosa) YX 702.

FIG. 7 is a high performance liquid analysis chart of ethyl acetate extract obtained by culturing Monilinia mountain Monilis (Hypomontagnella monticulosa) YX702 in GYP liquid medium.

FIG. 8 is an absorption wavelength chart of a high performance liquid phase correlation peak of ethyl acetate extract obtained by culturing Monilinia mountain Monilis (Hypomontagnella monticulosa) YX702 in GYP liquid medium.

FIG. 9 is a diagram of the results of high resolution mass spectrometry experiments on the main product Nodulisporcid A of Moniliella mountain (Hypomontagnella monticulosa) YX 702.

FIG. 10 is a graph showing the results of single crystal diffraction experiments of the main product Nodulisporcid A of Monilinia mountain (Hypomontagnella monticulosa) YX 702.

Detailed Description

The present invention will be described in further detail with reference to specific examples.

It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention.

The experimental methods, in which specific conditions are not noted in the following examples, are generally conducted under conventional conditions or under conditions recommended by the manufacturer. Materials, reagents, and the like used in the present example are commercially available ones unless otherwise specified; the various media formulations according to this example can be found in the laboratory manual.

Example 1 isolation and identification of Monilinia mountain Monilis (Hypomontagnella monticulosa) YX702

The method comprises the steps of washing the natural protection area of the Dongzhai harbor in Hainan province with the foleless sea Sang Jingbu of the endophytic mangrove plant, cutting the plant into small pieces in a sterile environment, respectively soaking the plant in 75% alcohol for 1min, soaking the plant in 2% sodium hypochlorite solution for 3min, transferring the plant into 75% alcohol for 30s, rinsing the plant with sterile water for 3 times, placing the plant on a Mongolian red culture medium plate, placing the plant in a constant-temperature incubator, and culturing the plant at 28 ℃ until mycelia grow out of a section of tissue. Hyphae grown on tissue sections were inoculated onto PDA medium plates using a continuous streaking method and cultured at 28℃until single colonies developed. According to the characteristics of colony size, morphology and the like, single colony is selected, bacterial suspension is prepared, and bacterial strains are separated and purified by a dilution and dish pouring method until the appearance of the colony on the plate is consistent.

Morphological identification: the mycelium of the colony is creeping-shaped and white velvet-shaped mycelium, and the mycelium is unevenly distributed in the culture medium, and the PDA culture medium at the lower layer of the mycelium is yellow after culture (figure 1).

Gene identification (identification of the strain by DNA amplification and sequencing of the ITS region of the strain): extracting strain DNA, carrying out PCR amplification by taking ITS as a primer (ITS 1: TCCGTAGGTGAACCTGCGG, SEQ ID.NO.1; ITS4: TCCTCCGCTTATTGATATGC, SEQ ID.NO. 2), and sequencing the amplified product, wherein the sequence is as follows: GGGTTAATGGATATCAAAACTCCCAACCCTTTGTGACTTACCACTGTTGCCTCGGCGAGTTGTGCTACCCTATAGCTACCCTGTAGCTACCCGGGAACACATTCCAAGCTCGCCAGAGGACCTACCAACTCTGTTTTATACTGTATCTCTGAACTTTATAACTAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTATTCGAGCGTCATTTCAACCCTTAAGCCTCAGTTGCTTAGCATTGGGACTCTACGACCTATTATAGCGTAGTTCCTTAAAGTTAGTGGCGGAGTTATAGCACACTCTAAGCGTAGTAATTCTCTCTCGCTTCTTGTAGTGGTTATAGTTGCTAGCCATAAAACACCCCCTATTTTAATGGTTGACCTCGGATTAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA (SEQ ID. NO. 3). By comparing with the gene sequences of the known strains, the similarity of the gene sequences with the gene sequences of Mongolian mountain is found to be 99.45 percent (figure 2), the strain is Mongolian mountain and named Mongolian mountain (Hypomontagnella monticulosa) YX702, the strain is classified and named Hypomontagnella monticulosa, and the strain is preserved in China general microbiological culture collection center (CGMCC) of North Chen Xiylu No.1, no.3 of the Korean region of Beijing in1 month 17 of 2022, and the preservation number is CGMCC No.40063.

Example 2 preparation of Nodulisporcid A by culturing Monilinia mountain Monilinia (Hypomontagnella monticulosa) YX702 with modified Rice Medium

GYP liquid medium preparation: 10.0g glucose, 2.0g peptone, 1.0g yeast extract, 2.0g crude sea salt and 1000mL water are weighed into a bottle, stirred uniformly until the crude sea salt, the yeast extract and the glucose are completely dissolved, sterilized at a high temperature of 121 ℃ for 32min, and naturally cooled to 25 ℃ in a sterile room to prepare a GYP liquid culture medium (seed culture medium).

Preparation of an improved rice culture medium: 98.0g of rice is weighed, 0.4g of crude sea salt, 0.5g of yeast extract, 0.5g of glucose and 200mL of water are added into a bottle, and the mixture is stirred uniformly until the crude sea salt, the yeast extract and the glucose are completely dissolved, and then the mixture is sterilized at a high temperature of 121 ℃ for 32min, and naturally cooled to 25 ℃ in a sterile room, so that the improved rice culture medium (fermentation culture medium) is prepared.

Active bacterial liquid preparation: inoculating Monilinia mountain Monilis (Hypomontagnella monticulosa) YX702 on PDA culture medium plate at 28deg.C for activation, waiting for strain recovery and mycelium production, and culturing at 1cm ² Inoculating mycelium of (E) into 150mL GYP liquid culture medium, and culturing at 28deg.CCulturing for 3 days at a rotation speed of 121r/min to obtain active bacterial liquid.

Preparing a bacterial strain crude extract: 4mL of active bacterial liquid is inoculated into 200mL of modified rice culture medium, and the culture is carried out for 40 days at the temperature of 28 ℃. Soaking the culture medium in methanol, ultrasonic extracting for 30min, and filtering to obtain primary extract methanol solution. After methanol was removed from the primary extract by distillation under reduced pressure, the extract was extracted with ethyl acetate, and ethyl acetate was removed from the primary extract by distillation under reduced pressure, whereby 3.16g of a crude extract of Monilinia fructicola YX702 was obtained.

High performance liquid phase analysis: the crude extract was analyzed by high performance liquid chromatography experiments, the liquid chromatography conditions were as follows: column type and specification: thermo Hypersil gold AQ liquid chromatography column 250X 4.6mm,5 μm; temperature: 35 ℃; mobile phase: phase a is water (0.1% formic acid) and phase B is acetonitrile; the flow rate is 1mL/min; sample injection amount: 20. Mu.L; liquid chromatography gradient and time: 30-80% of B in 0-30 min, 80-100% of B in 30-31 min, 100% of B in 31-35 min, and 100-30% of B in 35-36 min. It was found that a chromatographic peak of the target compound (nodulisporic acid A) appears at a retention time of 10 to 12min (specifically 10.449 min), and the peak maximum absorption wavelengths are in the vicinity of 215nm and 330nm, respectively (FIGS. 3, 4).

Analysis of main product content: through peak area calculation, the peak area occupation ratio of the main product is 44.29% under 254nm wavelength, namely the content of the main product in the crude extract can reach 44.29% in theory.

Preparation of the main product: 600mL of the active bacterial liquid is inoculated into 30L of modified rice culture medium and cultured for 40 days at the temperature of 28 ℃. The fermented modified rice culture medium was then soaked with methanol for 3 days to extract its secondary metabolites. Filtering to obtain a primary extract methanol solution, removing methanol by vacuum distillation to obtain a methanol primary extract, soaking the filtered fermentation medium in methanol for 3 days, filtering to obtain a primary extract methanol solution, removing methanol by vacuum distillation to obtain a methanol primary extract, repeating the above operation for 5 times, collecting the methanol primary extract, extracting the methanol primary extract with ethyl acetate, and removing ethyl acetate by vacuum distillation to obtain 377.00g of crude extract.

The post-treatment of the crude extract comprises column chromatography separation, concentration, drying and washing processes. The column chromatography separation is to sequentially and isocratically elute in normal phase silica gel with 200 to 300 meshes by a petroleum ether-ethyl acetate system at normal temperature and normal pressure; the ratio of the petroleum ether-ethyl acetate system is sequentially 1: 0. 4:1, 2:1, 1:1, 1:2, 1:4; removing the solvent of the eluting system in a ratio of 1:1 to 1:4 by reduced pressure distillation to obtain an off-white solid; washing with ethyl acetate, purifying the off-white solid to obtain a white solid; the washed ethyl acetate solution was distilled off under reduced pressure to obtain an orange-yellow oily liquid; adding dichloromethane into oily liquid until the oily liquid is completely dissolved, then adding petroleum ether into the dichloromethane solution until the solution is turbid, and after the solid in the turbid solution is completely settled, carrying out suction filtration to obtain white solid, washing by using ethyl acetate, and drying; the above-mentioned purification operation was repeated for the remaining ethyl acetate solution, and 155.56g of the obtained white solid powder or colorless transparent crystals were collected.

Identification of the main product: high resolution mass spectrometry (FIG. 9) shows that the positive ion mass to charge ratio of this compound is 309.13284[ M+H ]] ⁺ ([C ₁₆ H ₂₀ O ₆ +H] ⁺ 309.13381), it can be judged that the molecular formula of the compound is C ₁₆ H ₂₀ O ₆ The method comprises the steps of carrying out a first treatment on the surface of the Nuclear magnetic data (Table 1) and X-ray single crystal diffraction results (FIG. 10), the compound was identified as Nodulisporcid A.

TABLE 1 tetronic acid class of Nodulisporcid A compounds ¹ H-NMR ¹³ C-NMR characterization results

According to the YX702 strain, the modified rice culture medium is used for standing and fermenting for 30L at normal temperature for 40 days, 377.00g of crude extract can be obtained by extracting ethyl acetate with methanol, 155.56g of Nodulisporcid A is obtained after simple purification, and the content of Nodulisporcid A in the crude extract is up to 41.26%.

EXAMPLE 3 preparation of Nodulisporcid A by culturing Monilinia mountain (Hypomontagnella monticulosa) YX702 with GYP liquid Medium

GYP liquid medium preparation: weighing 10.0g of glucose, 2.0g of peptone, 1.0g of yeast extract and 2.0g of crude sea salt, and 1000mL of water in a bottle, stirring uniformly until the crude sea salt, the yeast extract and the glucose are completely dissolved, sterilizing at 121 ℃ for 32min, and naturally cooling to 25 ℃ in a sterile room to prepare the GYP liquid culture medium.

Active bacterial liquid preparation: inoculating Monilinia mountain Monilis (Hypomontagnella monticulosa) YX702 on PDA culture medium plate at 28deg.C for activation, waiting for strain recovery and mycelium production, and culturing at 1cm ² Inoculating the mycelium into 150mL GYP liquid culture medium, and culturing at 28deg.C for 3 days at 121r/min with microorganism culture shaker to obtain active bacterial liquid.

Preparing a bacterial strain crude extract: 8mL of active bacterial liquid is inoculated into 600mL of GYP liquid culture medium, a microorganism culture table is used for culturing for 7 days at the rotation speed of 121r/min and the temperature of 28 ℃, and the culture medium is filtered to obtain corresponding hypha and bacterial liquid. Soaking mycelium in methanol for 30min, filtering to obtain methanol solution, and distilling under reduced pressure to remove methanol; extracting the primary methanol extract and the bacterial liquid by using ethyl acetate, and removing the ethyl acetate in the extract by reduced pressure distillation; 220.00mg of a crude extract of Mongolian bacteria YX702 was obtained.

High performance liquid phase analysis: the crude extract was analyzed using a high performance liquid chromatograph under the following conditions: column type and specification: thermo Hypersil gold AQ liquid chromatography column 250X 4.6mm,5 μm; temperature: 35 ℃; mobile phase: phase a is water (0.1% formic acid) and phase B is acetonitrile; the flow rate is 1mL/min; sample injection amount: 20. Mu.L; liquid chromatography gradient and time: 30-80% of B in 0-30 min, 80-100% of B in 30-31 min, 100% of B in 31-35 min, and 100-30% of B in 35-36 min. The analysis by high performance liquid chromatography shows that the target peak appears when the retention time is 10-12 min, the maximum absorption wavelength of the peak is near 215nm and 330nm (figure 7 and figure 8), the peak outlet time is 10.9min, the maximum absorption wavelength is 215nm and 330nm (figure 5 and figure 6), the liquid chromatography conditions are as follows, the column type and specification are Thermo Hypersil gold AQ liquid chromatography column 250 multiplied by 4.6mm, the temperature is 35 ℃, the mobile phase is water (containing 0.1% formic acid), the phase B is acetonitrile, the flow rate is 1mL/min, the sample injection amount is 20 mu L, the liquid chromatography gradient and time are 0-30 min 30-80% B, 30-31min 80-100% B, 31-35 min 100% B, 35-36 min 100-30% B, and the main product of the crude extract can be primarily judged to be Nodulisporcoic A.

Analysis of main product content: through peak area calculation, under 254nm wavelength, the peak area ratio of the product is 52.71%, namely, the content of Nodulisporcoic acid A in the GYP liquid culture medium crude extract can reach 52.71% theoretically.

The GYP liquid culture medium is used for fermenting the Monilinia fructicola (Hypomontagnella monticulosa) YX702 and 600mLGYP liquid culture medium, thereby obtaining 220.00mg of crude extract, and the content of the main product Nodulisporcid A can reach 52.71 percent (115.962 mg). The calculated Nodulisporcid A content in the crude extract of 1.00g can reach 0.5217g.

Example 4 preparation of Nodulispora A ester derivatives and in vitro cell Activity test

(1) The synthesis method and activity detection method of the ester derivative of Nodulisporcid A comprise the following steps:

122mg of Nodulisporcid A prepared in example 2 and 9.8mg of p-toluenesulfonic acid are weighed respectively, and 7 round bottom flasks are put into for standby; weighing 5mL of methanol, ethanol, n-propanol, benzyl alcohol, 2-phenethyl alcohol, 3-phenylpropanol and p-methoxybenzyl alcohol respectively, and putting the mixture into the 7 round bottom flasks respectively for standby; 20mL of the ultra-dry dichloromethane solvent was weighed and put into each of the above 7 round-bottomed flasks for use.

(2) In the step (1), a magnetic rotor was added to each round bottom flask, and the reaction was carried out by heating to 70℃in a heated reflux apparatus equipped with a magnetic stirrer for 6 hours.

(3) And (3) placing the round-bottomed flask in the step (2) in a normal temperature environment, and dripping saturated sodium bicarbonate solution until the solution is neutral, and stopping the reaction.

(4) The methylene chloride solvent and water (vacuum 0.09MPa, temperature 45 ℃ C.) in the round-bottomed flask solution in step (3) were removed by distillation under reduced pressure to give a pale yellow oily liquid.

(5) Purifying the pale yellow oily liquid in the step (4) by using silica gel column chromatography (column chromatography is normal phase silica gel column chromatography, normal phase silica gel used is 200-300 meshes, petroleum ether-ethyl acetate system elution is carried out at normal temperature and normal pressure in a ratio of 3:2), removing solvent of an elution system by reduced pressure distillation to obtain the pale yellow oily liquid, and drying by using a vacuum drying box (drying by using a vacuum drying box, wherein the vacuum degree is 0.09MPa, the drying temperature is 35 ℃ C., and the drying time is 24 hours), so as to obtain methyl ester, ethyl ester, n-propyl ester, benzyl ester, 2-phenethyl ester, 3-phenylpropyl ester and p-methoxybenzyl ester of the Nodulisporcid A.

(6) MCF-7 breast cancer cell suspension (10 mu L) in logarithmic growth phase is inoculated into 96-well plates according to the cell density of 4000 cells/well, 190 mu L of DMEM culture medium is added into each well, and the mixture is cultured for 24 hours in a carbon dioxide incubator (the DMEM culture medium contains 10% fetal bovine serum, 1% penicillin and 1% streptomycin, the culture condition of the carbon dioxide incubator is saturated humidity, the carbon dioxide concentration is 5%, and the culture temperature is 37 ℃).

(7) Diluting the Nodulisporcid A ester derivative prepared in the step (5) and the 5-fluorouracil and Nodulisporcid A to the concentration of 80, 40, 20, 10 and 5 mu M respectively by using a DMEM culture medium; mu.L of each was added to a 96-well plate (3 replicates for all concentrations were used as a group) and incubated in a carbon dioxide incubator for 24 hours.

(8) Adding 10 mu L of MTT solution (with the concentration of 5 mg/mL) into the 96-well plate in the step (7), culturing for 4 hours, removing the upper layer of culture medium by using a discharge gun, adding 100 mu L of DSMO, oscillating for 10 minutes by using a micro-mixing oscillator, measuring the optical density value of each well at the wavelength of 540/655nm by using an enzyme-labeling instrument, and calculating the IC ₅₀ Value (IC using GraphPad Prism 7 software ₅₀ Value calculation), IC ₅₀ The values are shown in table 2.

Table 2: cytotoxic activity test result of Nodulisporcid A and ester derivatives thereof on MCF-7 breast cancer cells

As can be seen from Table 2, although Nodulisporcid A has low cytotoxic activity on MCF-7 breast cancer cells, ester derivatives of Nodulisporcid A have a certain cytotoxicity on MCF-7 breast cancer cells; among them, nodulisporic acid a benzyl ester has the best cytotoxic activity and shows stronger cytotoxic activity than 5-fluorouracil of the positive control group; namely, the ester compound of Nodulisporcid A can be used for resisting tumors.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

SEQUENCE LISTING

<110> university of medical science in Guangzhou

<120> a strain of mountain Monilinia and application thereof

<130>

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> DNA

<213> artificial sequence

<400> 1

tccgtaggtg aacctgcgg 19

<210> 2

<211> 20

<212> DNA

<213> artificial sequence

<400> 2

tcctccgctt attgatatgc 20

<210> 3

<211> 555

<212> DNA

<213> Hypomontagnella monticulosa

<400> 3

gggttaatgg atatcaaaac tcccaaccct ttgtgactta ccactgttgc ctcggcgagt 60

tgtgctaccc tatagctacc ctgtagctac ccgggaacac attccaagct cgccagagga 120

cctaccaact ctgttttata ctgtatctct gaactttata actaaataag ttaaaacttt 180

caacaacgga tctcttggtt ctggcatcga tgaagaacgc agcgaaatgc gataagtaat 240

gtgaattgca gaattcagtg aatcatcgaa tctttgaacg cacattgcgc ccattagtat 300

tctagtgggc atgcctattc gagcgtcatt tcaaccctta agcctcagtt gcttagcatt 360

gggactctac gacctattat agcgtagttc cttaaagtta gtggcggagt tatagcacac 420

tctaagcgta gtaattctct ctcgcttctt gtagtggtta tagttgctag ccataaaaca 480

ccccctattt taatggttga cctcggatta ggtaggaata cccgctgaac ttaagcatat 540

caataagcgg aggaa 555

Claims

1. Monilinia mountain strain named Monilinia mountain strainHypomontagnella monticulosa) YX702, classified and namedHypomontagnella monticulosaThe microbial strain is preserved in China general microbiological culture Collection center (CGMCC) No.40063, which is No.1 and No.3 of North west road, korea, the region of Chaoyang, beijing, at 1 month 17 of 2022.

2. A microbial agent comprising: the mountain Monilinia fructicola of claim 1.

3. Use of the mountain morganella and/or the microbial inoculum of claim 1 in the preparation of an antimalarial drug.

4. Use of the mountain Monilinia and/or the microbial inoculum of claim 2 in the preparation of a derivative of Nodulisporcid A;

the derivatives of Nodulisporcid A are ester compounds of Nodulisporcid A;

the ester compound of Nodulisporacic acid A is selected from at least one of methyl ester of Nodulisporacic acid A, ethyl ester of Nodulisporacic acid A, n-propyl ester of Nodulisporacic acid A, n-butyl ester of Nodulisporacic acid A, benzyl ester of Nodulisporacic acid A, 2-phenethyl ester of Nodulisporacic acid A, 3-phenylpropyl ester of Nodulisporacic acid A, p-methoxybenzyl ester of Nodulisporacic acid A and 3-methoxybenzyl ester of Nodulisporacic acid A.

5. The use of the mountain morganella of claim 1 and/or the microbial inoculum of claim 2 in the preparation of an antitumor drug;

the tumor is at least one of breast cancer, lung cancer, bile duct cancer, oral epidermoid carcinoma, cervical cancer, liver cancer and leukemia;

the active ingredients of the antitumor drug comprise: ester compounds of nodulisporic acid a;